ID: 1119179235

View in Genome Browser
Species Human (GRCh38)
Location 14:72593812-72593834
Sequence CATTCTAAGAAGAGGTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119179235_1119179240 -1 Left 1119179235 14:72593812-72593834 CCACCCCACCTCTTCTTAGAATG No data
Right 1119179240 14:72593834-72593856 GTCCAGAAGCTGACATGTTCAGG No data
1119179235_1119179242 16 Left 1119179235 14:72593812-72593834 CCACCCCACCTCTTCTTAGAATG No data
Right 1119179242 14:72593851-72593873 TTCAGGAAGCTGAACCGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119179235 Original CRISPR CATTCTAAGAAGAGGTGGGG TGG (reversed) Intergenic
No off target data available for this crispr