ID: 1119179263

View in Genome Browser
Species Human (GRCh38)
Location 14:72593938-72593960
Sequence GAGGGTCATCAGAGGGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119179251_1119179263 1 Left 1119179251 14:72593914-72593936 CCCCTCATCCTGTGAGGGGAAAC No data
Right 1119179263 14:72593938-72593960 GAGGGTCATCAGAGGGGTGGGGG No data
1119179250_1119179263 2 Left 1119179250 14:72593913-72593935 CCCCCTCATCCTGTGAGGGGAAA No data
Right 1119179263 14:72593938-72593960 GAGGGTCATCAGAGGGGTGGGGG No data
1119179253_1119179263 -1 Left 1119179253 14:72593916-72593938 CCTCATCCTGTGAGGGGAAACTG No data
Right 1119179263 14:72593938-72593960 GAGGGTCATCAGAGGGGTGGGGG No data
1119179256_1119179263 -7 Left 1119179256 14:72593922-72593944 CCTGTGAGGGGAAACTGAGGGTC No data
Right 1119179263 14:72593938-72593960 GAGGGTCATCAGAGGGGTGGGGG No data
1119179252_1119179263 0 Left 1119179252 14:72593915-72593937 CCCTCATCCTGTGAGGGGAAACT No data
Right 1119179263 14:72593938-72593960 GAGGGTCATCAGAGGGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119179263 Original CRISPR GAGGGTCATCAGAGGGGTGG GGG Intergenic
No off target data available for this crispr