ID: 1119179771

View in Genome Browser
Species Human (GRCh38)
Location 14:72597964-72597986
Sequence CACCCTGTGCCCTCCTAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119179763_1119179771 8 Left 1119179763 14:72597933-72597955 CCCACCCCATTCCCACTCAAGGG No data
Right 1119179771 14:72597964-72597986 CACCCTGTGCCCTCCTAAAATGG No data
1119179766_1119179771 4 Left 1119179766 14:72597937-72597959 CCCCATTCCCACTCAAGGGTGTT No data
Right 1119179771 14:72597964-72597986 CACCCTGTGCCCTCCTAAAATGG No data
1119179758_1119179771 19 Left 1119179758 14:72597922-72597944 CCCCTCCTGAACCCACCCCATTC No data
Right 1119179771 14:72597964-72597986 CACCCTGTGCCCTCCTAAAATGG No data
1119179756_1119179771 27 Left 1119179756 14:72597914-72597936 CCTTTCCTCCCCTCCTGAACCCA No data
Right 1119179771 14:72597964-72597986 CACCCTGTGCCCTCCTAAAATGG No data
1119179768_1119179771 2 Left 1119179768 14:72597939-72597961 CCATTCCCACTCAAGGGTGTTGA No data
Right 1119179771 14:72597964-72597986 CACCCTGTGCCCTCCTAAAATGG No data
1119179767_1119179771 3 Left 1119179767 14:72597938-72597960 CCCATTCCCACTCAAGGGTGTTG No data
Right 1119179771 14:72597964-72597986 CACCCTGTGCCCTCCTAAAATGG No data
1119179770_1119179771 -4 Left 1119179770 14:72597945-72597967 CCACTCAAGGGTGTTGAGACACC No data
Right 1119179771 14:72597964-72597986 CACCCTGTGCCCTCCTAAAATGG No data
1119179759_1119179771 18 Left 1119179759 14:72597923-72597945 CCCTCCTGAACCCACCCCATTCC No data
Right 1119179771 14:72597964-72597986 CACCCTGTGCCCTCCTAAAATGG No data
1119179765_1119179771 7 Left 1119179765 14:72597934-72597956 CCACCCCATTCCCACTCAAGGGT No data
Right 1119179771 14:72597964-72597986 CACCCTGTGCCCTCCTAAAATGG No data
1119179760_1119179771 17 Left 1119179760 14:72597924-72597946 CCTCCTGAACCCACCCCATTCCC No data
Right 1119179771 14:72597964-72597986 CACCCTGTGCCCTCCTAAAATGG No data
1119179757_1119179771 22 Left 1119179757 14:72597919-72597941 CCTCCCCTCCTGAACCCACCCCA No data
Right 1119179771 14:72597964-72597986 CACCCTGTGCCCTCCTAAAATGG No data
1119179769_1119179771 -3 Left 1119179769 14:72597944-72597966 CCCACTCAAGGGTGTTGAGACAC No data
Right 1119179771 14:72597964-72597986 CACCCTGTGCCCTCCTAAAATGG No data
1119179761_1119179771 14 Left 1119179761 14:72597927-72597949 CCTGAACCCACCCCATTCCCACT No data
Right 1119179771 14:72597964-72597986 CACCCTGTGCCCTCCTAAAATGG No data
1119179755_1119179771 30 Left 1119179755 14:72597911-72597933 CCTCCTTTCCTCCCCTCCTGAAC No data
Right 1119179771 14:72597964-72597986 CACCCTGTGCCCTCCTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119179771 Original CRISPR CACCCTGTGCCCTCCTAAAA TGG Intergenic