ID: 1119181250

View in Genome Browser
Species Human (GRCh38)
Location 14:72606678-72606700
Sequence ATTTCAACACGGAATTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119181250_1119181254 -6 Left 1119181250 14:72606678-72606700 CCCACCAAATTCCGTGTTGAAAT No data
Right 1119181254 14:72606695-72606717 TGAAATGTGATCCCCAGTGTTGG 0: 197
1: 894
2: 2142
3: 3454
4: 3867
1119181250_1119181255 -3 Left 1119181250 14:72606678-72606700 CCCACCAAATTCCGTGTTGAAAT No data
Right 1119181255 14:72606698-72606720 AATGTGATCCCCAGTGTTGGAGG 0: 172
1: 835
2: 2295
3: 3913
4: 3935
1119181250_1119181265 22 Left 1119181250 14:72606678-72606700 CCCACCAAATTCCGTGTTGAAAT No data
Right 1119181265 14:72606723-72606745 GGGCCTAGTGGGAAGTGTTTGGG 0: 30
1: 283
2: 1163
3: 1869
4: 2040
1119181250_1119181262 10 Left 1119181250 14:72606678-72606700 CCCACCAAATTCCGTGTTGAAAT No data
Right 1119181262 14:72606711-72606733 GTGTTGGAGGTGGGGCCTAGTGG 0: 114
1: 1238
2: 3097
3: 4016
4: 4628
1119181250_1119181267 28 Left 1119181250 14:72606678-72606700 CCCACCAAATTCCGTGTTGAAAT No data
Right 1119181267 14:72606729-72606751 AGTGGGAAGTGTTTGGGTCGTGG No data
1119181250_1119181263 11 Left 1119181250 14:72606678-72606700 CCCACCAAATTCCGTGTTGAAAT No data
Right 1119181263 14:72606712-72606734 TGTTGGAGGTGGGGCCTAGTGGG 0: 184
1: 2016
2: 3834
3: 4220
4: 4418
1119181250_1119181258 2 Left 1119181250 14:72606678-72606700 CCCACCAAATTCCGTGTTGAAAT No data
Right 1119181258 14:72606703-72606725 GATCCCCAGTGTTGGAGGTGGGG 0: 237
1: 1360
2: 2901
3: 3621
4: 3238
1119181250_1119181264 21 Left 1119181250 14:72606678-72606700 CCCACCAAATTCCGTGTTGAAAT No data
Right 1119181264 14:72606722-72606744 GGGGCCTAGTGGGAAGTGTTTGG 0: 31
1: 273
2: 1405
3: 3646
4: 5612
1119181250_1119181268 29 Left 1119181250 14:72606678-72606700 CCCACCAAATTCCGTGTTGAAAT No data
Right 1119181268 14:72606730-72606752 GTGGGAAGTGTTTGGGTCGTGGG No data
1119181250_1119181257 1 Left 1119181250 14:72606678-72606700 CCCACCAAATTCCGTGTTGAAAT No data
Right 1119181257 14:72606702-72606724 TGATCCCCAGTGTTGGAGGTGGG 0: 267
1: 1507
2: 3196
3: 4012
4: 3694
1119181250_1119181269 30 Left 1119181250 14:72606678-72606700 CCCACCAAATTCCGTGTTGAAAT No data
Right 1119181269 14:72606731-72606753 TGGGAAGTGTTTGGGTCGTGGGG No data
1119181250_1119181256 0 Left 1119181250 14:72606678-72606700 CCCACCAAATTCCGTGTTGAAAT No data
Right 1119181256 14:72606701-72606723 GTGATCCCCAGTGTTGGAGGTGG 0: 198
1: 1372
2: 3236
3: 4077
4: 3789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119181250 Original CRISPR ATTTCAACACGGAATTTGGT GGG (reversed) Intergenic
No off target data available for this crispr