ID: 1119182782

View in Genome Browser
Species Human (GRCh38)
Location 14:72615611-72615633
Sequence CCAGGGAAGAGCCTGTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119182782_1119182789 -8 Left 1119182782 14:72615611-72615633 CCCACCCACAGGCTCTTCCCTGG No data
Right 1119182789 14:72615626-72615648 TTCCCTGGTTCCAGTCGGCTGGG No data
1119182782_1119182793 7 Left 1119182782 14:72615611-72615633 CCCACCCACAGGCTCTTCCCTGG No data
Right 1119182793 14:72615641-72615663 CGGCTGGGCTCAGCCTGCCCAGG No data
1119182782_1119182788 -9 Left 1119182782 14:72615611-72615633 CCCACCCACAGGCTCTTCCCTGG No data
Right 1119182788 14:72615625-72615647 CTTCCCTGGTTCCAGTCGGCTGG No data
1119182782_1119182794 14 Left 1119182782 14:72615611-72615633 CCCACCCACAGGCTCTTCCCTGG No data
Right 1119182794 14:72615648-72615670 GCTCAGCCTGCCCAGGCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119182782 Original CRISPR CCAGGGAAGAGCCTGTGGGT GGG (reversed) Intergenic