ID: 1119183683

View in Genome Browser
Species Human (GRCh38)
Location 14:72621296-72621318
Sequence CCTTGCATACAGGAGCTGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119183680_1119183683 -8 Left 1119183680 14:72621281-72621303 CCACTGTAGAGACTTCCTTGCAT 0: 1
1: 0
2: 1
3: 7
4: 149
Right 1119183683 14:72621296-72621318 CCTTGCATACAGGAGCTGCTCGG 0: 1
1: 0
2: 0
3: 17
4: 208
1119183679_1119183683 6 Left 1119183679 14:72621267-72621289 CCTCATCACTGCATCCACTGTAG 0: 1
1: 1
2: 1
3: 19
4: 189
Right 1119183683 14:72621296-72621318 CCTTGCATACAGGAGCTGCTCGG 0: 1
1: 0
2: 0
3: 17
4: 208
1119183678_1119183683 29 Left 1119183678 14:72621244-72621266 CCTTGGGGGCAAAATCTTGTTTT 0: 1
1: 0
2: 3
3: 24
4: 223
Right 1119183683 14:72621296-72621318 CCTTGCATACAGGAGCTGCTCGG 0: 1
1: 0
2: 0
3: 17
4: 208
1119183677_1119183683 30 Left 1119183677 14:72621243-72621265 CCCTTGGGGGCAAAATCTTGTTT 0: 1
1: 0
2: 1
3: 15
4: 181
Right 1119183683 14:72621296-72621318 CCTTGCATACAGGAGCTGCTCGG 0: 1
1: 0
2: 0
3: 17
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119183683 Original CRISPR CCTTGCATACAGGAGCTGCT CGG Intronic
900724499 1:4207057-4207079 CAGTGCCTACAGGAGATGCTTGG - Intergenic
901681393 1:10914809-10914831 CCTTGCTTATAGAAGCTGCCTGG - Intergenic
902694592 1:18131870-18131892 ACTTGCATACAGGAGAGACTGGG + Intronic
902936687 1:19769692-19769714 CCTGGCAGAGAGGAGCTGGTGGG + Intronic
903280909 1:22249306-22249328 CCCTGCCTGCAGGAGGTGCTGGG - Intergenic
904601882 1:31677720-31677742 ACCTGAATAAAGGAGCTGCTTGG + Intronic
906197398 1:43937383-43937405 CCTCCCATCCCGGAGCTGCTGGG - Intergenic
907254063 1:53164873-53164895 CCTTGCCTAAAAGAGCTGCTAGG - Intergenic
908002275 1:59691960-59691982 CCTGACATAGAGTAGCTGCTTGG + Intronic
912698776 1:111860974-111860996 CCTTTCAAACAGGAGCTGTCTGG + Intronic
913327406 1:117638837-117638859 ACCTGCATACAGCAGCTGCTTGG + Intergenic
913966348 1:143380533-143380555 CCTGGCATACAGCAGGTGCCTGG - Intergenic
914060721 1:144206140-144206162 CCTGGCATACAGCAGGTGCCTGG - Intergenic
914118429 1:144760229-144760251 CCTGGCATACAGCAGGTGCCTGG + Intergenic
915042651 1:152981861-152981883 CCTGGCGTGCAGAAGCTGCTTGG - Intergenic
915648190 1:157288759-157288781 CCCTCCCTCCAGGAGCTGCTGGG - Intergenic
919396847 1:197060366-197060388 CTTCGCATACAGGAGATTCTGGG + Exonic
920112548 1:203597532-203597554 CCTGGCACACAGCAGTTGCTTGG + Intergenic
920671637 1:208008133-208008155 GTTTGCATACAGGAGATGCATGG + Intergenic
921671511 1:217929500-217929522 AAATGCAAACAGGAGCTGCTTGG - Intergenic
921940224 1:220831289-220831311 GCTTGCAGACAGGAGGTGGTGGG - Intergenic
922976229 1:229785655-229785677 CCTTGGGGACAGGAGCTGCAGGG + Intergenic
1063506244 10:6602461-6602483 CTGTGCAAACACGAGCTGCTTGG + Intergenic
1063654640 10:7975633-7975655 GCCTGCATGCAGGAGATGCTCGG - Intronic
1064145836 10:12825770-12825792 CCTGGCAAACAGGAGGTGCTCGG - Intronic
1067578220 10:47420943-47420965 CCTTGCACCCAGGATCTGCCCGG + Intergenic
1068093681 10:52464142-52464164 CATTGCATTCAAGAGCAGCTAGG + Intergenic
1069747327 10:70724069-70724091 CCTGGCACACAGTAGGTGCTTGG + Intronic
1070294280 10:75145973-75145995 CCTTACATACATGTGCTGATAGG + Intronic
1070299084 10:75189738-75189760 CTGTGTAAACAGGAGCTGCTTGG - Intergenic
1070317588 10:75330182-75330204 CCTTGCATCCAGGGGTTGCATGG + Intergenic
1071879437 10:89879313-89879335 CCTTGTACACAGGAGTTGGTGGG - Intergenic
1072867551 10:99079818-99079840 CCTGGCATACTTTAGCTGCTTGG - Intronic
1075046500 10:119150348-119150370 CCTGGCAGGCAGGAGGTGCTGGG + Intronic
1075875854 10:125804950-125804972 CCTGGCACACAGGTGCTCCTGGG + Intronic
1077648566 11:3948851-3948873 CCTGGCATATAGTAGATGCTTGG - Intronic
1080004032 11:27386137-27386159 CATTGATTCCAGGAGCTGCTTGG - Intronic
1082189122 11:49221037-49221059 CCCTTCATTCAGGAGCTCCTGGG + Intergenic
1082857274 11:57819534-57819556 CTTAGCATATAGGAGGTGCTTGG - Intronic
1083885420 11:65571152-65571174 GCTGGCACACAGGAGGTGCTTGG - Intronic
1084544467 11:69807804-69807826 CCTTACACACAGGAGGGGCTGGG - Intergenic
1084653862 11:70503996-70504018 GCTCCCATTCAGGAGCTGCTGGG - Intronic
1086228855 11:84544743-84544765 CCTGGCATACAGTGGCTGCTTGG + Intronic
1086275318 11:85120979-85121001 CTATGCATACAGGAGCTGAATGG - Intronic
1087510470 11:99086197-99086219 CTTTGCATTTGGGAGCTGCTGGG - Intronic
1088819026 11:113441414-113441436 GCTTGCATACAGGATTTGTTGGG + Intronic
1089809645 11:121121214-121121236 CCTGGCACACAGTAGGTGCTCGG + Intronic
1092527462 12:9318054-9318076 CCTTGCACACAGGCACTGTTGGG + Intergenic
1092539813 12:9413718-9413740 CCTTGCACACAGGCACTGTTGGG - Intergenic
1097144636 12:56931741-56931763 CCTTGCATGAAGGAGCTGGAAGG - Intronic
1099370509 12:81824332-81824354 CCTTTCATACAGAAACTTCTAGG + Intergenic
1101732134 12:107435566-107435588 CCTGGCACACAGTAGGTGCTAGG + Intronic
1103058816 12:117842622-117842644 CCTGGCATCCACGAGGTGCTGGG - Intronic
1103983559 12:124752287-124752309 CCTGGCATACAGTAGGTGCTCGG - Intergenic
1104415565 12:128594453-128594475 CCTTGCATATTGCAGGTGCTTGG + Intronic
1106100615 13:26692765-26692787 CCTTACATACTGGTGATGCTAGG - Intergenic
1107670984 13:42746079-42746101 CCTTGCATTCAGCAGCTCCATGG + Intergenic
1107759488 13:43661859-43661881 CCTTGCATATAGTAGATACTCGG - Intronic
1112493443 13:99886920-99886942 CCTGGCACAAGGGAGCTGCTCGG + Intronic
1113602937 13:111583959-111583981 CTTTGCACAGAGAAGCTGCTTGG + Intergenic
1113625471 13:111793098-111793120 CCTTGCAGACAGCAGGTGCTTGG + Intergenic
1113744301 13:112732141-112732163 CCCTGAATGGAGGAGCTGCTTGG - Intronic
1115308678 14:31957691-31957713 CCATGCATAGTGGAGCTTCTGGG - Intergenic
1117852215 14:59986263-59986285 CCATGTAAACAGGAGATGCTGGG - Intronic
1118727489 14:68639432-68639454 CCTTGCATGCAGGAGGGGCCAGG - Intronic
1119183683 14:72621296-72621318 CCTTGCATACAGGAGCTGCTCGG + Intronic
1121001808 14:90456540-90456562 CCCTGTATACAGGTGCTTCTGGG + Intergenic
1121208779 14:92190862-92190884 CTTTGCAGATGGGAGCTGCTGGG + Intergenic
1121845711 14:97170277-97170299 CATTCCAAACAGGAGCTGCAGGG + Intergenic
1124341915 15:28895206-28895228 CCCTGCACACTGGAGCTGCCTGG - Intronic
1125130618 15:36279688-36279710 ACTTGCAGACAGGGGCAGCTTGG - Intergenic
1126223736 15:46245221-46245243 CCTTTCTTACATGAGCTGCTTGG - Intergenic
1127271087 15:57402693-57402715 ACTTGCATATAGTAGGTGCTTGG + Intronic
1127754438 15:62077329-62077351 CCTTCCCTAAAGGTGCTGCTAGG - Intergenic
1128097581 15:64969752-64969774 GCTTGCATTTAGGAACTGCTGGG - Intronic
1128231519 15:66038839-66038861 CTTTGGATCCAGGTGCTGCTCGG - Intronic
1129689048 15:77702908-77702930 CCTGCCCTCCAGGAGCTGCTGGG - Intronic
1129976119 15:79823245-79823267 CCTTGCATTTAGTAGCTACTTGG - Intergenic
1130907169 15:88249017-88249039 CCATGCCTGGAGGAGCTGCTGGG + Intronic
1131150237 15:90043122-90043144 GCCTGCACACAGGAGGTGCTCGG - Intronic
1132067186 15:98741722-98741744 CTTTGCATACAGTATCTCCTGGG - Intronic
1136276798 16:29183590-29183612 CCATGTCTCCAGGAGCTGCTGGG - Intergenic
1138000456 16:53273627-53273649 CCCTGGGTACAGGAGCTGATAGG - Exonic
1138026772 16:53528296-53528318 CCTTGAATACTGGACCTTCTTGG + Intergenic
1138336736 16:56259301-56259323 CCTTGCACTCAGGAGGTGTTGGG + Intronic
1139210709 16:65073889-65073911 CCTTGCAGAAAGTAGATGCTTGG + Intronic
1139286705 16:65821774-65821796 ATTTGCATACAGGAGATTCTTGG + Intergenic
1139636249 16:68260220-68260242 CCCTGCCTGCAGGAGCTACTAGG - Exonic
1139788145 16:69410762-69410784 CATTGCACACAGTAGGTGCTTGG - Intergenic
1139954609 16:70687109-70687131 CCTTTCATCCAGGAACTCCTGGG + Intergenic
1140202177 16:72903602-72903624 CCTTGCATTCTGGAGCAGATGGG - Intronic
1141212321 16:81993105-81993127 CCCTGCATAAAGGAGCAGGTGGG + Exonic
1142081177 16:88149650-88149672 CCATGTCTCCAGGAGCTGCTGGG - Intergenic
1143346218 17:6251094-6251116 CCTTGGAAACAGGAGCTCCTGGG + Intergenic
1143652998 17:8275856-8275878 TCTTACATACAGCAGGTGCTGGG - Intergenic
1144769754 17:17752918-17752940 CCTGGCACACAGTAGGTGCTCGG + Intronic
1145236015 17:21208952-21208974 CCTATGATACAGGAGGTGCTGGG + Intronic
1146374143 17:32283192-32283214 CCTGGCGTCCAGGAGATGCTTGG + Intronic
1148804899 17:50259153-50259175 CCCTGCAGACGGGAGCTGCTGGG - Intergenic
1150327805 17:64270781-64270803 CATTGTAGACAGAAGCTGCTTGG - Intergenic
1151649627 17:75458206-75458228 CGTTGCATACAGGAACAGCGTGG + Intronic
1151830312 17:76545409-76545431 CCTTGCAAAGAGCCGCTGCTTGG + Intronic
1151896809 17:76986315-76986337 CCTTGCACCCAGGCCCTGCTTGG - Intergenic
1152535815 17:80949810-80949832 GCTTGCAGACATGTGCTGCTTGG + Intronic
1153772493 18:8426690-8426712 CCAAGCAGACAGGAGCTGTTAGG - Intergenic
1155588381 18:27395673-27395695 ACTTGCAGACAGCAGATGCTAGG - Intergenic
1156290952 18:35748209-35748231 CCTGGCACACAGTAGGTGCTTGG - Intergenic
1161145976 19:2678388-2678410 CTTTGGATTCAGAAGCTGCTGGG + Intronic
1161511492 19:4674781-4674803 CGTTGCAAACAGGGTCTGCTGGG + Intergenic
1162780756 19:13006003-13006025 CCTGGCACCCAGGAGGTGCTTGG - Intronic
1162947534 19:14052959-14052981 CCTTGCATCCAGGTGCAGCATGG + Exonic
1164457695 19:28422070-28422092 CCTTGGTTACAGGATCTTCTGGG + Intergenic
1164884789 19:31769503-31769525 GATTGAATACAGGAGCTGTTGGG + Intergenic
1168680982 19:58315755-58315777 CCATGCATACAGGCACTCCTCGG - Intergenic
1202700129 1_KI270712v1_random:158028-158050 CCTGGCATACAGCAGGTGCCTGG - Intergenic
925197649 2:1939723-1939745 CCTTTGATATAGAAGCTGCTTGG + Intronic
925350129 2:3195248-3195270 CCGTGCAGGTAGGAGCTGCTGGG - Intronic
925706935 2:6694621-6694643 CCTAGAAGACAGGAGCTCCTGGG + Intergenic
926756855 2:16243472-16243494 CCTTGAATCAAGGAGCTGCTTGG + Intergenic
927226015 2:20767067-20767089 CCTGGCATTCAGGGGCAGCTGGG - Intronic
932494761 2:72140811-72140833 CCCTGCCTACAGGACCTTCTGGG - Intronic
934171062 2:89541503-89541525 CCTGGCATACAGCAGGTGCCTGG - Intergenic
934281367 2:91615821-91615843 CCTGGCATACAGCAGGTGCCTGG - Intergenic
935897454 2:107753111-107753133 CCTTGACTACAGCCGCTGCTGGG - Intergenic
936522025 2:113217546-113217568 CCTTGGGGGCAGGAGCTGCTGGG + Exonic
938298201 2:130191697-130191719 CTCTGCCTACAGGAGCTGGTGGG - Intergenic
938613547 2:132973922-132973944 CCTTGCAACCAAGAGCTACTTGG - Intronic
945121109 2:206458236-206458258 CCTGGCATACAGGAGGTACATGG + Intronic
945862638 2:215141177-215141199 CATTGCATACAGGACCTGTGAGG + Intergenic
946277948 2:218644683-218644705 GCTTGCATAGCGGAGCTGCCAGG + Exonic
947336285 2:229088289-229088311 CCTGGCTTACAGTAGTTGCTCGG - Intronic
947444808 2:230155617-230155639 CCTCGCACACAGTAGCTACTCGG - Intergenic
947595970 2:231412132-231412154 CCGGGCAGCCAGGAGCTGCTGGG + Intergenic
948782203 2:240328805-240328827 CCTTCCATTCAGGGGCTGCCGGG - Intergenic
1169276013 20:4234197-4234219 CCAGGCCTGCAGGAGCTGCTGGG + Intronic
1170162214 20:13325078-13325100 CCTTGCATCCAGGAGCTCCCTGG - Intergenic
1171316697 20:24201831-24201853 CCTTGCGTGGAGGTGCTGCTGGG - Intergenic
1172031732 20:31987063-31987085 CCTTGGATACTGGATCTGTTTGG - Intronic
1172031762 20:31987300-31987322 CCTTGGATACTGGATCTGTTTGG - Intronic
1172031772 20:31987376-31987398 CCTTGGATACTGGGTCTGCTTGG - Intronic
1172031783 20:31987452-31987474 CCTTGGATACTGGGTCTGCTTGG - Intronic
1172175753 20:32970935-32970957 CCTGGCACACAGCAGCTGCTGGG + Intergenic
1172609285 20:36237521-36237543 CCTAGCACAGAGGAGATGCTAGG - Intronic
1173569150 20:44065776-44065798 CATGGCATACATGGGCTGCTTGG - Exonic
1174136943 20:48386281-48386303 ACGTCCATGCAGGAGCTGCTGGG - Intergenic
1180069953 21:45431284-45431306 CCCTGCACACAGCAGGTGCTCGG - Intronic
1180245573 21:46545381-46545403 CCTTCCACACAGGCGCTGCTGGG + Intronic
1181674330 22:24441900-24441922 CCTAGGGTTCAGGAGCTGCTGGG + Exonic
1182929961 22:34163888-34163910 TCTTCCATATAGGAGCTCCTTGG - Intergenic
1183309616 22:37102341-37102363 CCTGGCACACAGGAGGTGCTTGG + Intronic
1183498573 22:38164482-38164504 CCAGGCATGCAGGACCTGCTGGG + Intronic
1184087225 22:42272115-42272137 CCTGGCATGCAGGAGGTGTTGGG - Intronic
1185137920 22:49083824-49083846 CCCTGGATGCAGGAGGTGCTGGG + Intergenic
950314816 3:11991979-11992001 TCTTGCACAGAGCAGCTGCTGGG + Intergenic
952219292 3:31308535-31308557 CATTGCAGACAGGAGTTGCCTGG - Intergenic
954432635 3:50479327-50479349 CCTGGCATCCTGGACCTGCTGGG + Intronic
954441748 3:50525967-50525989 CCTGGGACCCAGGAGCTGCTGGG + Intergenic
954688933 3:52385611-52385633 CCTGGCATAGAAGAGCTACTGGG - Intronic
958667661 3:97161044-97161066 CTTTGCATTCAGGGCCTGCTTGG + Intronic
958910614 3:99990116-99990138 TCTGGCATACAATAGCTGCTGGG - Intronic
959172883 3:102864800-102864822 CATTGCAGACAGTACCTGCTTGG - Intergenic
960003642 3:112759768-112759790 CATTTCATGCAGCAGCTGCTTGG + Intronic
962119010 3:132542214-132542236 CCTTGTAGACAGGAGCGTCTAGG + Intergenic
964338843 3:155686701-155686723 CCTTGCATATGGGAGATGCCTGG - Intronic
966297840 3:178444641-178444663 CCCAGGAGACAGGAGCTGCTGGG - Intronic
966983902 3:185162434-185162456 TCCTGCATTCAGGAGCTGCAGGG + Intergenic
967403201 3:189086432-189086454 CATTGCATCCTGGAGCTTCTGGG + Intronic
967650073 3:191974735-191974757 CCTTACATACAGATGCTCCTTGG - Intergenic
967822512 3:193851328-193851350 CCTTTTATCCTGGAGCTGCTAGG + Intergenic
967967694 3:194974980-194975002 CCTTGCATGAAGGCGCAGCTGGG - Intergenic
968549084 4:1213274-1213296 TCTTACACACAGGACCTGCTGGG - Intronic
970584423 4:17501656-17501678 CCTTGCTTGCTGGGGCTGCTGGG - Intronic
971285800 4:25289014-25289036 TCTTGAATACAGGACCTGATGGG + Intergenic
972477125 4:39460900-39460922 TCTTGCAGACAGGAGCACCTGGG + Exonic
972656150 4:41065566-41065588 CCATACATACATGAGCTGCCTGG + Exonic
979595713 4:122531985-122532007 CCGTGCCTTCAGGACCTGCTTGG + Intergenic
980956901 4:139438366-139438388 CTTTGCTTACAGGAACTGTTTGG - Intergenic
981595884 4:146421242-146421264 CCTTGCATACAGTAGTCACTAGG + Intronic
985495704 5:203878-203900 CCTTGCACACAGGCCCTGGTAGG - Exonic
985950002 5:3215655-3215677 CCTTGCGTTCAGGAACTTCTGGG + Intergenic
987999430 5:25330462-25330484 CCTGGCATTCAGGGGCTGCCTGG - Intergenic
988536305 5:32072305-32072327 CCCTGCTTACTGGAGGTGCTGGG - Exonic
988781211 5:34523492-34523514 CTTTGAAAACAGTAGCTGCTTGG - Intergenic
990350159 5:54908121-54908143 CCTTGCATATAACAGCTACTCGG + Intergenic
992908263 5:81369833-81369855 CTTTGCACACAGGAGCCTCTGGG - Intronic
994110327 5:95995800-95995822 CATTGGATATAGGAGCTGTTTGG - Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
995725847 5:115179808-115179830 CTTTGCATTCCGCAGCTGCTGGG + Intronic
996354612 5:122581831-122581853 CCTTCCAGACAGAAGCTGCTGGG - Intergenic
998678048 5:144432089-144432111 CCTTGCAAACAGATGCTGTTTGG + Intronic
1000743597 5:165001517-165001539 CCTGCCATCCAGGAGCTGATGGG - Intergenic
1001919798 5:175590912-175590934 CCTTTCATGCAGAGGCTGCTAGG - Intergenic
1003707800 6:8554130-8554152 CCTTGATTACAGAAGGTGCTAGG + Intergenic
1004234549 6:13862527-13862549 CCTTGGATACAGGAGCTATGAGG - Intergenic
1012136699 6:95566429-95566451 CCTTGCTTACTGGAGGTTCTTGG - Intergenic
1013174430 6:107665223-107665245 CCTTGCATTCAGGAGCTCCAAGG - Intergenic
1016637690 6:146313550-146313572 CCTTGTATACATTTGCTGCTGGG + Intronic
1017521277 6:155205483-155205505 CCTTACAATCAGGAGCTGCCTGG + Intronic
1017525068 6:155235199-155235221 CCTTGTGCACAGCAGCTGCTCGG + Intronic
1019183458 6:170207470-170207492 GCCTGCATCCAGGAGCTGCTAGG - Intergenic
1019520323 7:1457982-1458004 CCTTGCAGGCAGAAGATGCTGGG - Intronic
1019724334 7:2592806-2592828 CCCTGCACACAGCAGGTGCTCGG + Intronic
1023991846 7:45133270-45133292 CTGGGCACACAGGAGCTGCTGGG - Intergenic
1024935226 7:54705333-54705355 CCTTGGAGACAGAAGCTACTTGG + Intergenic
1027231646 7:76276253-76276275 CCTGGCACAAAGGAGGTGCTGGG - Intronic
1029644389 7:101844205-101844227 CCGTGTAAACAGAAGCTGCTGGG - Intronic
1035319175 7:158017449-158017471 CCCTGCACACAGGTGCTCCTGGG - Intronic
1035448818 7:158961405-158961427 CCTTTCCTGGAGGAGCTGCTTGG - Intergenic
1042756794 8:72223118-72223140 CAATGCATCCAGGAGCTCCTGGG + Intergenic
1048369921 8:133768358-133768380 CCTTGCATAGAGGAGGTGGCAGG + Intergenic
1049711948 8:144068781-144068803 CCTTGCAGCCAGGAGCTGGGAGG - Intergenic
1050319259 9:4434243-4434265 TCTGGCATACAGCAGGTGCTTGG - Intergenic
1050701348 9:8343210-8343232 GCTTGCATACAGGAGCTCTGTGG + Intronic
1051547350 9:18291411-18291433 CCTAGCATACCAGAGGTGCTAGG - Intergenic
1055080087 9:72260123-72260145 CCTTCCATCCAGAAGCTTCTTGG - Intergenic
1056314446 9:85374453-85374475 CCTTGAATGAAGGAGCGGCTGGG - Intergenic
1060887110 9:127162155-127162177 CTGAGCACACAGGAGCTGCTTGG - Intronic
1061420374 9:130470262-130470284 CCTTGGAGACGGGATCTGCTGGG + Intronic
1061956194 9:133962435-133962457 CCCTGCAGAGAGGAGCTGGTGGG + Intronic
1062128788 9:134881366-134881388 CTTTCCATCCAGGACCTGCTGGG + Intronic
1062466005 9:136681927-136681949 CTTTGCACACAGGAGGTGCAGGG - Intronic
1187024256 X:15417417-15417439 CCATACATACAGTAGCTACTTGG - Intronic
1188135913 X:26494811-26494833 CCTTCCCTACAGGAGCATCTGGG + Intergenic
1192396830 X:70790555-70790577 CCTTGCATGCAGAACCTTCTGGG - Intronic
1192583167 X:72301386-72301408 CATGGCATACAGGGGCTGGTTGG - Intronic
1201240615 Y:11954127-11954149 CCTTTTATTCAGGCGCTGCTAGG - Intergenic