ID: 1119184355

View in Genome Browser
Species Human (GRCh38)
Location 14:72629492-72629514
Sequence CCTGGCACTTGGGAGCAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 227}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119184355_1119184363 -6 Left 1119184355 14:72629492-72629514 CCAGGTTGCTCCCAAGTGCCAGG 0: 1
1: 0
2: 0
3: 24
4: 227
Right 1119184363 14:72629509-72629531 GCCAGGGTAACAGGCCCCAGGGG 0: 1
1: 0
2: 0
3: 23
4: 231
1119184355_1119184361 -8 Left 1119184355 14:72629492-72629514 CCAGGTTGCTCCCAAGTGCCAGG 0: 1
1: 0
2: 0
3: 24
4: 227
Right 1119184361 14:72629507-72629529 GTGCCAGGGTAACAGGCCCCAGG 0: 1
1: 1
2: 1
3: 8
4: 201
1119184355_1119184362 -7 Left 1119184355 14:72629492-72629514 CCAGGTTGCTCCCAAGTGCCAGG 0: 1
1: 0
2: 0
3: 24
4: 227
Right 1119184362 14:72629508-72629530 TGCCAGGGTAACAGGCCCCAGGG 0: 1
1: 0
2: 0
3: 28
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119184355 Original CRISPR CCTGGCACTTGGGAGCAACC TGG (reversed) Intronic