ID: 1119184777

View in Genome Browser
Species Human (GRCh38)
Location 14:72632632-72632654
Sequence CAGGAGGAAGGGAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25058
Summary {0: 4, 1: 63, 2: 681, 3: 4372, 4: 19938}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119184777 Original CRISPR CAGGAGGAAGGGAGGGAAGG AGG Intronic
Too many off-targets to display for this crispr