ID: 1119187850

View in Genome Browser
Species Human (GRCh38)
Location 14:72656366-72656388
Sequence AGTCGTAGTGGATCACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119187850_1119187854 20 Left 1119187850 14:72656366-72656388 CCAGCTTGTGATCCACTACGACT 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1119187854 14:72656409-72656431 AATTGTGCCTTGCCAGGTGATGG 0: 1
1: 0
2: 0
3: 10
4: 125
1119187850_1119187853 14 Left 1119187850 14:72656366-72656388 CCAGCTTGTGATCCACTACGACT 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1119187853 14:72656403-72656425 AGCTATAATTGTGCCTTGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119187850 Original CRISPR AGTCGTAGTGGATCACAAGC TGG (reversed) Intronic
900088072 1:908171-908193 AGTCGGAGGGCAGCACAAGCCGG + Intergenic
901048758 1:6415524-6415546 AGTCGTCTGGGATCACAGGCGGG + Exonic
904289142 1:29472370-29472392 AGTCCCAGTGGACCACAAGTCGG + Intergenic
920492742 1:206430053-206430075 TGTCTTAGCGGATCACCAGCCGG - Intronic
923981888 1:239333978-239334000 AGTCATAGTGGATGGCAAGGAGG + Intergenic
1066153521 10:32650617-32650639 AGTGGTACAGGCTCACAAGCTGG - Intronic
1089707151 11:120286937-120286959 AGCCACAGTGGACCACAAGCAGG + Intronic
1091010126 11:131993438-131993460 TGTAGTAGAGGATGACAAGCTGG + Intronic
1112662012 13:101520897-101520919 AGTGGTAATGAGTCACAAGCAGG + Intronic
1119187850 14:72656366-72656388 AGTCGTAGTGGATCACAAGCTGG - Intronic
1119557722 14:75566440-75566462 AGTCCTGGTGGCACACAAGCTGG - Intergenic
1126442359 15:48703258-48703280 AGTTTTTGTGGATCACAAGCTGG - Intergenic
1138895025 16:61193735-61193757 AGTAGTAGTAGAACAAAAGCAGG + Intergenic
1139003971 16:62548595-62548617 AGTCTTAGTAGGTCACATGCTGG + Intergenic
1143461762 17:7108651-7108673 AGGCGGGGTGGAGCACAAGCTGG - Intronic
1152808102 17:82367429-82367451 AATCTTAGTAAATCACAAGCAGG - Intergenic
1153938764 18:9957474-9957496 AGTGGTAGAAGATCACAAGTTGG - Intronic
1159934628 18:74353356-74353378 AGTAGCAGTGGACCACAAGGTGG + Exonic
1160946403 19:1645923-1645945 AGTCGTCGAGGCTCACAAGGTGG + Intronic
930024041 2:47019548-47019570 GGTCAGAGTGGATCACAAGTTGG + Intronic
932759855 2:74432164-74432186 AGTCTTACTGGATCACAGACAGG + Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
1170757189 20:19214494-19214516 ATTCCTAGTGGATTACACGCTGG + Intronic
961539871 3:127591980-127592002 AGTCCCAGAGGATCACAAGGTGG - Intronic
970032521 4:11692818-11692840 AGTCCCAGTGGATCACCTGCTGG + Intergenic
972246610 4:37251611-37251633 AGTCATAGTGGCTAACATGCAGG - Intronic
1006054954 6:31377460-31377482 AGTCCTAGGGGATCAGAAGTAGG - Intergenic
1006934958 6:37710872-37710894 AGTCGTACCAGCTCACAAGCTGG + Intergenic
1013775197 6:113671656-113671678 AGGAGAAGTGGCTCACAAGCAGG - Intergenic
1038594320 8:28872669-28872691 AGTCATATTGGATCACAAAGAGG + Intronic
1049792756 8:144479480-144479502 AGTCCAAGTGCATCCCAAGCAGG - Intronic
1053196666 9:36125160-36125182 AGACATAGAGGACCACAAGCTGG + Intergenic
1057796378 9:98160904-98160926 AGTCCTAGAGGGTCACAGGCAGG - Intronic
1059719020 9:116941178-116941200 AGTCTTAATGGATCTCAAACTGG - Intronic