ID: 1119188995

View in Genome Browser
Species Human (GRCh38)
Location 14:72666441-72666463
Sequence TCTTCCAAAGATGATCTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 1, 2: 0, 3: 24, 4: 280}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119188992_1119188995 10 Left 1119188992 14:72666408-72666430 CCTACAGGCATTTTACTGATTTC 0: 1
1: 0
2: 2
3: 23
4: 205
Right 1119188995 14:72666441-72666463 TCTTCCAAAGATGATCTTTGGGG 0: 1
1: 1
2: 0
3: 24
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119188995 Original CRISPR TCTTCCAAAGATGATCTTTG GGG Intronic
903961702 1:27061956-27061978 CTCTCCAAAGATCATCTTTGTGG - Intergenic
904177594 1:28641995-28642017 TTTTTAAAAGATGATCTTTTGGG + Intronic
904573719 1:31487978-31488000 TCTGTCAAAGATGTTCGTTGTGG - Intergenic
905625786 1:39490224-39490246 ACTTCCAAATGTGATTTTTGGGG + Intergenic
907093504 1:51752348-51752370 CTTTCCAAAGATGTTCCTTGTGG - Intronic
907221900 1:52913118-52913140 TCCTCCACAGATAATCTCTGAGG - Intronic
908373504 1:63507462-63507484 TCTCCCAAAGAACAGCTTTGGGG + Intronic
909331445 1:74416844-74416866 TCTTCCAAAATATATCTTTGTGG + Intronic
909395444 1:75166602-75166624 TCAACCAAAGATGAAATTTGTGG - Intergenic
909421700 1:75473892-75473914 TCTTCTAAATATGAGCTCTGTGG + Intronic
911589848 1:99734435-99734457 TCTACCTAAGTTGATTTTTGTGG - Intronic
912155721 1:106916467-106916489 ACTTGCAAAAATGGTCTTTGAGG + Intergenic
912740811 1:112195267-112195289 TCTTCCAAAAATAAAATTTGAGG + Intergenic
915560364 1:156683572-156683594 TCTTAGAAAGATCATCTTGGAGG + Intergenic
915892944 1:159788379-159788401 TCTTGCAAAGCTGTCCTTTGTGG - Intergenic
917933723 1:179843203-179843225 TCTTTTAAAAATGATTTTTGAGG + Exonic
918641643 1:186848204-186848226 TCTTTCATAGATGCTTTTTGTGG - Intronic
919582008 1:199388032-199388054 TCTGTCAAAGATGTTCGTTGTGG + Intergenic
922333874 1:224603025-224603047 TTTTCCAAAGATGATTTTGAGGG + Intronic
923208982 1:231786429-231786451 TCTTCAAAGGCTCATCTTTGGGG + Intronic
923380823 1:233416210-233416232 CCCTGCAAAGCTGATCTTTGTGG - Intergenic
924073077 1:240303137-240303159 CCTGCCTCAGATGATCTTTGGGG + Intronic
924237773 1:242013539-242013561 TTTTCCTAAAATGATATTTGAGG + Intergenic
1063465302 10:6239623-6239645 TCTTCCAGACAGCATCTTTGGGG + Intergenic
1063903623 10:10761057-10761079 TGTTCCATAGAAGATCTTTTTGG + Intergenic
1065404621 10:25350005-25350027 TCTTGTAAAGATGACCTTGGTGG + Intronic
1068019701 10:51566004-51566026 TCTTCCCAAGATGCTCTTCCAGG - Intronic
1068048626 10:51919632-51919654 TCTTCCAAAAATGTTCTTTAAGG + Intronic
1068651756 10:59529851-59529873 TCTTCCAAGGAATATCTTCGTGG - Intergenic
1069063977 10:63923363-63923385 TCTTGCAAAGAGGATATTTAGGG + Intergenic
1069319475 10:67150499-67150521 TGTTACTAACATGATCTTTGTGG - Intronic
1069416323 10:68204030-68204052 CCTTAGAAAGATGATGTTTGAGG - Intronic
1070905386 10:80067834-80067856 TCCTGCAAAGCTGTTCTTTGTGG + Intergenic
1070916636 10:80159240-80159262 ACTTCCACATATGAACTTTGGGG - Intronic
1071729248 10:88231622-88231644 TCATCCTAAGGTGACCTTTGGGG + Intergenic
1073526442 10:104187090-104187112 TCTGACAAAGATGATGTATGTGG + Intronic
1075883158 10:125872261-125872283 TCTTCCAAAGAGGAACTATGGGG - Intronic
1076224685 10:128764692-128764714 TCTTCCAAAGATGTGCTCTGTGG - Intergenic
1078483361 11:11699803-11699825 TCTTCCATTGATGAGCTGTGTGG - Intergenic
1078499745 11:11859618-11859640 TTTTCAAAAGATTATCTTTTGGG - Intronic
1079725404 11:23874460-23874482 TCTTCCAAATATGTTTTTAGAGG - Intergenic
1079860522 11:25664477-25664499 TCTTTCAAATATGATCTTTAGGG + Intergenic
1080214569 11:29826696-29826718 ACTTCCAAAGAATGTCTTTGTGG + Intergenic
1080413889 11:32051717-32051739 TCTGCCATAGATGTTGTTTGGGG - Intronic
1080580002 11:33634453-33634475 ACTTCCAGAGATGACCTTTAAGG + Intronic
1082247637 11:49942800-49942822 CCTTCCATAGATGCTCATTGGGG - Intergenic
1082797042 11:57385688-57385710 TCCCCCAAAGAAGATCTCTGTGG + Intergenic
1083464735 11:62837777-62837799 TCTTCCAAAGATGATGAAAGAGG - Intronic
1084452262 11:69246177-69246199 TCTTCCTAAAATGCTCTTTCTGG + Intergenic
1086420073 11:86630150-86630172 TCTTCAAAAGAACATTTTTGGGG - Intronic
1087955686 11:104284932-104284954 TCTTCCAACGGTGCTTTTTGTGG + Intergenic
1088872194 11:113900365-113900387 CCTTCCAAGGATGATGTCTGGGG + Intergenic
1090453198 11:126824540-126824562 TTTTCCAAAGATGATTTTGAGGG + Intronic
1090484181 11:127097750-127097772 TCTTCCAAAGATGATGAGAGAGG + Intergenic
1091113369 11:132992199-132992221 TCTTCCAAACCTGATATTTCAGG + Intronic
1091592078 12:1848676-1848698 TCTTCCAAAGATGGCCAATGAGG + Intronic
1091698770 12:2645900-2645922 TCTTCCAAAGTTGGTCTCTTTGG + Intronic
1091874526 12:3922841-3922863 TATTCCAAGGTTGATCTTTCTGG - Intergenic
1093154339 12:15663320-15663342 ACTTCCAAAGGTGATCTCTGTGG - Intronic
1095041458 12:37445960-37445982 TCCTCCAAAGATTCTCTTTCTGG + Intergenic
1095526759 12:43135192-43135214 TTTTACAAAGATGGTCTTTGAGG - Intergenic
1096480966 12:51940781-51940803 TCTTCCAAAGAAGGGCTTCGAGG - Intergenic
1099993018 12:89746603-89746625 TCTTCCATTGATGATTTATGGGG + Intergenic
1100247293 12:92772124-92772146 CCTTCCAAAAAGTATCTTTGGGG + Exonic
1101896815 12:108763169-108763191 TCTGCCAAAGATGTACTGTGTGG + Intergenic
1106107702 13:26748249-26748271 ACTACCAAATATCATCTTTGTGG + Intergenic
1106276667 13:28215455-28215477 TCTGTCAAAGATGTTCGTTGGGG + Intronic
1108156801 13:47593393-47593415 TCTTCTTAAGATGATCTGAGTGG - Intergenic
1108834628 13:54527394-54527416 TCTTCCTGAGAAGATCTGTGGGG - Intergenic
1109085613 13:57967264-57967286 TTTTCCAAAGATGATTTTGAGGG - Intergenic
1109669275 13:65584019-65584041 GCTGCAAAAGATGTTCTTTGAGG - Intergenic
1111195192 13:84867309-84867331 TTCTCCAAAGATAATTTTTGAGG + Intergenic
1114382817 14:22226156-22226178 TCTGCCTTACATGATCTTTGAGG + Intergenic
1114884307 14:26828636-26828658 TCTTCAATAGGTGATCTTTATGG + Intergenic
1119188995 14:72666441-72666463 TCTTCCAAAGATGATCTTTGGGG + Intronic
1120013047 14:79438747-79438769 TTTTCCAAAAATGCTCTTTCAGG - Intronic
1120024836 14:79571031-79571053 GCTTCAACAGATGATTTTTGGGG + Intronic
1120333280 14:83120981-83121003 TGTTCCAAAGCTTATTTTTGGGG - Intergenic
1120835635 14:89036288-89036310 TCTTCCAAAGACTAACCTTGAGG - Intergenic
1121093120 14:91196659-91196681 ACTTCCAGAGATGTTCTGTGAGG - Intronic
1124460931 15:29891044-29891066 TTTTCCAAAGATACTTTTTGTGG + Intronic
1125574830 15:40748135-40748157 TCTTCCAAATAACAACTTTGAGG - Intronic
1127942677 15:63715525-63715547 ACTTCTAAAAATGATTTTTGAGG - Intronic
1128903068 15:71442832-71442854 TCTACCAAAGGTGACCTATGTGG - Intronic
1129020877 15:72516847-72516869 CCTTCCAAAAAAGATCTCTGTGG - Intronic
1130197277 15:81792289-81792311 TCTTCCAGAAATAATCATTGTGG - Intergenic
1130311943 15:82763921-82763943 TTCTCCAAACATGATCTTTCCGG + Intronic
1132195361 15:99910612-99910634 TTTTCCAAAGATGATTTTGAGGG + Intergenic
1133534699 16:6690538-6690560 TTTTGAAACGATGATCTTTGAGG - Intronic
1133579346 16:7128180-7128202 TCTTTGAAAGAAAATCTTTGAGG - Intronic
1134343252 16:13365021-13365043 TCTTCCAAAAATGATGATGGTGG + Intergenic
1137247249 16:46715913-46715935 TCTTTCCAAGAGGATCTGTGGGG - Intronic
1137416539 16:48287231-48287253 TCTGCCAAAGATGAGCTTATAGG + Intronic
1137625648 16:49906523-49906545 TCTCCTAAATATGTTCTTTGGGG - Intergenic
1139346732 16:66308511-66308533 TCTGGGTAAGATGATCTTTGAGG - Intergenic
1140270424 16:73460458-73460480 ATTTCCATAAATGATCTTTGTGG + Intergenic
1141759709 16:86020050-86020072 GCTTCCACAGGGGATCTTTGTGG - Intergenic
1142369772 16:89672375-89672397 TCCTCCAAAGATGATGTTGAGGG - Intergenic
1143056264 17:4164310-4164332 TCTTCCAAAGAAAGTCTTTAAGG + Intronic
1143535940 17:7539590-7539612 GGTTCCAAAAATGATTTTTGTGG + Intergenic
1144345878 17:14348926-14348948 TCTTCCCAGGATTCTCTTTGGGG + Exonic
1146144830 17:30405148-30405170 TTCTCCAAAGATGACTTTTGAGG + Intronic
1146229783 17:31096978-31097000 ACTTCCAAAGCTGAACCTTGTGG + Intronic
1148040237 17:44700874-44700896 TCTTCAAAATATGCTCTTTATGG + Intergenic
1148113222 17:45159248-45159270 GCTTTTAAAGACGATCTTTGTGG - Intergenic
1149506219 17:57196105-57196127 TGTTCCATAGATGACCTGTGAGG - Intergenic
1149956043 17:61051326-61051348 TATTACAAGGTTGATCTTTGTGG + Intronic
1150852337 17:68715339-68715361 TCTTCCCAAGGTGATATCTGGGG - Intergenic
1151088711 17:71410735-71410757 TCTTCCAAAGAACATCTTGTAGG + Intergenic
1152984170 18:306979-307001 TTTTCCAAAGATGATTTTGAGGG - Intergenic
1153170287 18:2308469-2308491 TCTCGCAAAGATTATCGTTGAGG + Intergenic
1157051651 18:44173123-44173145 TCTACCAAAGATAATCTATTTGG - Intergenic
1157092465 18:44652383-44652405 TCTTCAAAAGGTGATATTTCTGG + Intergenic
1159010579 18:63055745-63055767 ACTTCCACAAATGTTCTTTGGGG - Intergenic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1162706300 19:12557160-12557182 TCTTCCAAATATGAACATTCTGG - Intronic
1163720002 19:18894418-18894440 TGTTCCAAAGCTGATCTTCTTGG - Intronic
1166246503 19:41530908-41530930 TTTTCCAAAGAAGATGTTTCTGG - Intergenic
1166246529 19:41531233-41531255 TTTTCCAAAGAAGATGTTTCTGG - Intergenic
1167137892 19:47628591-47628613 TTTTCCAAAGGTGACCTCTGTGG + Intronic
1167246678 19:48377203-48377225 TATTTCAAAGAATATCTTTGGGG + Intergenic
925219362 2:2125306-2125328 TCTTCAATAGCTCATCTTTGTGG - Intronic
926529332 2:14023002-14023024 TCTACAAAATATGATGTTTGGGG + Intergenic
927185100 2:20476610-20476632 TGTTGCAAAAATGATCTTTATGG - Intergenic
927801262 2:26101857-26101879 TCTTCAAAACCTCATCTTTGAGG + Intronic
929720570 2:44363261-44363283 ACTTCCTATGATGATCTGTGAGG - Intronic
929957415 2:46469170-46469192 TATTACAAAGATGGTCTTTGGGG - Intronic
929965202 2:46529370-46529392 TCTTCCCAAGAAGATCACTGAGG - Intronic
930076733 2:47411735-47411757 TCTCCCAAAGATTCTTTTTGTGG + Intronic
930407648 2:50980858-50980880 TCTACCATAGATAATCTTTCTGG - Intronic
930511628 2:52352665-52352687 TTTTCCACACATGAACTTTGAGG - Intergenic
930611784 2:53553126-53553148 TCTTCCAAATATGAACATTCTGG + Intronic
931502554 2:62885812-62885834 TCTGCCAATCAAGATCTTTGAGG - Intronic
932121068 2:69100615-69100637 TCTTCCTCTGCTGATCTTTGAGG + Intronic
933282448 2:80346748-80346770 TCTTTCAAACATGATCTTGTAGG - Intronic
933400776 2:81794377-81794399 TCTTCAATATATGAACTTTGTGG - Intergenic
933702454 2:85265170-85265192 TCTTTCAAAGATGACCTTCCTGG - Intronic
934637153 2:96000538-96000560 TCTTCTCAAGAGTATCTTTGCGG + Intergenic
934796497 2:97104867-97104889 TCTTCTCAAGAGTATCTTTGCGG - Intergenic
935316350 2:101838270-101838292 ACTCCCCAAAATGATCTTTGTGG + Intronic
935713001 2:105915932-105915954 TTTTCCAAAGATGATTTTGGGGG + Intergenic
936239472 2:110774781-110774803 AATCCCAAAGATGATTTTTGCGG + Intronic
936720811 2:115250826-115250848 TATTTCAAACATGATCTTTATGG + Intronic
939561331 2:143735713-143735735 TCTTGCTAAGACCATCTTTGGGG - Intronic
940878885 2:158926040-158926062 TGTTGAAAAGATTATCTTTGAGG + Intergenic
941808570 2:169733995-169734017 TCTTCCAAAGATGGTCAGAGGGG + Exonic
941811972 2:169764250-169764272 TCCTCCAAAGATGATTTATTAGG + Intronic
941954175 2:171187638-171187660 TCCTCCAAACATGATTTTTTAGG + Intronic
942215418 2:173714574-173714596 TCCTCAAAAGATGATCTTTTAGG - Intergenic
942373206 2:175308503-175308525 TCTTTCAAAAATGATCTTGATGG - Intergenic
944899594 2:204200559-204200581 TCTTACAAAAATGAGATTTGGGG - Intergenic
945154320 2:206822619-206822641 TCTTAGAAAGATGTTATTTGAGG + Intergenic
947214569 2:227738212-227738234 TCTTCCAAAGATGACCAATGAGG + Intergenic
948236845 2:236397539-236397561 TCTTCCGAAGAGCACCTTTGTGG - Intronic
949078661 2:242078993-242079015 TCTTCTAAAGATGACCTTAAAGG - Intergenic
1168843797 20:928035-928057 TCTTGCAAAGCTGTCCTTTGTGG - Intergenic
1169559382 20:6783330-6783352 GCTTCCAAAGCTGGTATTTGAGG + Intergenic
1171364530 20:24614689-24614711 ACTTCCAAAAAGGATCTGTGTGG - Intronic
1171536062 20:25890871-25890893 TCTTCCAAAGATTCTCTTTCTGG + Intergenic
1171571801 20:26259031-26259053 TCCTCCAAAGATTCTCTTTCTGG - Intergenic
1171805037 20:29670299-29670321 TCCTCCAAAGATTCTCTTTCTGG - Intergenic
1171839022 20:30186127-30186149 TCCTCCAAAGATTCTCTTTCTGG + Intergenic
1172457412 20:35088783-35088805 TATACCACAGATGATCCTTGAGG + Intronic
1172742242 20:37178530-37178552 TTTTCCAAAGATTATCAGTGGGG - Intronic
1175250323 20:57605489-57605511 TCTTCTACAGGTGATATTTGTGG - Intronic
1175587157 20:60150229-60150251 GCTCCCAAATAGGATCTTTGGGG + Intergenic
1177015313 21:15780863-15780885 TCTTTTAAAATTGATCTTTGAGG + Intronic
1177631333 21:23732749-23732771 TCTTCCTAATGTTATCTTTGGGG - Intergenic
1177717410 21:24856939-24856961 TTTACCACATATGATCTTTGTGG + Intergenic
1179295967 21:40062827-40062849 TCTTTCAAACATGATATCTGGGG + Intronic
1179337169 21:40468250-40468272 TCCTCCAAAGATGATTTTGAGGG - Intronic
1182313921 22:29430186-29430208 GTTTTCAAAGATGATTTTTGGGG + Intergenic
1183247041 22:36702125-36702147 TATTCCAATGAGGATGTTTGAGG + Intronic
1183366840 22:37411387-37411409 TCTTCCCAGGATGATGCTTGGGG + Intronic
1183611573 22:38910749-38910771 TCCTGCAAAAATGATCTTTATGG + Intergenic
1183934113 22:41252423-41252445 TCATTCATAGATGATCTTCGGGG - Intronic
1184543809 22:45151300-45151322 ACTTCAAAAGATGAATTTTGGGG + Intergenic
949739136 3:7210014-7210036 TCTTGCAGAGAGGATCTTTTAGG + Intronic
951006074 3:17617384-17617406 TTTTCCAAGGAGTATCTTTGTGG + Intronic
951224170 3:20101425-20101447 TCTCCCAATGATGATATTTCTGG + Exonic
952706677 3:36384548-36384570 TATTCCAATGATGACATTTGGGG - Intronic
952907272 3:38149594-38149616 TCTTGAAAAGATGACCTTTAGGG + Intergenic
955810388 3:62781799-62781821 GCTTCCAAAGGTGGTCTTTGAGG - Intronic
956070240 3:65441662-65441684 TGTGAGAAAGATGATCTTTGGGG + Intronic
956803064 3:72780624-72780646 ACCCCCAAAGATGTTCTTTGTGG - Intronic
956913623 3:73847380-73847402 TTTTCCAAAGATGATTTTGAGGG + Intergenic
957962467 3:87275151-87275173 TCTTCCAAAAATTATGTTGGAGG + Intronic
958042246 3:88240776-88240798 TCACCTAAAGAGGATCTTTGGGG + Intergenic
959174706 3:102892309-102892331 TCTTCCACTGATGGTCATTGAGG + Intergenic
963896750 3:150694632-150694654 TCCTCCAAAGATGATTTTGAGGG - Intronic
964207533 3:154190790-154190812 TCTCAGAAAGAGGATCTTTGTGG + Intronic
966232114 3:177663845-177663867 TCTTCTCAAGAGTATCTTTGTGG + Intergenic
966507545 3:180723875-180723897 CATTCCCCAGATGATCTTTGTGG + Intronic
967573870 3:191066876-191066898 TCTTAACAAGATGTTCTTTGAGG + Intergenic
970082213 4:12300257-12300279 TCCTGCAAAGATGTCCTTTGTGG - Intergenic
970151572 4:13095817-13095839 GCTCCCAAAGATCATCTTTTTGG + Intergenic
970614599 4:17756459-17756481 TCCTCCAAAGATGACCAATGAGG - Intronic
970824259 4:20253482-20253504 TCTCCCAAGGATGAACTTGGCGG - Intronic
971822661 4:31578733-31578755 ACTTCCATAGATGAACTTTAGGG + Intergenic
974523706 4:63019508-63019530 TTTTCCAAAAATGATCCTTGGGG - Intergenic
974612575 4:64234794-64234816 TCTTTAAAATATGAACTTTGAGG - Intergenic
975384404 4:73738785-73738807 TCAAACAAACATGATCTTTGAGG - Intergenic
975412094 4:74065259-74065281 TTTTCCAAAGATGATTTTGAGGG - Intergenic
976126457 4:81838309-81838331 TCTTCCTCAAATGATCTTTGTGG + Intronic
977448507 4:97163005-97163027 GCTTCAAAATATGAACTTTGTGG - Intergenic
979622779 4:122813838-122813860 TCTTCCAAATGTGATCTGTTTGG + Intergenic
982146097 4:152394578-152394600 AGTTCCAAAGATGCTCTTTTGGG - Intronic
984356317 4:178663975-178663997 TCTACCAAAGAGGATCCTCGTGG + Intergenic
984402587 4:179286292-179286314 TCTTCAAGAGATGCACTTTGTGG - Intergenic
985610173 5:883493-883515 CCTGCCACAGATGGTCTTTGTGG - Intronic
987796999 5:22640867-22640889 TTTTCCAAAGATGATTTTGGTGG - Intronic
988852272 5:35191659-35191681 ATTTCTAAAGATGGTCTTTGAGG - Intronic
989438033 5:41437476-41437498 TCTTGCAGAGGTGATGTTTGAGG + Intronic
989583264 5:43053331-43053353 TCTTCCAAAGATGATGAATGGGG - Intergenic
990307623 5:54508456-54508478 TCCTGCAAAGCTGTTCTTTGTGG - Intergenic
990444607 5:55882303-55882325 TCTTCAAAACATGATTTTTAAGG - Intronic
991098322 5:62762996-62763018 TCTTCTAGAGAGGATCTTTTGGG + Intergenic
991321784 5:65382249-65382271 GGATCCAAAGTTGATCTTTGAGG - Intronic
995225306 5:109693719-109693741 ACTTCCAAAGAATATCTTAGAGG - Intronic
996007526 5:118440877-118440899 TTTTCCAAGCATGATATTTGTGG - Intergenic
996123941 5:119704401-119704423 CCTTGCAAAGCTGTTCTTTGTGG + Intergenic
996282927 5:121753861-121753883 TTCTCCAAAGATGATTTTGGGGG + Intergenic
998142675 5:139709164-139709186 TCTGGCCAAGATGATCTTTGCGG - Intergenic
998574468 5:143298847-143298869 TCTTCAGAAGATCATCTCTGTGG + Intronic
999536003 5:152518317-152518339 TCTTCCCAAGATGAGCTTTCAGG - Intergenic
1001303557 5:170555280-170555302 GCTTCCAAGGAGGATCTTTGGGG + Intronic
1002865527 6:1118853-1118875 TTTCCCACAGATGAACTTTGGGG - Intergenic
1003012992 6:2443768-2443790 TTTTCCAAAGATGATCATCCAGG + Intergenic
1003042467 6:2700664-2700686 CCCTCCAAAAATGATCTATGGGG + Intronic
1003772351 6:9319447-9319469 CCTTCCTAAGATGACATTTGAGG + Intergenic
1003912695 6:10757142-10757164 TGTTTCAAAAATGATCTCTGAGG + Intronic
1004301542 6:14462712-14462734 TTTGCCAAAAATGAGCTTTGTGG - Intergenic
1006042480 6:31267796-31267818 TGTTGCAAAGATGACCTTTCAGG - Intergenic
1007344742 6:41220935-41220957 TCTTCCAAACTTGTTCTATGAGG - Intergenic
1008419263 6:51278127-51278149 TCTTCTAAAAATGATATATGTGG - Intergenic
1010160751 6:72851552-72851574 TCTTCAGAAAATGATCTTTTTGG - Intronic
1010283721 6:74050560-74050582 TTTTCCAAAGATGATGTTGAGGG + Intergenic
1010873829 6:81076123-81076145 TCTTACAAAGACCACCTTTGTGG - Intergenic
1011037207 6:82990818-82990840 TTTTCCAAAGATGATTTTGAGGG - Intronic
1011537094 6:88387694-88387716 TCTTTCAAAGAAGTCCTTTGGGG + Intergenic
1012089879 6:94877863-94877885 TATTCCAAAGATGATCTTTGGGG - Intergenic
1012786362 6:103633121-103633143 TCTTCAAAAGATGATCTCCTAGG + Intergenic
1014560063 6:122879191-122879213 TCTTCCAGGGATGATCTGTCTGG + Intergenic
1015646836 6:135400905-135400927 TTCTCCAAAGATGATTTTGGGGG - Intronic
1015708118 6:136110192-136110214 TCTTCCAAAAAGCATTTTTGAGG - Intronic
1015971214 6:138744383-138744405 TCTTCCAAACATGTTCTTTTCGG + Intergenic
1018075471 6:160208529-160208551 TCCTGCAAAGCTGTTCTTTGTGG + Intronic
1020823146 7:12995637-12995659 TCTTCCCGAAATGATCTTTCCGG - Intergenic
1020925578 7:14319881-14319903 TGTTCCAAAGAAGATGCTTGTGG - Intronic
1020953637 7:14711719-14711741 TCTTCACAGGATGATCTCTGGGG + Intronic
1023653429 7:42394465-42394487 ACTTCCAAAGATGACCAATGTGG - Intergenic
1025287527 7:57677568-57677590 TCCTCCAAAGATTCTCTTTCTGG + Intergenic
1025874574 7:65468978-65469000 TCTCTCAAGGATTATCTTTGTGG + Intergenic
1026613906 7:71884801-71884823 TCCTGCAAAGTTGTTCTTTGTGG + Intronic
1026743524 7:72993801-72993823 TTTTCCAGAGGTGATTTTTGTGG - Intergenic
1026783013 7:73282866-73282888 TTTTCCAGAGGTGATTTTTGTGG - Intergenic
1026803400 7:73414261-73414283 TTTTCCAGAGGTGATTTTTGTGG - Intergenic
1027029634 7:74878501-74878523 TTTTCCAGAGGTGATTTTTGTGG - Intergenic
1027100211 7:75371276-75371298 TTTTCCAGAGGTGATTTTTGTGG + Intergenic
1030228271 7:107176900-107176922 TCTTCCAAATTTCATCTTTTAGG + Intronic
1033122386 7:138677532-138677554 TCCTGCAAAGCTGTTCTTTGTGG + Intronic
1033319169 7:140324381-140324403 TGTGCCAAAAATGATCCTTGCGG + Intronic
1034051436 7:147988376-147988398 GCCTCCAAAGCTGTTCTTTGTGG - Intronic
1034260945 7:149755086-149755108 TCTTGAAAATAGGATCTTTGCGG + Intergenic
1034737008 7:153438871-153438893 TAGCCCAATGATGATCTTTGTGG + Intergenic
1035536927 8:399014-399036 TCTTCTAAAGATGACCTTAAAGG - Intergenic
1035855661 8:2973787-2973809 TCTTCCAAAGAGGACCCATGCGG + Intronic
1035933845 8:3814947-3814969 TCTTTCAAAGATCATTTTTTTGG - Intronic
1036174685 8:6525877-6525899 ATTTGCAAAGATGATATTTGGGG + Intronic
1036583090 8:10095454-10095476 TCTCCAAAAGATGTCCTTTGCGG - Intronic
1039714446 8:40092545-40092567 TTTTCCAAAGATGATTTTGAGGG + Intergenic
1040775513 8:51038336-51038358 TCTTTAAAACATGATCTTTTTGG - Intergenic
1041573700 8:59368575-59368597 ACTTCACAAGATGAGCTTTGAGG - Intergenic
1042197277 8:66241880-66241902 TCTTCCAAAAAGTATATTTGCGG + Intergenic
1046120673 8:109842526-109842548 GCTTCAAAAGATGAACTTTAGGG - Intergenic
1050622573 9:7469863-7469885 TTCTCCAAAGATGATTTTTGAGG + Intergenic
1050649005 9:7755055-7755077 TCTTCCAAAGCATATCTTCGTGG + Intergenic
1050649864 9:7764428-7764450 TTTTCCAAAGATGATTTTGAGGG - Intergenic
1051222306 9:14862522-14862544 TTTTTAAAAGATGAACTTTGTGG - Intronic
1053128470 9:35601364-35601386 TCTTCCAAAGTTGACCGATGAGG - Intergenic
1053243328 9:36514886-36514908 ACTTGCAGTGATGATCTTTGAGG + Intergenic
1053559593 9:39176080-39176102 TCTTTCTAAGATCAGCTTTGGGG - Exonic
1053823700 9:41996336-41996358 TCTTTCTAAGATCAGCTTTGGGG - Exonic
1054137522 9:61442863-61442885 TCTTTCTAAGATCAGCTTTGGGG + Intergenic
1054606871 9:67191022-67191044 TCTTTCTAAGATCAGCTTTGGGG + Intergenic
1056442154 9:86632140-86632162 TCTGCGGAAGATGCTCTTTGTGG + Intergenic
1057098988 9:92339734-92339756 TCTTCAGCAAATGATCTTTGTGG - Intronic
1058349218 9:104000890-104000912 TCTTCCAAATATGAACGTTCTGG - Intergenic
1058580960 9:106456567-106456589 TCCTCCAAAGATGATTTTGAGGG + Intergenic
1059627639 9:116084515-116084537 TTGTCAAAAAATGATCTTTGAGG + Intergenic
1060741495 9:126100952-126100974 TCCTCCAAAGATGACCTATGAGG - Intergenic
1060888705 9:127174761-127174783 TCTTCCAAGGAAGATCTTGCAGG + Exonic
1187102605 X:16210159-16210181 TCTCCCAAAGAGGATATGTGTGG + Intergenic
1190859674 X:54332290-54332312 TCTTCCAGAGATACTCTCTGAGG + Intronic
1191720869 X:64227417-64227439 TCTTCAAAAGGTCATCTTTGTGG + Intronic
1192728977 X:73783243-73783265 CCTTGCAAAGCTGTTCTTTGTGG - Intergenic
1192784795 X:74325297-74325319 TCTTGAAAAGCTGATCTCTGGGG - Intergenic
1192803829 X:74493022-74493044 TCTTGAAAAGCTGATCTCTGGGG + Intronic
1194643214 X:96428060-96428082 TCTTCTAAGGAGTATCTTTGTGG + Intergenic
1195476225 X:105288963-105288985 TCTTGAAAAGATAATCTGTGGGG + Intronic
1195582137 X:106517363-106517385 TCTTTCAAAAATGCTCTTTTAGG + Intergenic
1199076443 X:143531350-143531372 TATTCCAAAGATGGTATTTGGGG + Intergenic
1199490495 X:148394004-148394026 TCTTAAAAAGTTGATTTTTGTGG + Intergenic
1200851999 Y:7892745-7892767 TCTTGCATAAATGATCTTTCTGG - Intergenic
1201966457 Y:19741670-19741692 TCTACCACAGAAGATCCTTGAGG + Intronic
1202063142 Y:20909300-20909322 TCTTGCAAAGCTGTCCTTTGTGG - Intergenic