ID: 1119189228

View in Genome Browser
Species Human (GRCh38)
Location 14:72669020-72669042
Sequence TAGACAGAACAACCCAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 239}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119189225_1119189228 9 Left 1119189225 14:72668988-72669010 CCATATTTCCTAGGAACAGGCCA 0: 1
1: 1
2: 1
3: 12
4: 118
Right 1119189228 14:72669020-72669042 TAGACAGAACAACCCAAAAGTGG 0: 1
1: 0
2: 3
3: 23
4: 239
1119189222_1119189228 24 Left 1119189222 14:72668973-72668995 CCTTGGAGGTTTATGCCATATTT 0: 1
1: 0
2: 0
3: 15
4: 204
Right 1119189228 14:72669020-72669042 TAGACAGAACAACCCAAAAGTGG 0: 1
1: 0
2: 3
3: 23
4: 239
1119189226_1119189228 1 Left 1119189226 14:72668996-72669018 CCTAGGAACAGGCCACATATAGA 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1119189228 14:72669020-72669042 TAGACAGAACAACCCAAAAGTGG 0: 1
1: 0
2: 3
3: 23
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119189228 Original CRISPR TAGACAGAACAACCCAAAAG TGG Intronic
902420445 1:16275260-16275282 TAGAGAGAACTACAGAAAAGAGG + Intronic
906562918 1:46772527-46772549 AAAACAGAACACCCCAAAAGGGG - Intronic
909558946 1:76987656-76987678 CAGACACAACAGCCCAACAGTGG + Intronic
910467859 1:87519252-87519274 GAGAAAGAACTTCCCAAAAGAGG - Intergenic
911580499 1:99628122-99628144 TATTCATAACAACCGAAAAGTGG + Intergenic
913259298 1:116984228-116984250 TAGGCAGAAGAACCCAAGACTGG - Intronic
913273625 1:117117855-117117877 TAGCCAGAACAAACCAGAAAGGG + Intronic
913443773 1:118927726-118927748 GAGACAGAGCAGCCCAAAAGAGG + Intronic
914008138 1:143751374-143751396 TAAACAGAAAATCTCAAAAGCGG - Intergenic
916942728 1:169693004-169693026 TAGACAGTAGAAACCAAATGAGG + Intronic
917211425 1:172635630-172635652 TAGACAGATCAACCTCAAGGAGG + Intergenic
917567104 1:176224069-176224091 AAAACAGAAAAACCCAAAACAGG + Intergenic
918543877 1:185660580-185660602 TGGACAGAAAAAAACAAAAGAGG + Intergenic
923603436 1:235423104-235423126 AAGACAGACCAACCCAAAAAAGG - Intronic
924154201 1:241159360-241159382 TAGAAAGAACAACACATAAAAGG - Intronic
1065432709 10:25675411-25675433 TGCACAGAACATCCCAAAACGGG + Intergenic
1066242489 10:33551767-33551789 TAGAGGGAACAACACAAAATTGG - Intergenic
1066956772 10:42180224-42180246 AAGACAGGACAGCCCAAAGGAGG - Intergenic
1067550936 10:47235739-47235761 TATTCAGAACAGCCAAAAAGTGG + Intergenic
1069766846 10:70868457-70868479 CAGACAGACAAATCCAAAAGGGG - Intronic
1071547169 10:86537543-86537565 TAGATAGAAAAACCCAAAACTGG + Intergenic
1071898122 10:90086839-90086861 AAAACAAAACACCCCAAAAGGGG - Intergenic
1073925746 10:108513254-108513276 TTGATAGAACAATACAAAAGGGG - Intergenic
1074573703 10:114648867-114648889 TACACAGCAGAGCCCAAAAGAGG + Intronic
1074716476 10:116224409-116224431 TAGTCATAATAACCAAAAAGTGG + Intronic
1074892716 10:117748789-117748811 AAGAGAGAACAAACAAAAAGTGG - Intergenic
1077837933 11:5940699-5940721 AAAACAAAACAAACCAAAAGTGG + Intergenic
1078878180 11:15419329-15419351 TAGGCAGAACAACCCCAAACTGG + Intergenic
1084606387 11:70174775-70174797 TATACCGAAGACCCCAAAAGGGG + Intronic
1086774241 11:90810101-90810123 TTGACTTATCAACCCAAAAGTGG + Intergenic
1087152483 11:94871127-94871149 TAAACAGATAAACCCAAATGTGG + Exonic
1087501344 11:98958585-98958607 TAGGAAGAAAAACCCAAGAGTGG + Intergenic
1088809318 11:113379942-113379964 TGAACAGAACATCTCAAAAGAGG - Intronic
1093120550 12:15266305-15266327 TATAAAGAACTACCCAAAACTGG + Intronic
1094430575 12:30365403-30365425 TATTCACAACAGCCCAAAAGTGG + Intergenic
1094520436 12:31181559-31181581 TAGAAAAAAAAAACCAAAAGAGG + Intergenic
1096622960 12:52875839-52875861 CAGTCAGAACCACCAAAAAGAGG + Intergenic
1097049141 12:56210573-56210595 AAGAGAGAACAAGGCAAAAGGGG + Intronic
1097454074 12:59774633-59774655 TAAAAAGAACAAAACAAAAGTGG - Intronic
1098408358 12:70151626-70151648 AAAACAGAATACCCCAAAAGGGG - Intergenic
1098537195 12:71606267-71606289 TACACAGAACTACCCAAAGATGG - Intergenic
1098895230 12:76052150-76052172 TAAATAGAAAAATCCAAAAGGGG + Intronic
1099353164 12:81599188-81599210 GAAACAGAATAAGCCAAAAGTGG + Intronic
1099766599 12:86995547-86995569 AAAACAGAACACCTCAAAAGGGG - Intergenic
1099857348 12:88183601-88183623 TACACAGAATAACCTAAAAAGGG - Intronic
1100239581 12:92697962-92697984 TAGAAAGAACAAAACAAAACTGG - Intergenic
1100522660 12:95390222-95390244 AAGACAGAACACCCTAAAAGGGG - Intergenic
1101330399 12:103753223-103753245 TAGATGGAACACCCCAACAGTGG - Exonic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1102080147 12:110091257-110091279 TGGACAGAACAAACCACATGAGG - Intergenic
1102286729 12:111663708-111663730 TAGACCAAACCACCCCAAAGAGG + Intronic
1105817946 13:24053629-24053651 TAGACAGCTCAGCCCCAAAGTGG - Intronic
1106473185 13:30076143-30076165 CAGACAGAACAACCAACAACAGG + Intergenic
1106852305 13:33807221-33807243 TAGAGTGAACATCCAAAAAGTGG - Intergenic
1107910800 13:45104108-45104130 TAGGCAGAACAAAACAAAATGGG - Intergenic
1111271616 13:85893670-85893692 TATAAAGAACTACCCAAGAGTGG - Intergenic
1111769469 13:92578632-92578654 TAGATAGAACAAAACAACAGAGG - Intronic
1113828435 13:113275057-113275079 GAGAAAGAACAAGCCAACAGAGG + Intergenic
1114501348 14:23171277-23171299 TTGACAGAACAAGCCAAACTGGG - Intronic
1115878067 14:37882798-37882820 TAGAAAGTGCAACCCAAGAGTGG - Intronic
1116720281 14:48487193-48487215 AACACAGAAAAACTCAAAAGAGG - Intergenic
1118157331 14:63254943-63254965 TGGACTGAACAACAGAAAAGCGG + Intronic
1118659662 14:67994835-67994857 TAGACACAATAACCAAAAGGTGG + Intronic
1118947602 14:70402080-70402102 AAGACAGAATACCCCAAAAAGGG - Intronic
1119189228 14:72669020-72669042 TAGACAGAACAACCCAAAAGTGG + Intronic
1120752524 14:88211072-88211094 TATTCATAACAACCAAAAAGTGG + Intronic
1122949487 14:105033825-105033847 AAAACAGAACACCCCAAAAGGGG - Intergenic
1123204427 14:106698746-106698768 TACAAAGAAGAACCCAAAAAGGG + Intergenic
1123209433 14:106745217-106745239 TACAAAGAAGAACCCAAAAAGGG + Intergenic
1123408440 15:20038788-20038810 TATAAAGAACTGCCCAAAAGTGG - Intergenic
1123517763 15:21045429-21045451 TATAAAGAACTGCCCAAAAGTGG - Intergenic
1126014606 15:44338230-44338252 TGGGCAGAACAAATCAAAAGAGG + Exonic
1131773874 15:95772652-95772674 TAGGAATAAAAACCCAAAAGGGG + Intergenic
1132194605 15:99903456-99903478 TAGATAGAACAAAACAACAGAGG + Intergenic
1132902390 16:2264380-2264402 CAAACAGCACAACCCAAAACGGG + Intronic
1133521218 16:6559261-6559283 TAGACAAAACACCCAAACAGGGG + Intronic
1133870773 16:9683769-9683791 TATTCATAACAACCAAAAAGTGG + Intergenic
1133933583 16:10251618-10251640 TAGACAGAAGCACCAAAAAGGGG + Intergenic
1143353397 17:6306454-6306476 TACACAGAACAAGGCAAGAGAGG - Intergenic
1143874122 17:9979062-9979084 TAGGCAAAACCACCCAAAAGAGG + Intronic
1146441923 17:32904609-32904631 AAAACAGAACACCCCAAAAGGGG + Intergenic
1146922699 17:36723860-36723882 AAGACAGAACAAGGCAGAAGCGG - Intergenic
1147513052 17:41088821-41088843 AAAACAAAACACCCCAAAAGGGG - Intronic
1147515123 17:41108825-41108847 AAAACAAAACACCCCAAAAGGGG - Intergenic
1149797486 17:59533980-59534002 CAAACTGAAGAACCCAAAAGGGG - Intergenic
1151606982 17:75143872-75143894 AAAAAAGAAAAACCCAAAAGGGG + Intronic
1151766072 17:76133822-76133844 AAGACAAAACAACACAAAACAGG - Intergenic
1153506255 18:5802578-5802600 TATAAAGAACTACCCAAGAGTGG - Intergenic
1153542722 18:6173467-6173489 AAGACAGAACTACAAAAAAGGGG + Intronic
1153599067 18:6761289-6761311 AAAACAGAACAAACCATAAGTGG - Intronic
1154956365 18:21259960-21259982 TATAAAGAACATCTCAAAAGCGG - Intronic
1155448661 18:25940932-25940954 GAGACAGAGGACCCCAAAAGTGG + Intergenic
1156736647 18:40267813-40267835 TATACAGAACAATGCAAAACTGG + Intergenic
1157864065 18:51165867-51165889 TACTAAGAACAACCCAGAAGAGG + Intergenic
1159136041 18:64337937-64337959 AAGACAAAACAACCCACAAGTGG + Intergenic
1159942726 18:74420897-74420919 TACAGAGAACAACACAAAACAGG + Intergenic
1161864604 19:6824881-6824903 TATTCATAATAACCCAAAAGCGG - Intronic
1164295153 19:23903439-23903461 TATACAGAACAGCCTAAAAAGGG + Intergenic
1164566556 19:29329988-29330010 TCCACAGAACTACCCAAAGGTGG + Intergenic
1168096502 19:54118491-54118513 TAGACAGAATCTCCCAGAAGGGG + Intronic
1168292702 19:55364583-55364605 TAGAAAGAAAAACACAAAATTGG + Exonic
1168640378 19:58027463-58027485 TGGGCAGAACAGCCAAAAAGGGG + Intergenic
927298796 2:21486302-21486324 TAGACAGTACACCCCTAGAGAGG + Intergenic
927814229 2:26200036-26200058 TAGAGAGGACAACCGAAACGGGG + Intronic
928117966 2:28561490-28561512 TAGTCACAATAGCCCAAAAGTGG + Intronic
929052444 2:37849592-37849614 TAGGTAGAAGAAACCAAAAGGGG - Intergenic
929071263 2:38032916-38032938 GAGACATAAAAACCCCAAAGTGG + Intronic
930494807 2:52127592-52127614 AAAACAGAACACCTCAAAAGGGG - Intergenic
931324221 2:61201706-61201728 TTGACAAGACAACCCAAAACAGG + Intronic
931497503 2:62825605-62825627 TAGACAGAAAAAAAAAAAAGAGG + Intronic
934896109 2:98121611-98121633 TAGCTGGAACAACCCAAATGAGG + Intronic
935280171 2:101510480-101510502 CAGCCATAAGAACCCAAAAGGGG + Intergenic
936698680 2:114983668-114983690 TAGACTGAACAACTGAAAAAGGG + Intronic
937777023 2:125789990-125790012 TAGACAAAACAATCCAGAAAAGG + Intergenic
938925671 2:136039341-136039363 CAGAGAGAACAGCACAAAAGGGG - Intergenic
939254448 2:139724247-139724269 AAAGCAGAACACCCCAAAAGGGG - Intergenic
939503570 2:143015647-143015669 TAAACAGAACAAAATAAAAGAGG - Intronic
939606232 2:144257800-144257822 TACACAGAACTACCAAAAACTGG + Intronic
939918963 2:148085067-148085089 TACACAGACCAACACAAATGTGG - Intronic
942432058 2:175922260-175922282 TAGACAGAACAAATAACAAGAGG + Intergenic
942496795 2:176548388-176548410 TAGACAGAAAAACCCAACGGAGG + Intergenic
943953402 2:194158059-194158081 TTCACAGAACAGCCCAAAGGAGG - Intergenic
944407171 2:199398244-199398266 TAGAAAGAAAAAACAAAAAGAGG + Intronic
945189830 2:207175810-207175832 TAGAAAGGACAAAACAAAAGAGG - Intergenic
945291289 2:208129878-208129900 TGGCAAGAACAACACAAAAGGGG + Intergenic
946749149 2:222875768-222875790 TGAACTGGACAACCCAAAAGGGG - Intronic
947259892 2:228209172-228209194 TAGACATAACCACCCAAGATAGG + Intergenic
948322163 2:237079109-237079131 TATAAAGAACTACCCAAAACTGG - Intergenic
949029793 2:241788153-241788175 AAGACAGAACACCCCAAAAGCGG - Intronic
1169457900 20:5768416-5768438 AAGACAGAAGAGCCCAGAAGGGG - Intronic
1171027461 20:21643957-21643979 TAGACAGAGCATCTCACAAGAGG - Intergenic
1175546596 20:59782106-59782128 TAAACTCAACAACGCAAAAGAGG + Intronic
1177867989 21:26535938-26535960 TATACAGAACAACCTAAGACTGG + Intronic
1178068602 21:28935281-28935303 TAGACTGAACAAGCCAAGTGTGG + Exonic
1179005132 21:37507333-37507355 TCAACAGAAAAAGCCAAAAGAGG - Intronic
1179083405 21:38194607-38194629 TCAACAAAAAAACCCAAAAGCGG - Intronic
1183249660 22:36721202-36721224 TTAACATAACAAACCAAAAGAGG - Intergenic
1184723601 22:46330151-46330173 TTGAAAGAACAGCCCTAAAGTGG + Exonic
1185405557 22:50646632-50646654 AAAACAGGACACCCCAAAAGGGG - Intergenic
949734233 3:7152705-7152727 TATACATCACAATCCAAAAGAGG - Intronic
951737915 3:25887984-25888006 TATAAAGAACAACCCAAGACTGG + Intergenic
954587830 3:51752094-51752116 AAAACAAAACACCCCAAAAGGGG + Intergenic
954763403 3:52894060-52894082 TAGACAAAACCACCAAAACGAGG + Intronic
957399800 3:79695373-79695395 TAAACAGAACAAGCCAACACTGG - Intronic
959696090 3:109250122-109250144 TATTCATAAGAACCCAAAAGTGG + Intergenic
960128001 3:114021799-114021821 TAAACAGAACAACCCAGTTGTGG - Intronic
960227744 3:115186586-115186608 AAAACAGAACATCCCAAAAGGGG - Intergenic
960243991 3:115379596-115379618 TAGAGAGAACAACACAAATTGGG - Intergenic
960598408 3:119429863-119429885 AAGACAGATCAAGCCAGAAGGGG + Exonic
962060189 3:131918152-131918174 TAGATTGCACAACCCAAAAATGG + Intronic
964023236 3:152040659-152040681 AAGACAAAACACCCCAAAAGGGG + Intergenic
964205364 3:154168591-154168613 AAAACAGAAAAACCCAAAAATGG + Intronic
964328291 3:155572540-155572562 TAGACTGACAAACCCAAACGAGG - Intronic
964611681 3:158622109-158622131 AAAACAGAACACACCAAAAGGGG + Intergenic
964619542 3:158707332-158707354 TAGACAGAATAAGGAAAAAGAGG + Intronic
965890503 3:173508090-173508112 TAGACAAAAGAACCCTAAAGTGG - Intronic
967310284 3:188099551-188099573 TAGATGGACCAACTCAAAAGAGG - Intergenic
967813866 3:193782781-193782803 TAGACAGAACCATTCAAAGGTGG - Intergenic
968120153 3:196120384-196120406 TAGAGAGCAGAACCCAGAAGTGG + Intergenic
969727232 4:8927770-8927792 GAAACAGAACACTCCAAAAGGGG - Intergenic
970525206 4:16925117-16925139 TAAACAGAAAAATCCCAAAGTGG + Intergenic
972618964 4:40728230-40728252 TAAACAGAACAACTTAAAACTGG - Intergenic
972642133 4:40934518-40934540 TAGGCAGAAAAACAGAAAAGTGG + Intronic
972987097 4:44777957-44777979 TAGACAGAAAAACCTGAAACTGG + Intergenic
975186060 4:71404343-71404365 AGGACAGAACAGCCAAAAAGGGG + Intronic
977875773 4:102148463-102148485 TAAACACAACCACCAAAAAGGGG + Intergenic
979069825 4:116187897-116187919 TAGTCATAATAACCCAGAAGGGG + Intergenic
979208314 4:118069467-118069489 TAGACAAAAAAACCCCAAACAGG - Intronic
979454271 4:120908910-120908932 TAAACACAACAGCCCCAAAGAGG + Intronic
979692550 4:123575252-123575274 TAGCAAGAAAAATCCAAAAGTGG + Intergenic
980270141 4:130573849-130573871 AAAACAGAACACCCCAAAAGGGG + Intergenic
981191560 4:141871027-141871049 CAGACTGAACAACCCATAATAGG + Intergenic
982103806 4:151994063-151994085 TAGATAGAAAAACCTGAAAGTGG - Intergenic
984091471 4:175380600-175380622 TATATAGAACAACCCTAAAAAGG + Intergenic
986294321 5:6424415-6424437 TAGACAGCACACCCCGTAAGAGG - Intergenic
987119976 5:14757992-14758014 TAGTCACAAGAACCCAAAGGTGG + Intronic
987357081 5:17073163-17073185 TATTCAAAATAACCCAAAAGTGG - Intronic
987494719 5:18629373-18629395 TATAAAGAACTACCCAAAACTGG + Intergenic
987611628 5:20211801-20211823 TAGACAAAACAACACAGATGGGG + Intronic
990385497 5:55257337-55257359 TAGAAACAACAACAAAAAAGTGG + Intronic
990453795 5:55963208-55963230 TTGAAATAACAACCCAGAAGAGG + Intronic
993628434 5:90254264-90254286 TAGTTAGAACAACCCAACAAGGG + Intergenic
993745956 5:91596995-91597017 TATAAAGAACTACCCAAAACTGG - Intergenic
995678093 5:114685966-114685988 TAGAGAGAGCAACCAATAAGGGG - Intergenic
996917331 5:128727978-128728000 AAGACTGAACAACTGAAAAGAGG + Intronic
997698405 5:135879496-135879518 TTCACAGGACATCCCAAAAGTGG - Intronic
998515480 5:142749953-142749975 TAGTCAGGACTACCCAAGAGGGG - Intergenic
1001860098 5:175046884-175046906 TGTAAAGAACAACCCAAATGTGG + Intergenic
1002703576 5:181144666-181144688 TAAACAGAACACCCCAAAAGGGG - Intergenic
1003278150 6:4669838-4669860 TACACAGAACAACCAAAGATGGG - Intergenic
1003610293 6:7607503-7607525 TAGGCAGCAGAACACAAAAGTGG - Intronic
1005046985 6:21652224-21652246 CAGACAGAACAACACAGGAGAGG + Intergenic
1005764727 6:28999792-28999814 AAGAGAAAACAACCCACAAGTGG + Intronic
1005797746 6:29385589-29385611 TATTCATAACAACCCAAAACTGG + Intronic
1008098472 6:47365522-47365544 TAGACTTAATAAGCCAAAAGTGG + Intergenic
1009852619 6:69216723-69216745 TGGACAGAATAACCAGAAAGAGG + Intronic
1010356634 6:74942029-74942051 TACAAACAACAACCCAGAAGTGG - Intergenic
1011939634 6:92826713-92826735 TAAACAGAACACCCCAAAAGTGG - Intergenic
1014537288 6:122629490-122629512 TAGACACAACATCCTCAAAGAGG + Intronic
1015814223 6:137191591-137191613 AAAACAGAACACCCCAAAAGGGG + Intergenic
1016882334 6:148923215-148923237 TATTCATAATAACCCAAAAGTGG - Intronic
1022019743 7:26386862-26386884 TAGACAGAAGACCTCAGAAGAGG + Intergenic
1022736859 7:33084196-33084218 CAGACAGAAGACCCAAAAAGTGG - Intergenic
1023022835 7:36026277-36026299 TATTCAAAAAAACCCAAAAGTGG - Intergenic
1023085842 7:36569189-36569211 AAAACAAAACAACCCCAAAGAGG + Intronic
1023384189 7:39638791-39638813 TATTCACAACAACCAAAAAGTGG - Intronic
1023747666 7:43336711-43336733 TAGACTGAGGACCCCAAAAGTGG - Intronic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1025477400 7:60941705-60941727 AAGACAGAACAAAATAAAAGAGG + Intergenic
1026636748 7:72089836-72089858 TGGACAAAACAACCAAAAATAGG + Intronic
1027905697 7:84178436-84178458 TCTACACAACAATCCAAAAGAGG + Intronic
1028185119 7:87774528-87774550 TAGACAGCACAACATAAATGTGG + Intronic
1028819121 7:95185465-95185487 TAAACAGAAAACCCCAAGAGTGG - Intronic
1030782872 7:113623676-113623698 AAAACAGAACACCCCCAAAGTGG + Intergenic
1031621995 7:123945604-123945626 AAAACAGAACACCCCAAAAAGGG + Intronic
1032731494 7:134647370-134647392 TAGACAGAAAAACTCGAATGCGG + Intronic
1033853436 7:145526482-145526504 GAAAAAGAAAAACCCAAAAGAGG + Intergenic
1034850616 7:154489972-154489994 TACACAGGACAACCCAAAGAAGG + Intronic
1036109222 8:5879066-5879088 TACACAGAAGAACCTAAAAAGGG - Intergenic
1037012421 8:13859903-13859925 AAGGCAGGACAACTCAAAAGAGG - Intergenic
1037324406 8:17674089-17674111 CAGAGAGAAGAACCCCAAAGCGG + Intronic
1043647985 8:82547201-82547223 AAGACAAAACAACAAAAAAGAGG - Intergenic
1043677390 8:82974218-82974240 GAAATAGAACAACCCAAAAGGGG + Intergenic
1043978624 8:86612446-86612468 TGGACAGGACCACCCACAAGAGG - Intronic
1044165891 8:88983455-88983477 TAGGCAAAATAACCAAAAAGAGG + Intergenic
1044818107 8:96133547-96133569 TAGCCAGAACAAGGCAAAGGTGG - Intergenic
1046941992 8:119940350-119940372 TATACAGAATAGCCAAAAAGTGG + Intronic
1047583040 8:126237913-126237935 TAAACAGAAAAACATAAAAGAGG + Intergenic
1048474135 8:134727978-134728000 GAGACAGGAGCACCCAAAAGTGG - Intergenic
1049841448 8:144775612-144775634 TACACAGAAAAATCCAAAGGAGG + Intronic
1050108548 9:2191113-2191135 TAGACAGAACCACACAGAACAGG + Intronic
1050990058 9:12139007-12139029 AAAACAGAACACTCCAAAAGCGG - Intergenic
1051232171 9:14965413-14965435 TAGAAACAACATCTCAAAAGCGG + Intergenic
1053078815 9:35157217-35157239 AAGACGGAACAACTCAAAGGGGG - Intergenic
1053322307 9:37110290-37110312 TACTCATAACAACCCAAAGGTGG + Intergenic
1053932641 9:43124299-43124321 TAAACAGAATGACCCAAGAGTGG - Intergenic
1054932825 9:70653843-70653865 AAAACAGAACACCCCAACAGGGG - Intronic
1056407328 9:86287167-86287189 TAGAGAGAAGAAACCAGAAGGGG + Intergenic
1057333103 9:94134463-94134485 TAGACAGAAACACCTAAAACTGG + Intergenic
1057722705 9:97545732-97545754 GAGAGAGAAGAAGCCAAAAGAGG - Intronic
1057756396 9:97840958-97840980 TAGTCATAATAACCAAAAAGTGG + Intergenic
1058131386 9:101257625-101257647 TATAAAGAAGAACCCAGAAGTGG - Intronic
1058383893 9:104410222-104410244 AAAACAGAACACCCCAAAATGGG - Intergenic
1059262087 9:112987428-112987450 TATTCACAACAACCAAAAAGAGG + Intergenic
1185812843 X:3126557-3126579 TAAACAAAAAAACCCAAAACGGG + Intergenic
1189691796 X:43624505-43624527 AAAACAGAACACCCCAAAAGGGG + Intergenic
1192718194 X:73665270-73665292 TACACAGAAGAGCCTAAAAGGGG - Intronic
1193974305 X:88098625-88098647 AGAACAGAACACCCCAAAAGGGG + Intergenic
1194032471 X:88833663-88833685 TAAACAGAGAACCCCAAAAGTGG + Intergenic
1194412270 X:93571749-93571771 AAAACAGAACACCCCAAAAGGGG + Intergenic
1195165573 X:102216104-102216126 GAGAAAGAATAATCCAAAAGAGG - Intronic
1195193285 X:102470987-102471009 GAGAAAGAATAATCCAAAAGAGG + Intronic
1195325817 X:103757561-103757583 TAGATAGAAAAACCTAAAACTGG - Intergenic
1195557872 X:106248016-106248038 AAGACAGAACAACTTGAAAGGGG + Intergenic
1196198830 X:112862854-112862876 TAGACAGACGAACAGAAAAGAGG - Intergenic
1196382674 X:115109148-115109170 AACACAGAACACCCCAAAAGGGG + Intergenic
1196719688 X:118841675-118841697 TATTCATAACAACCAAAAAGTGG - Intergenic
1196772733 X:119310953-119310975 AAAACAGAACACTCCAAAAGGGG - Intergenic
1197042685 X:121958431-121958453 CAAACAGAACATCCCAAAAGGGG - Intergenic
1198130915 X:133694267-133694289 TGGACAGAACAACTCAAGAAAGG + Intronic
1199193825 X:145003645-145003667 AAAACAGAACACCCCAAAAAGGG + Intergenic
1199321791 X:146448087-146448109 AAAACAGGACACCCCAAAAGGGG + Intergenic
1199356383 X:146867919-146867941 AAAACAGAACACCCCAAAAGGGG + Intergenic
1199808824 X:151328900-151328922 TATTCACAACAACCAAAAAGTGG + Intergenic
1199863005 X:151818945-151818967 TAGATACAAGAATCCAAAAGAGG - Intergenic
1202068675 Y:20968010-20968032 TACACAGAACAGCCTAAAAAGGG + Intergenic