ID: 1119190000

View in Genome Browser
Species Human (GRCh38)
Location 14:72674776-72674798
Sequence CAGTGCCTGGACCTTGCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119189993_1119190000 15 Left 1119189993 14:72674738-72674760 CCACACACCATGGTGTGAGGACA 0: 1
1: 0
2: 3
3: 20
4: 242
Right 1119190000 14:72674776-72674798 CAGTGCCTGGACCTTGCCATTGG 0: 1
1: 0
2: 1
3: 13
4: 145
1119189996_1119190000 8 Left 1119189996 14:72674745-72674767 CCATGGTGTGAGGACAGGGAGAG 0: 1
1: 0
2: 10
3: 50
4: 443
Right 1119190000 14:72674776-72674798 CAGTGCCTGGACCTTGCCATTGG 0: 1
1: 0
2: 1
3: 13
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119190000 Original CRISPR CAGTGCCTGGACCTTGCCAT TGG Intronic
900121275 1:1049633-1049655 CAGCGCCTGGAGCTTGGCATTGG + Exonic
901190607 1:7407771-7407793 CCATGCCTGGACCTTGGCCTGGG - Intronic
901194643 1:7433525-7433547 TAGTGGCTTCACCTTGCCATTGG - Intronic
901401110 1:9015583-9015605 CAGGGCCTGGACCCTGCGCTGGG + Intronic
901795361 1:11676513-11676535 CAGTGCCCTGACCTCACCATTGG + Intronic
902448647 1:16483595-16483617 CAGGGCCTGGACCTGGCCTGGGG + Intergenic
902506131 1:16939765-16939787 CAGGGCCTGGACCTGGCCTGGGG - Intronic
902952198 1:19893861-19893883 GAGAGCCAGGACCTTGGCATTGG + Intronic
903213605 1:21831545-21831567 CAGGCCCTGGAACTTGCCCTGGG + Exonic
903673103 1:25047966-25047988 CAGAGGCTGGACCTGGCCCTTGG - Intergenic
904059819 1:27699975-27699997 CAGTGCCTTGACTTTGACATAGG + Intergenic
910767036 1:90792064-90792086 TGGGGCCTGGACCCTGCCATAGG - Intergenic
911129912 1:94377247-94377269 CAGTCCCTGGACCCTGCTATTGG + Intergenic
912577166 1:110683532-110683554 CAAAGGCTGAACCTTGCCATGGG + Intergenic
921582225 1:216908287-216908309 CTCTGCATGGACTTTGCCATGGG + Intronic
923958795 1:239053717-239053739 CATCACCTGGAACTTGCCATTGG + Intergenic
1064497428 10:15927445-15927467 CTGAGCCTGCACCTTTCCATGGG + Intergenic
1064544812 10:16439471-16439493 CAGTGCCAGGACTTGGCCATAGG + Intronic
1067163932 10:43849825-43849847 CAGTTCCTGGACATGGCCCTGGG - Intergenic
1070395189 10:76006114-76006136 CAGGGTCTGGACCTTGCCTGAGG - Intronic
1071600663 10:86957351-86957373 GAGGGCCTGGACCTTGGCAGAGG - Intronic
1075850469 10:125582096-125582118 CACTCCCTTGGCCTTGCCATGGG - Intronic
1076453086 10:130570412-130570434 CACTGCAGGGACCTTGACATGGG - Intergenic
1077307674 11:1875260-1875282 CAGCGCCTGGACTTGGACATCGG - Intronic
1078070487 11:8105806-8105828 CTTTGCCTGGACCTTGCTAGGGG - Exonic
1078518882 11:12047656-12047678 CAGTGCCTGGCCCTGGGCAGGGG - Intergenic
1081659102 11:44877083-44877105 CAGTGCATGGCCCTTCCCACAGG - Intronic
1083679475 11:64344543-64344565 CAGGGCCTGGACCTGGCCACGGG + Exonic
1084858551 11:72003875-72003897 CAGTGCCTCTACCTTGCCCTTGG + Exonic
1085212211 11:74791447-74791469 CAGTGCCCGGGCTGTGCCATGGG + Intronic
1088531556 11:110816318-110816340 CAGGGCCTGTTCCTTACCATAGG + Intergenic
1091165055 11:133468222-133468244 CTGTGCTTTGACCCTGCCATGGG - Intronic
1095149852 12:38779984-38780006 AAGTGCCTGGACATTGGCACTGG - Intronic
1102161649 12:110774090-110774112 CAGGGGCTGGGCCTTGCAATGGG + Intergenic
1103862650 12:124026740-124026762 CAGTGTCTGGCTCATGCCATGGG + Intronic
1107485264 13:40820623-40820645 CAATGTCTGGAGGTTGCCATAGG - Intergenic
1108017292 13:46089356-46089378 CAGTGCCTGAGCTTTGCCAATGG + Intronic
1108472733 13:50783826-50783848 CAGTCCCTGATCCCTGCCATAGG + Intronic
1113362686 13:109645560-109645582 AAGTGCCTTGACCCTGCCAGCGG - Intergenic
1114636891 14:24192647-24192669 CAGTTCCTGGCCCTTGGCACTGG - Exonic
1119190000 14:72674776-72674798 CAGTGCCTGGACCTTGCCATTGG + Intronic
1119901184 14:78261189-78261211 CAGTGACTGAACCTTGTCCTCGG + Intronic
1122519662 14:102334334-102334356 CAGTGCCCAGAGCTTGTCATGGG + Intronic
1131293802 15:91129928-91129950 CAGTGCCTGGTCCTTGGCAAAGG + Intronic
1132300018 15:100769384-100769406 CTGTGCCGGGACCTTGCTCTAGG + Intergenic
1134294181 16:12930910-12930932 CAGGGCTTGGGGCTTGCCATTGG - Intronic
1135154710 16:20042400-20042422 TAGTGCCTGGAATGTGCCATGGG - Intronic
1135502398 16:23008037-23008059 CACATCCTGGACCTCGCCATTGG - Intergenic
1136061233 16:27728117-27728139 CAGCGCCCAGACCCTGCCATGGG - Intronic
1137476879 16:48817070-48817092 CAAGACCTGGACCTTGTCATGGG + Intergenic
1139675604 16:68520961-68520983 CTCTGCCTGGACCTTGGCCTGGG - Intergenic
1143964829 17:10749727-10749749 CAGTGCCAGGACCTTGGAGTTGG + Intergenic
1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG + Exonic
1146634369 17:34493208-34493230 CAGTGCCTGGTCCTTGGCGTGGG - Intergenic
1149041461 17:52194396-52194418 CAGTGCATGCACCTGGCCTTGGG + Intergenic
1152000006 17:77639305-77639327 CACAGCCTGATCCTTGCCATTGG - Intergenic
1152163091 17:78681700-78681722 CAGTGCTAGGACTTGGCCATGGG - Intronic
1152211836 17:79006538-79006560 CAGTGACTGGTCCTGGCCCTTGG - Intronic
1152232475 17:79120968-79120990 CAGTGCCTGGCCCATGGCAGGGG - Intronic
1153774181 18:8438307-8438329 TTGTGCCTGGCCCTTGACATTGG - Intergenic
1160846216 19:1167374-1167396 CAGTGCCTTGACCTTGGCCTTGG - Intronic
1162804255 19:13128863-13128885 CAGTGCCTAGTCCTGGCCCTGGG - Intronic
1162918876 19:13888852-13888874 CAGTGCCTGACCCTGGCCGTGGG - Intronic
1163455941 19:17405669-17405691 CACTTCCTGGAACTTGCTATTGG - Intergenic
1163861123 19:19743389-19743411 CAGTGCCAGGACCCAGCCATGGG - Intergenic
1164560627 19:29289562-29289584 CAGTGCCTTGGCCCTGCCCTGGG - Intergenic
1165275719 19:34749482-34749504 CAGTGCTTGCATCTTTCCATGGG - Intergenic
1166821998 19:45586266-45586288 CAGTGCCAGGAGCTTGACAAAGG - Intronic
1167212165 19:48140009-48140031 CAGGGCCTGGAGCTTGGCGTGGG - Exonic
925844308 2:8021356-8021378 GATGGCTTGGACCTTGCCATGGG + Intergenic
926625678 2:15087681-15087703 CATTTCCTGTATCTTGCCATTGG - Intergenic
926671224 2:15578592-15578614 CAGCACCTGGACCTCTCCATGGG - Intergenic
927054272 2:19355399-19355421 CTATGCCTGGGCCTTGCCCTGGG - Intronic
927146577 2:20170067-20170089 CTGTGCCTGCCCCCTGCCATCGG - Intergenic
927190297 2:20512568-20512590 CTCTGCCTGGACCTTCCCAAAGG + Intergenic
927553355 2:24017074-24017096 CTGTGCCTGGACCATGCCATTGG + Intronic
928021111 2:27705877-27705899 CAGTTCCTTGAACTTGTCATTGG - Exonic
929992318 2:46800812-46800834 CAGAGCCTGCACCTGGCCAGAGG - Intergenic
932219670 2:69989945-69989967 CAGCACATGGCCCTTGCCATGGG + Intergenic
936762959 2:115808488-115808510 AAGTGCCTGGTCCTTGGTATAGG - Intronic
945059492 2:205896358-205896380 CAGTGTCTCCACCTTGCTATTGG + Intergenic
946148638 2:217749332-217749354 AAAGGCCTGGCCCTTGCCATAGG + Intronic
946368685 2:219266919-219266941 CAGACCCTGGGCCTTGCCACAGG + Intronic
946656144 2:221950119-221950141 CAGTTTCTGGACCCTGCCTTGGG - Intergenic
948378764 2:237539108-237539130 CAGAGCCTGGACCATGGCCTGGG - Intronic
1173523711 20:43716785-43716807 CCTTGCCTGGCCCTTGCCTTGGG + Intergenic
1173611383 20:44370799-44370821 CTCTGCCTGGGCCTTGCCCTGGG + Intronic
1173643110 20:44617158-44617180 CAGACCCTGGAGCTTGCTATAGG + Intronic
1174719602 20:52797864-52797886 CAGTGCCCAGGCCTTGCCACAGG + Intergenic
1175832860 20:61976580-61976602 CAGTGCTTGGACCTGGTCCTGGG + Intronic
1178403780 21:32308673-32308695 CAGTGGCTGGCCCATGCCCTTGG + Intronic
1179986703 21:44926203-44926225 CAGAGCCGTGACCTTGCTATGGG + Intronic
1180203968 21:46245459-46245481 GAGGGCCTGGGCCTTTCCATGGG - Intronic
1182301050 22:29337394-29337416 CAGTGCCCAGACCCTGCCAGGGG + Intronic
1182360400 22:29743236-29743258 CAGTGCCTGGATCCTGGGATTGG - Intronic
1182418312 22:30235693-30235715 CAGTGCCTGGGCCTTGCCTATGG + Intergenic
1184029538 22:41883818-41883840 CACTGTCTGCACCTTGACATGGG + Intronic
1184057245 22:42060778-42060800 CAGTGCCTGCAGCTCCCCATGGG + Intronic
1184107194 22:42374886-42374908 CAGAGCCTGGACCTTGAAAGAGG + Intergenic
1184894976 22:47401449-47401471 CAATGCCTGCTCCATGCCATGGG - Intergenic
950103466 3:10373338-10373360 CACAGCCTGGACCTTTCTATTGG + Intronic
951179841 3:19646523-19646545 CAATGCCATGACCTTTCCATTGG - Intergenic
952181496 3:30921013-30921035 CCCTGCCTGGATCCTGCCATAGG + Intergenic
954385159 3:50240300-50240322 CAGTGCCTGGCCCTGGCAAATGG - Intronic
955094511 3:55783795-55783817 CAGTGTTGGGACCTTGCCTTGGG - Intronic
958758168 3:98274987-98275009 CAGTGGCTGCCCCTTGCAATGGG + Intergenic
960383900 3:116996187-116996209 GAAATCCTGGACCTTGCCATCGG - Intronic
961774024 3:129271202-129271224 CAGTGCTTGAACCTGGGCATAGG + Intronic
965348569 3:167583705-167583727 CAATGGCTGTACCTTGCTATTGG - Intronic
966826149 3:183966688-183966710 CAGTGGCTGGGCCCAGCCATTGG - Intronic
967494434 3:190127158-190127180 CAGTTCCTGGAGCTTGCAACAGG - Intergenic
967863646 3:194172645-194172667 CAGTGCTTGGCCCTTGACTTGGG + Intergenic
969423544 4:7110871-7110893 CCGTGCCTGCCCCTTTCCATGGG + Intergenic
970131462 4:12876170-12876192 CCCTGCCTGGACGTTGCCATGGG - Intergenic
970268108 4:14312144-14312166 CAGGGTCTGGGCTTTGCCATAGG + Intergenic
970927517 4:21470128-21470150 CAGAGCCAGGGCCTTGACATCGG + Intronic
972978644 4:44668563-44668585 CATTGCCTGGGCATTGCCTTGGG + Intronic
976627947 4:87207240-87207262 CGGTGCATGGAATTTGCCATAGG - Intronic
981753608 4:148117868-148117890 CTGTGCCCAGCCCTTGCCATGGG - Intronic
993884950 5:93405187-93405209 TAGTGCATGGACCTTGAGATGGG + Intergenic
997474515 5:134134873-134134895 CAATGCCTGGGGCTTCCCATGGG - Intronic
999565499 5:152855875-152855897 CAGAGCCGGGACTTTGGCATTGG - Intergenic
1001694288 5:173658651-173658673 CTGTTCCTGGACTTTGCCTTTGG - Intergenic
1002135562 5:177105609-177105631 CTGTGCCTGGACCTGGGAATGGG - Intergenic
1002200873 5:177527359-177527381 CAGTGGCTGGACATTGCCCTCGG - Intronic
1002689957 5:181043883-181043905 CAGGGCCTGGACCCTGCCCGAGG + Intronic
1005196812 6:23296782-23296804 AATTTCCTGGACCTTTCCATGGG - Intergenic
1006471803 6:34233868-34233890 CATTCCCTGGACATTCCCATTGG + Intergenic
1007240176 6:40419242-40419264 CATTCCCTGCACCTTGCCTTTGG + Intronic
1009023318 6:57968495-57968517 TGGTGCGTGGAACTTGCCATGGG + Intergenic
1009198888 6:60720028-60720050 TGGTGCGTGGAACTTGCCATGGG + Intergenic
1011264115 6:85497558-85497580 GGGTGCCTGGACCTTGCCCAGGG + Intergenic
1011411844 6:87074437-87074459 CAGTGCCTGCTCCATGCCAGGGG - Intergenic
1019573553 7:1725198-1725220 CAGTGCCTGGCCCCTGCTGTGGG - Intronic
1019638134 7:2087748-2087770 CAGTCCCTGCTCCTGGCCATGGG - Intronic
1025858934 7:65308464-65308486 AGGTGCCTGGACCTTGGCACTGG - Intergenic
1028335932 7:89654967-89654989 CAATGTCTGGGCCTGGCCATTGG + Intergenic
1028383348 7:90224196-90224218 CAGTGTCTGAACCTTGCCTCTGG - Intronic
1029743356 7:102503498-102503520 CAGTGGCTGCACCTTGCTCTGGG + Intronic
1029761345 7:102602659-102602681 CAGTGGCTGCACCTTGCTCTGGG + Intronic
1031013493 7:116548150-116548172 AAATGCCTGGACCCTGCCCTTGG + Intronic
1032265491 7:130367468-130367490 CAGAGCCTTGAAGTTGCCATGGG - Exonic
1034779104 7:153860587-153860609 CAGTACCTGGGGCTTGTCATTGG - Intergenic
1035567412 8:650625-650647 CAGAGCCGGCACCGTGCCATAGG + Intronic
1036664410 8:10729761-10729783 CATTCCCTGGACCTTACAATTGG - Intronic
1039430733 8:37523194-37523216 CAGGCCCTGGAGCTTACCATGGG - Intergenic
1039885252 8:41650619-41650641 CAGGGCCTGGCCCATGCCTTAGG - Intronic
1044933951 8:97276306-97276328 CATTGCCTGGACCTTGTTCTTGG - Exonic
1051050189 9:12923387-12923409 CATTGCCTGGACCAGGCCTTGGG - Intergenic
1051365640 9:16319721-16319743 CAGTTCCTGGACTTTTCCACAGG + Intergenic
1056429969 9:86517454-86517476 AAGTGCCTGGACATTGACCTTGG - Intergenic
1056752727 9:89363847-89363869 GAGTGCATGGGCCCTGCCATCGG + Intronic
1057812932 9:98271614-98271636 CAGCTCCTTGAGCTTGCCATTGG - Intergenic
1059939000 9:119339620-119339642 CAGTGCCTGGCACTTGCTAGGGG - Intronic
1186290219 X:8089154-8089176 CAGTGCCTGGCCCATGAAATGGG + Intergenic
1192190940 X:68990842-68990864 CAGTGCCTTGACCTTTCCTAAGG - Intergenic
1199722233 X:150550216-150550238 CATTGCCAGGACCTGCCCATGGG - Intergenic
1199825118 X:151490924-151490946 CAGTGTCTCCACCATGCCATTGG + Intergenic
1199874867 X:151921525-151921547 CAGAGCCTGGGCCCTGCCTTGGG - Intronic
1200108080 X:153725378-153725400 CAGTGCCTGGCCCCGGCCAGGGG + Exonic