ID: 1119191603

View in Genome Browser
Species Human (GRCh38)
Location 14:72686431-72686453
Sequence CAACTAAGAAGCAGAAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 248}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119191600_1119191603 -4 Left 1119191600 14:72686412-72686434 CCCCGTTTTATAGATGAGGCAAC 0: 2
1: 14
2: 270
3: 1824
4: 6038
Right 1119191603 14:72686431-72686453 CAACTAAGAAGCAGAAGTGTAGG 0: 1
1: 1
2: 0
3: 16
4: 248
1119191599_1119191603 -3 Left 1119191599 14:72686411-72686433 CCCCCGTTTTATAGATGAGGCAA 0: 1
1: 3
2: 81
3: 421
4: 1738
Right 1119191603 14:72686431-72686453 CAACTAAGAAGCAGAAGTGTAGG 0: 1
1: 1
2: 0
3: 16
4: 248
1119191601_1119191603 -5 Left 1119191601 14:72686413-72686435 CCCGTTTTATAGATGAGGCAACT 0: 1
1: 32
2: 484
3: 2686
4: 7978
Right 1119191603 14:72686431-72686453 CAACTAAGAAGCAGAAGTGTAGG 0: 1
1: 1
2: 0
3: 16
4: 248
1119191602_1119191603 -6 Left 1119191602 14:72686414-72686436 CCGTTTTATAGATGAGGCAACTA 0: 2
1: 56
2: 646
3: 3477
4: 9960
Right 1119191603 14:72686431-72686453 CAACTAAGAAGCAGAAGTGTAGG 0: 1
1: 1
2: 0
3: 16
4: 248
1119191596_1119191603 21 Left 1119191596 14:72686387-72686409 CCCATGAAGTCAGGAGGATTATT 0: 1
1: 0
2: 1
3: 23
4: 220
Right 1119191603 14:72686431-72686453 CAACTAAGAAGCAGAAGTGTAGG 0: 1
1: 1
2: 0
3: 16
4: 248
1119191597_1119191603 20 Left 1119191597 14:72686388-72686410 CCATGAAGTCAGGAGGATTATTA 0: 1
1: 0
2: 1
3: 20
4: 184
Right 1119191603 14:72686431-72686453 CAACTAAGAAGCAGAAGTGTAGG 0: 1
1: 1
2: 0
3: 16
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119191603 Original CRISPR CAACTAAGAAGCAGAAGTGT AGG Intronic
902305034 1:15530472-15530494 TGCCAAAGAAGCAGAAGTGTTGG + Intronic
902558422 1:17260726-17260748 AAACTAAGAAGGAGAAGGGGTGG + Intronic
905888770 1:41506991-41507013 CAACACAGAAGCAGAATTGGTGG + Exonic
906735412 1:48121487-48121509 CTACTAAGAAGGAAATGTGTCGG + Intergenic
909744362 1:79075071-79075093 AAGCTAGGAAGCAGAATTGTAGG + Intergenic
911143318 1:94529011-94529033 CACCTACAGAGCAGAAGTGTAGG + Intergenic
911224026 1:95284569-95284591 CAACTAACAAGCTGACTTGTGGG + Intergenic
914707595 1:150183508-150183530 CAGCTAAAAAACACAAGTGTTGG - Intergenic
914717247 1:150263279-150263301 CAGCTGAGGAGCAGAAGCGTGGG - Exonic
915779812 1:158534940-158534962 GATCTAAGAAGCAGATGTTTAGG - Intergenic
917496635 1:175546403-175546425 CAAGCAAGAAGCAGAATTGCCGG + Intronic
917768636 1:178251072-178251094 AAACTAAGAATCAGGAGTTTAGG + Intronic
921478027 1:215633422-215633444 GACCTAAGTAGCAGGAGTGTTGG - Intronic
921528812 1:216253633-216253655 AATGGAAGAAGCAGAAGTGTAGG - Intronic
924089767 1:240490298-240490320 CATCCAAGGAGCAGAAGTGATGG - Exonic
1062881352 10:980626-980648 CAGCTAAGCAGCTGAAATGTGGG + Intergenic
1064115679 10:12575389-12575411 CAGCTAAGAAACAGGAGTGATGG - Intronic
1068219934 10:54031064-54031086 CAACGATGAAGCAGGAGTATAGG - Intronic
1070072922 10:73107162-73107184 CAGCTAATCAGTAGAAGTGTTGG - Intergenic
1070337721 10:75469998-75470020 CATCCAAGAACCAGAAGTGTGGG - Intronic
1071194456 10:83141646-83141668 CAACTGAGAAGCAAAATAGTTGG + Intergenic
1072269734 10:93764616-93764638 CAACTAGGAAGAAGCAGAGTGGG - Intronic
1073864251 10:107784284-107784306 CACCTAAGAAAAAGAAATGTGGG - Intergenic
1074774079 10:116753573-116753595 AAACTAAGAAGCAGCAAAGTTGG - Intergenic
1074921412 10:118017793-118017815 GAACTAAGAAACAGAAATATCGG + Intronic
1075293704 10:121253653-121253675 CAACTAAAAGCCAGAAGGGTAGG - Intergenic
1078305906 11:10186152-10186174 CAACTAAGAAACAGACAAGTGGG + Intronic
1079326376 11:19496047-19496069 AAACGAAGAAGCAGAAAAGTAGG + Intronic
1080091629 11:28355452-28355474 CAATGAAGAAACAGAGGTGTAGG - Intergenic
1081218561 11:40432233-40432255 CAACTTAAAAGGAGAAGTCTTGG - Intronic
1081286428 11:41275460-41275482 AAACACAGAAGCAGAAGAGTGGG + Intronic
1082060565 11:47856491-47856513 CAACAAAGAACCAGATGTGCAGG + Intergenic
1082081562 11:48016209-48016231 CAAGCAAGAAGCAGAGGTATGGG - Intronic
1084870143 11:72093179-72093201 AAACTAAGAACCAGAATTGTTGG - Intronic
1084884165 11:72192510-72192532 CAACCAAGAAGGTGAACTGTTGG - Intronic
1085521703 11:77142931-77142953 CATCTGAGAGGCAGAAGTGGGGG - Intronic
1085840160 11:80002347-80002369 AAAAAAAGAAGAAGAAGTGTAGG - Intergenic
1086817731 11:91393979-91394001 GAGCTGAGAAGCTGAAGTGTTGG + Intergenic
1088751250 11:112844033-112844055 CAACCAAGAAGGAAAAGTGCAGG + Intergenic
1090689155 11:129159195-129159217 TAACTAAGGAGCAGAACTGAAGG + Intronic
1092534351 12:9374075-9374097 TAACTAAGATGCTGAAGTGCTGG - Intergenic
1092871587 12:12810469-12810491 GATCTAAGAAGCAGATGTTTAGG + Intronic
1093395983 12:18682990-18683012 CAACTCAGCAGCAGAAGGGCAGG + Intergenic
1095535258 12:43238448-43238470 CAACTATGAGTCAGAATTGTAGG - Intergenic
1095812045 12:46382442-46382464 CATCTAAGAACCAGAATTGCAGG - Intergenic
1097226677 12:57480754-57480776 TAAGGCAGAAGCAGAAGTGTGGG - Intronic
1098305579 12:69099368-69099390 AAGCCAGGAAGCAGAAGTGTGGG + Intergenic
1102019689 12:109673660-109673682 AAATGAAGAAGCAGAAATGTTGG - Intergenic
1102732263 12:115122112-115122134 CAACTGAGAAGAAGAAATATTGG - Intergenic
1102890614 12:116555969-116555991 CAACTAAGGAGCAGGATTGGAGG + Intergenic
1102911133 12:116714960-116714982 CAAATAAGATGCAGAACTGGGGG + Exonic
1103148569 12:118617056-118617078 CAACTTAAAAGCAGAAGCTTTGG - Intergenic
1105039317 12:132949368-132949390 CAGCTAAGAAGCAGACGTTCAGG - Intronic
1107002594 13:35566957-35566979 CAACTATGAATCAGAAGAGTTGG + Exonic
1107747658 13:43528352-43528374 AAACTAAGAACTAGAATTGTTGG + Intronic
1107748166 13:43534788-43534810 CAACTAGTAAGCAGAAGTTAGGG + Intronic
1108198610 13:48020104-48020126 CAACTGACAACCAGAAGTGAGGG - Intergenic
1109872629 13:68353967-68353989 CAACAAACAATAAGAAGTGTTGG - Intergenic
1110380097 13:74840551-74840573 CGACTAAGAAGAAGAGGTGGGGG - Intergenic
1110483045 13:76005510-76005532 CAAACAAGATGCTGAAGTGTAGG + Intergenic
1111469924 13:88666892-88666914 CTATCAGGAAGCAGAAGTGTTGG - Intergenic
1111878434 13:93924747-93924769 CAACTCAGAAGGAAAAGTATAGG - Intronic
1112460522 13:99600008-99600030 GAATTAAGAATCAGCAGTGTGGG + Intergenic
1112952638 13:105019844-105019866 TACTTAAGAATCAGAAGTGTGGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1115687065 14:35807569-35807591 CAACAAAAAAGCTGAAGTTTGGG - Intronic
1116249461 14:42462006-42462028 CAACTAAGAAGTAGAACTAAGGG - Intergenic
1117456025 14:55897738-55897760 CAACTAAGTTGGAGAAGTATTGG - Intergenic
1117549475 14:56819087-56819109 CAACCAAAAAGCAGAAGTAGTGG + Intergenic
1117637184 14:57755701-57755723 AAACTATGAAGCATAAGTTTTGG - Intronic
1118059920 14:62124803-62124825 CAAATAAGAAGCAGCAGAGCTGG + Intergenic
1118467784 14:66046436-66046458 CAAGTTACAAGCAAAAGTGTAGG - Intergenic
1119191603 14:72686431-72686453 CAACTAAGAAGCAGAAGTGTAGG + Intronic
1121008766 14:90507622-90507644 CAACTCAGAAGCAGCAGAGCTGG - Intergenic
1121033384 14:90678729-90678751 CAATTAAGAAGCAGGAGAGTTGG + Intronic
1121311728 14:92939029-92939051 CAACTCAGAAGCAGAAGCTTAGG + Exonic
1121458794 14:94057165-94057187 CAACTATGAAGCAGCAGACTGGG + Intronic
1125161902 15:36653884-36653906 CAACTAAGAAGCTGAAGGTGGGG - Intronic
1125625241 15:41103289-41103311 CAATTAGGAAGCAGTAGTCTAGG - Intronic
1125664593 15:41420220-41420242 CAAATAAGAAGCTGAAGGGGAGG - Intronic
1128709060 15:69858370-69858392 CCAGTGAGAAGCAGGAGTGTAGG - Intergenic
1128796710 15:70471663-70471685 CATCTAAGAAGCAGAGTTCTGGG - Intergenic
1133599785 16:7327983-7328005 GAAGGAAGAAACAGAAGTGTTGG - Intronic
1133700744 16:8306132-8306154 CAACTATGAAGCAGCAGACTGGG + Intergenic
1133901184 16:9976572-9976594 CAACTGAGACTCAGAAGTGCTGG + Intronic
1134768386 16:16782558-16782580 CAACTAATAAGCAGCAGAGCTGG + Intergenic
1134869233 16:17636781-17636803 CCACCAAGATGCAGAAATGTAGG - Intergenic
1135937340 16:26792600-26792622 CAACTGAGAAGCTGAACTCTGGG - Intergenic
1136006915 16:27337117-27337139 AAACAAAAAAGAAGAAGTGTAGG + Intronic
1137065822 16:35842076-35842098 CGACTAAGAAAAAGAAATGTTGG + Intergenic
1138779247 16:59762875-59762897 CAACAAAAAAGGAGAAGTTTAGG + Intergenic
1139827521 16:69768936-69768958 CAAGAAAGAAGCATTAGTGTTGG + Intronic
1140536672 16:75715996-75716018 CATATAAGAAACAGAAATGTGGG - Intronic
1140930799 16:79625993-79626015 CAACAAAGAAGCTGAGGTCTAGG - Intergenic
1141002990 16:80325452-80325474 CAACTCAGAGGCAGAATTGCTGG + Intergenic
1144664109 17:17090504-17090526 CAGCTGAGAAGCAGTGGTGTTGG + Intronic
1147280665 17:39358079-39358101 TAACTAAGAACCAGAAGTGGAGG + Intronic
1148822635 17:50368454-50368476 CAATAAAGAAGCAGAAGGTTTGG - Intronic
1149267944 17:54948136-54948158 GGACTAAGATGCAGAAGTGGAGG - Intronic
1149776254 17:59359807-59359829 GTACTAAGAAACAGAAGGGTGGG + Intronic
1149835804 17:59911263-59911285 CAAGTAAAAAGCATTAGTGTAGG + Intronic
1153243667 18:3053294-3053316 CAACTAAGAAGAAGAAACTTGGG - Intergenic
1153497503 18:5714798-5714820 ATACTAAGGAGCAGAAGTGCTGG + Intergenic
1154452104 18:14486842-14486864 CAAGGAAGAAGCAGAAGGATAGG - Intergenic
1157955892 18:52097245-52097267 AAACTAGGAAGCTGAAGTTTAGG + Intergenic
1157970043 18:52256564-52256586 CAGCTAAGAAGGTGACGTGTTGG - Intergenic
1158667853 18:59449087-59449109 CAACTAAGAAACTGAAATGTGGG + Intronic
1159843204 18:73425393-73425415 GAATTAAGAAGGAGATGTGTTGG - Intergenic
1162334496 19:10052139-10052161 CAGCTAGGAAGCAGAAGAGCTGG + Intergenic
1164196522 19:22969756-22969778 TAATTAAGAAGAAAAAGTGTTGG + Intergenic
1164687360 19:30176288-30176310 CAACTGAGAAGCAGAAATGGAGG - Intergenic
1165653766 19:37515132-37515154 GAAATAAGAAACAGAAGTATTGG + Intronic
1167823381 19:51950071-51950093 TAAATAAAAATCAGAAGTGTGGG - Intergenic
1168561054 19:57383614-57383636 CTTCTAAGAATCAGAAGTTTAGG - Intronic
1168633481 19:57975527-57975549 CCAGGAAGAAGCAGAAGTCTGGG + Intergenic
925174606 2:1773415-1773437 CAACGAAGAAGCTGATGGGTTGG - Intergenic
928136109 2:28688620-28688642 CATCCAAGAAGCAGCATTGTTGG - Intergenic
928269480 2:29843241-29843263 CAACTATGAATCAGAATTATTGG + Intronic
928793771 2:34991749-34991771 CAAGGAATAAGCAGAAGTGCTGG + Intergenic
928994676 2:37275062-37275084 CAAGTAAGAAGCAGAAATAATGG + Intronic
929103482 2:38340392-38340414 CAAATAAGAATTAGAAGTGGGGG + Intronic
929458294 2:42082283-42082305 CAACTAATAAGCAGTTGGGTAGG - Intergenic
930142558 2:47967517-47967539 GAACCAAGAAGCAGAAGGGAAGG - Intergenic
930364838 2:50426250-50426272 CAACTAAGAAACACAATTGGTGG - Intronic
930522967 2:52491350-52491372 CAACTAAGCTTCATAAGTGTAGG - Intergenic
931644180 2:64406463-64406485 CAACTATGGAGAAGAAGTGGGGG + Intergenic
935070489 2:99689563-99689585 CAACTGAGAAGCACATGAGTAGG - Intronic
935946089 2:108288027-108288049 CAAGGAGGAAGAAGAAGTGTCGG + Intergenic
937333768 2:121048030-121048052 CAGCCAAGAAGCAGCAGAGTGGG + Intergenic
938791865 2:134683566-134683588 CCACTAATAAGCAGAAATTTAGG - Intronic
939784900 2:146497197-146497219 CAAAAAAGAAGAAAAAGTGTGGG - Intergenic
940040893 2:149359533-149359555 CAACTGTGAAGCAGAAGGCTGGG - Intronic
941587395 2:167378067-167378089 AAACTAAGAATCATAAGTGAAGG - Intergenic
942624463 2:177884598-177884620 TAAGTTAGAAGCAGAAGTGATGG + Intronic
944790870 2:203124352-203124374 CAACAAAGTAGCAGATATGTAGG + Intronic
945435021 2:209809126-209809148 CAAGGAAGAAGCTGAAGTGGAGG - Intronic
947044252 2:225961444-225961466 CAACAAAGAGGGAGAAGTGGTGG + Intergenic
947310833 2:228799978-228800000 AACCTAAGAAACAGAAGAGTGGG + Intergenic
1169106933 20:3004479-3004501 CAGTTAAGAAGCAGAAGATTTGG - Intronic
1169362390 20:4962042-4962064 GAACTAAGAAGCAGAGGTCATGG + Intronic
1169409335 20:5354166-5354188 CAACCAAAGAGGAGAAGTGTGGG + Intergenic
1169773834 20:9230401-9230423 GAACTAAGAACCAGAAAAGTGGG + Intronic
1171335682 20:24383407-24383429 CAGTTAAGAGACAGAAGTGTTGG - Intergenic
1171503690 20:25615759-25615781 CAACTTAGAAGCAATAGGGTTGG + Exonic
1173103329 20:40107841-40107863 CAGCCAAGAAGCAGCATTGTAGG - Intergenic
1176443919 21:6801458-6801480 CAAGGAAGAAGCAGAAGGATAGG + Intergenic
1176822086 21:13666497-13666519 CAAGGAAGAAGCAGAAGGATAGG + Intergenic
1177113793 21:17061154-17061176 CCACTTAGAAGCAGAATTGAAGG + Intergenic
1178116724 21:29425514-29425536 AAAAGAAGAAACAGAAGTGTGGG + Intronic
1178823858 21:35998944-35998966 CAACCAAGAAATAGAAGTATAGG + Intronic
1178900871 21:36597542-36597564 CAACTGAGAATCAGAAGTAAAGG + Intergenic
1180239457 21:46490663-46490685 CACCCAAGCAGCAGAAGTCTCGG + Exonic
1180608707 22:17081730-17081752 CAAGTAGGAAACAAAAGTGTGGG - Intergenic
1180933762 22:19610776-19610798 CTGCTAAGGAGCAGAAGTGGGGG - Intergenic
1181672403 22:24431825-24431847 CCCCTCAGAAGCAGAAGTTTTGG - Intronic
1183666779 22:39250613-39250635 CAGCAAGGAAGCAGCAGTGTCGG + Intergenic
949793274 3:7817122-7817144 ATACTAAGATGCAGTAGTGTTGG + Intergenic
950197493 3:11019128-11019150 CTACTCAGAAGCAGAATTGCTGG - Intronic
951093419 3:18601009-18601031 CAAGAAAGAGGTAGAAGTGTGGG - Intergenic
951626702 3:24672922-24672944 CAATTATGAAGGAGATGTGTTGG - Intergenic
952128388 3:30330845-30330867 CCACTAGCAAGGAGAAGTGTAGG - Intergenic
952551616 3:34485086-34485108 CAAGGAAGAAGCAGAGATGTGGG + Intergenic
953752244 3:45617767-45617789 CAAGTCAGAAGCAGAAGGCTTGG - Intronic
953758978 3:45672178-45672200 CATCCAAGAGGCAGAAGTGAAGG + Intronic
955934716 3:64091576-64091598 CAACAAATAAGCAAAAGTCTAGG - Intergenic
957236766 3:77602833-77602855 CAACTCAGAAGCAGATGTTGTGG - Intronic
957849179 3:85783369-85783391 CAAATAAGAAGCAGAAGTGTTGG - Intronic
957866723 3:86034912-86034934 CAACAAAGCAGCAGAAGTAGGGG - Intronic
958714540 3:97764147-97764169 CAACTAAGAAGCAGGGGTACAGG + Intergenic
958896708 3:99837668-99837690 CAGGTCAGAAGGAGAAGTGTTGG - Intronic
959687066 3:109159041-109159063 CAATTAAGAAGCAGCAGTGGAGG - Intergenic
961430929 3:126882411-126882433 CTACTAAGAAACAGAAGTCCTGG + Intronic
961543821 3:127618340-127618362 CAAGTCAGAGGCAGAAGTGAGGG - Intronic
962280755 3:134049976-134049998 CAACTCAGAGGCAGAAATCTTGG + Intronic
964284148 3:155099196-155099218 CAACTAATAAGAAGAGGTGCTGG + Intronic
964436610 3:156659787-156659809 CAAATAAGAAACAGAGGAGTTGG - Intergenic
966827602 3:183978201-183978223 AAGCTGAGAAGCAGAAGAGTGGG - Intronic
968439118 4:612679-612701 GAACCAAGAGGCAGAAGTGGGGG + Intergenic
968839034 4:2987638-2987660 GTACTCAGAAGCAGAATTGTTGG + Intronic
969520474 4:7675246-7675268 CCACTCAGAAGCAGGTGTGTTGG - Intronic
970418909 4:15886682-15886704 CAACTAACAAGTAGAAGAGCTGG + Intergenic
971012844 4:22458180-22458202 CAAGTAGAAAGCAAAAGTGTAGG - Intronic
971127534 4:23770901-23770923 CAAGGAAGAAGCAGAAGTAGTGG - Intronic
972258601 4:37385294-37385316 CAACTGAGAAGCATAGGAGTTGG + Intronic
972823993 4:42735427-42735449 CAAATAACATGCACAAGTGTAGG + Intergenic
973680676 4:53315688-53315710 CAATTATGAAGCATAAGTTTGGG - Intronic
974318267 4:60310142-60310164 CCAGTAAGAGGCAGAACTGTTGG - Intergenic
976703717 4:87999884-87999906 AAACTAAGAACTAGAATTGTTGG + Intergenic
976753936 4:88478473-88478495 ACACAAAGAAGCAGATGTGTAGG + Intronic
976774667 4:88694992-88695014 CAACTAAGAGGCATAAGTATTGG - Intronic
977441405 4:97072575-97072597 CAATTAAAATGCAGAAGAGTAGG - Intergenic
981354935 4:143778131-143778153 CATCTAAGAAGCAGATGTTCAGG - Intergenic
981614205 4:146629610-146629632 TAACCAAGAGGCAGAAGTGTGGG - Intergenic
982735392 4:159001155-159001177 CAATTAAGAAGACCAAGTGTTGG - Intronic
982739352 4:159041587-159041609 GAACTGAGAATCAGGAGTGTTGG - Intergenic
983565756 4:169149946-169149968 AGAATAAGAAGTAGAAGTGTAGG - Intronic
984366702 4:178807930-178807952 AAACTATTATGCAGAAGTGTGGG + Intergenic
985015872 4:185635425-185635447 CACCACAGAAGCAGAAGTGTAGG + Intronic
985955949 5:3266533-3266555 CAACCAACACGCAGAAGAGTGGG - Intergenic
986247508 5:6023912-6023934 CAACTTGTAAGAAGAAGTGTTGG - Intergenic
986990808 5:13550966-13550988 CAACCAAGAAGAAGAAGAGATGG + Intergenic
988275194 5:29071886-29071908 CATCTATGTAGCATAAGTGTAGG + Intergenic
992790694 5:80210794-80210816 CAACTAAGACCCAGAAGGGCAGG - Intronic
993142077 5:84046921-84046943 AAAGCAAGAAACAGAAGTGTAGG - Intronic
994621902 5:102173422-102173444 CAGTGAAGAAGCAGAAATGTAGG + Intergenic
994907707 5:105862149-105862171 AAACTCTGAAGGAGAAGTGTGGG - Intergenic
997306855 5:132843880-132843902 CAACTAAAAACAAAAAGTGTAGG - Intergenic
998634651 5:143940107-143940129 CAACCCAAAAGCAGAAGTGTTGG - Intergenic
998761279 5:145434720-145434742 CAAGGAAGATGCAGAAGTGGGGG + Intergenic
999718650 5:154382097-154382119 CATCTGAGAAGCAGGACTGTTGG + Intronic
1000217148 5:159171021-159171043 CAACTAATAAGCAATTGTGTAGG - Intronic
1001164103 5:169347882-169347904 CAACTAGGAAGCAAAAATCTTGG + Intergenic
1001570805 5:172729435-172729457 CAGCTAAGAACCAGCAGTCTGGG + Intergenic
1003672030 6:8168431-8168453 CATCTAAGATCCAGAACTGTGGG - Intergenic
1004956974 6:20738466-20738488 AAACTAAGAAGTAGAAATGCTGG - Intronic
1005576650 6:27196076-27196098 CATCTAAGAAGCAGACGTTTAGG - Intergenic
1006033344 6:31193665-31193687 GCACTATGAGGCAGAAGTGTAGG - Intergenic
1006485019 6:34332440-34332462 CACCTCAGAGGCAGAAGTGAAGG + Intronic
1009297237 6:61967476-61967498 AAAATAAGAAGCAGCAGGGTGGG + Intronic
1010497654 6:76554736-76554758 CTGCTATGAAGCAGAAATGTGGG - Intergenic
1011060544 6:83261657-83261679 GATCTGAGAAGAAGAAGTGTTGG + Intronic
1011287363 6:85739197-85739219 TAACTAAGAAGCAGAGTTGGGGG + Intergenic
1012489378 6:99763825-99763847 AAGCTAAGAAGAAGAAGTATTGG + Intergenic
1014284691 6:119483695-119483717 ATACTAAGAAGGAGAAGTCTGGG + Intergenic
1014526230 6:122505024-122505046 GATCTAAGAAGCAGATGTTTAGG + Intronic
1014535040 6:122604933-122604955 AAAGTAAGAAGCAGAAGGATGGG - Intronic
1016212627 6:141558396-141558418 TAACTAAAAAGGAGAAGGGTAGG + Intergenic
1020982833 7:15093181-15093203 CAACTGAGATACAGAAGGGTTGG + Intergenic
1021741846 7:23694690-23694712 CAACTAGGAAGTAGCAGGGTTGG + Intronic
1022061161 7:26797047-26797069 CATCCATGAATCAGAAGTGTTGG + Intronic
1022368856 7:29751747-29751769 CAGCTAATAAGCAGTAGAGTTGG - Intergenic
1026431041 7:70347595-70347617 CATCTAAGAGGGGGAAGTGTAGG - Intronic
1029975773 7:104831819-104831841 CAAATAATAAGCAGTAGTGCAGG - Intronic
1030150738 7:106402478-106402500 AAATTAAAAAACAGAAGTGTAGG + Intergenic
1030251010 7:107444885-107444907 AAACTAATAAGCAGAAATGTAGG + Intronic
1036949151 8:13124375-13124397 AAGCTGGGAAGCAGAAGTGTTGG + Intronic
1037208269 8:16352632-16352654 CAAATAAAAGACAGAAGTGTTGG - Intronic
1040439956 8:47430703-47430725 CAACTGAGAAACAAATGTGTTGG - Intronic
1041011191 8:53545451-53545473 CAACTAAGTAGCAAACATGTTGG + Intergenic
1046169305 8:110484765-110484787 CATCTAAGAATCAGAAGAGCTGG - Intergenic
1047378076 8:124323171-124323193 AAACTAAGAATCAGAAGAATAGG + Intronic
1047812066 8:128421644-128421666 CAGCCAACAAGCAAAAGTGTGGG - Intergenic
1048110266 8:131460561-131460583 CAACCAAGGAGCATGAGTGTTGG - Intergenic
1048486702 8:134854986-134855008 TATTTAAGAAGCAAAAGTGTGGG - Intergenic
1048761531 8:137800981-137801003 CAGCTAAGGAGAAGAAGTGCAGG + Intergenic
1048767065 8:137856265-137856287 CAACAACAAAGCAGAAGTTTAGG + Intergenic
1050108824 9:2193875-2193897 CAACTAAGAAACAGAATTTAAGG - Intergenic
1053151684 9:35747863-35747885 GAAGAAAGAAGCAGTAGTGTTGG + Intronic
1055869521 9:80857460-80857482 CAATTAAGAAGTAGTAGTGAAGG + Intergenic
1056155167 9:83827271-83827293 CAACTAAGAAGAAGAAGAAAGGG + Intronic
1057116076 9:92523582-92523604 GATCTAAGAAGCAGATGTTTAGG + Intronic
1058318700 9:103602092-103602114 AAAATGAAAAGCAGAAGTGTTGG - Intergenic
1058611676 9:106783845-106783867 CAACTAAGGATGAGGAGTGTTGG + Intergenic
1061115751 9:128610537-128610559 CAACTAAAAGGCAGTAGTGTTGG - Intronic
1061329188 9:129881516-129881538 AAACAAAGACGCAGTAGTGTGGG - Exonic
1203525281 Un_GL000213v1:83069-83091 CAAGGAAGAAGCAGAAGGATAGG - Intergenic
1186802586 X:13108358-13108380 GAACTAAGAAACAGAAGAGCTGG - Intergenic
1189908509 X:45786100-45786122 AAACTGAGAAGCAGACATGTAGG + Intergenic
1190649214 X:52552622-52552644 AAACTAAGATTCATAAGTGTAGG + Intergenic
1191196505 X:57729625-57729647 CAACTAAGATTCATAAGTGAAGG - Intergenic
1193171337 X:78340030-78340052 AAACTAAGAATCATAAGTGAAGG - Intergenic
1194235235 X:91374743-91374765 AAACTAAGCAACAGAAGTGAAGG + Intergenic
1194389910 X:93303737-93303759 CAACTAATAAGTGGAAGAGTTGG + Intergenic
1195501091 X:105600763-105600785 CTACTAAGAAGTAGAATTGCTGG + Intronic
1198388751 X:136152298-136152320 CAACTAATAAGCAGCAAGGTTGG + Intronic
1199026362 X:142943212-142943234 CAACAAAGAACCAGAAGAATCGG + Intergenic