ID: 1119194743

View in Genome Browser
Species Human (GRCh38)
Location 14:72709065-72709087
Sequence TTCTAAAGTCTCTTGTTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 381}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119194743_1119194751 21 Left 1119194743 14:72709065-72709087 CCAAGAAACAAGAGACTTTAGAA 0: 1
1: 0
2: 3
3: 33
4: 381
Right 1119194751 14:72709109-72709131 ATTCTGATACTACCCCCACTGGG 0: 1
1: 0
2: 0
3: 4
4: 79
1119194743_1119194750 20 Left 1119194743 14:72709065-72709087 CCAAGAAACAAGAGACTTTAGAA 0: 1
1: 0
2: 3
3: 33
4: 381
Right 1119194750 14:72709108-72709130 TATTCTGATACTACCCCCACTGG 0: 1
1: 0
2: 0
3: 2
4: 67
1119194743_1119194752 26 Left 1119194743 14:72709065-72709087 CCAAGAAACAAGAGACTTTAGAA 0: 1
1: 0
2: 3
3: 33
4: 381
Right 1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119194743 Original CRISPR TTCTAAAGTCTCTTGTTTCT TGG (reversed) Intronic
900033782 1:390194-390216 TTGTAAAGTCTGTTGCTGCTGGG - Intergenic
900054617 1:620084-620106 TTGTAAAGTCTGTTGCTGCTGGG - Intergenic
904728314 1:32567461-32567483 TACCAAATTCTTTTGTTTCTAGG + Intronic
905076816 1:35279231-35279253 TTTTAAAGTGTCTTACTTCTGGG - Intronic
906242216 1:44249022-44249044 ATGTTAAGTCTCTTCTTTCTGGG - Intronic
906864970 1:49408168-49408190 TTCTAGAGTCTCTGGGGTCTAGG - Intronic
906986272 1:50686712-50686734 TTACAAAGTCTATTTTTTCTTGG + Intronic
908976386 1:69903883-69903905 TTCTAAATTTTCTAGTTTATTGG - Intronic
909062362 1:70893769-70893791 TTCCAAAGTCTATTGCTGCTAGG + Intronic
909277433 1:73705673-73705695 TTGTATAGTCTATTGCTTCTAGG + Intergenic
909322836 1:74311663-74311685 ATCTGAAGTCTCTTTGTTCTTGG + Intronic
911643836 1:100317821-100317843 TTCTCAAGTCTCTTTTATATGGG - Intergenic
912314879 1:108658822-108658844 TTATAAATTCTGTTTTTTCTTGG - Intronic
912664834 1:111569622-111569644 TTCTAAACTGTTATGTTTCTGGG + Intronic
913587312 1:120288231-120288253 TTCTGAAGTCCCGTGATTCTGGG + Intergenic
913620873 1:120610138-120610160 TTCTGAAGTCCCGTGATTCTGGG - Intergenic
913721039 1:121595516-121595538 TTCTGAAGTCTCTTGTATTGGGG + Intergenic
914225326 1:145715182-145715204 TTCTAAAGTTTCTCCTTTCTGGG - Intergenic
914841233 1:151250485-151250507 TTCAAAAGTTTCTAGTTTCCAGG + Intergenic
915045382 1:153009120-153009142 TTCTACAGTCTACTGTTTCCAGG - Intergenic
915645232 1:157266078-157266100 TTCTAAATTGTATTGTTTGTAGG + Intergenic
917133898 1:171769603-171769625 TTCTATTGTCTATTTTTTCTCGG + Intergenic
918615460 1:186539430-186539452 TTCTTTAGTCTCTTATTTATAGG - Intergenic
918716714 1:187798183-187798205 TTATAGAGTTTCTAGTTTCTGGG + Intergenic
919137681 1:193531297-193531319 TTCTAAAGTCACTTTTTCCCTGG - Intergenic
919163812 1:193867140-193867162 TTTTAAAATCTATTTTTTCTTGG + Intergenic
919287276 1:195579757-195579779 TTCTAAAGCCTCTGACTTCTTGG - Intergenic
919544713 1:198900704-198900726 TTCTAAATTTTCTCCTTTCTAGG + Intergenic
919710007 1:200716941-200716963 TTTTAAAGTTTGTTGTTTGTAGG - Intergenic
922150968 1:223004036-223004058 TTCAAAAATCTCTTGCTTGTAGG - Exonic
922256139 1:223894350-223894372 TTGTAAAGTCTGTTGCTGCTGGG - Intergenic
923411167 1:233710735-233710757 ATGTAAACTCTCTTCTTTCTGGG + Intergenic
923818838 1:237412137-237412159 TTGTCAAGCCACTTGTTTCTCGG - Intronic
924337345 1:242997216-242997238 TTGTAAAGTCTGTTGCTGCTGGG - Intergenic
1063119505 10:3094986-3095008 TTTTAAAGTCTGTTATCTCTAGG + Intronic
1063585883 10:7352026-7352048 TTCTGAAGTCGCTTTTTTCTGGG + Intronic
1063657483 10:8006550-8006572 TGCTAAAGTCTCTTGATCTTTGG + Intronic
1063755787 10:9006504-9006526 TACTAAAATGTTTTGTTTCTAGG - Intergenic
1063933321 10:11051155-11051177 CTCTATAGTCTTTGGTTTCTAGG + Intronic
1064567045 10:16651242-16651264 CTCTTTATTCTCTTGTTTCTAGG + Intronic
1064655665 10:17553115-17553137 TTCTAAAGAGTCTTGGATCTAGG - Intergenic
1065321481 10:24514248-24514270 TTGATAATTCTCTTGTTTCTTGG + Intronic
1065466781 10:26032914-26032936 TTTTAAAGTCTCATGTGTCAAGG - Intronic
1067066377 10:43106300-43106322 TTCTAAGGTCTCTGGTTTTGGGG + Intronic
1069364100 10:67678198-67678220 TTCTAAATTTTCTTTTGTCTTGG - Intronic
1070244411 10:74717197-74717219 TTCTAAAGTCTATTTTATCAGGG + Intergenic
1071330154 10:84550909-84550931 TTCCACAGTCTCTTGTTTCTAGG + Intergenic
1073476928 10:103759887-103759909 TTCTGAGGTCTCTTGCTTTTTGG - Intronic
1074502767 10:114041879-114041901 TTCTAACGCCTCTTGTTTCCTGG + Intergenic
1076299908 10:129417705-129417727 TTCTGAAGTCTCTTGTATATCGG - Intergenic
1076436405 10:130447139-130447161 TTCTATGGTCTCATTTTTCTTGG + Intergenic
1077744326 11:4883644-4883666 TTCTATTTGCTCTTGTTTCTTGG + Intronic
1078292068 11:10021948-10021970 TTCTAAATTCACTTTTTTCTGGG - Intronic
1079167273 11:18056822-18056844 CTCAAAACTCTCTTCTTTCTTGG - Intergenic
1079423659 11:20318634-20318656 TTCTAAATTCTGTAGTTTATAGG + Intergenic
1080298959 11:30762731-30762753 TTCTACTTTCTCTTGGTTCTGGG - Intergenic
1081349353 11:42030492-42030514 TCCTATAGTCACTTATTTCTGGG - Intergenic
1081538922 11:44016163-44016185 TACCAAAGTCTCATGTTCCTGGG - Intergenic
1081606201 11:44528647-44528669 TCCTAAAGTCTGTTATTGCTAGG + Intergenic
1083499331 11:63088907-63088929 TTTCATAGTCTCATGTTTCTTGG - Intronic
1084511545 11:69607816-69607838 TTCTGATGTCTCTTATGTCTGGG - Intergenic
1085380536 11:76113364-76113386 TGCTAAATTCTCTTCTTTCATGG + Intronic
1085557737 11:77440778-77440800 TTAGAAGGTCTCTTGTTTTTTGG - Intronic
1085818050 11:79762331-79762353 TTCTGAAGAATCTTGTTTCTTGG - Intergenic
1087010587 11:93510448-93510470 TTTAAAAATCTCTTCTTTCTTGG - Intronic
1088325290 11:108594357-108594379 TTCTACAGTCCTTTGCTTCTGGG - Intergenic
1088554323 11:111046255-111046277 TACTACAGTCTCTTTTTCCTAGG + Intergenic
1088585938 11:111360212-111360234 TCCTAAGGTCTAGTGTTTCTTGG - Intronic
1089936719 11:122371797-122371819 TTCTAGATTCTCCTCTTTCTTGG - Intergenic
1094054781 12:26257649-26257671 TTATAAAGTCCCATGTTTCTTGG - Intronic
1095248949 12:39956505-39956527 ATCTAAAGTCTCTAGATTATTGG - Intronic
1095449299 12:42312928-42312950 TTTTAAAATATCTTTTTTCTTGG + Exonic
1096324239 12:50644496-50644518 GTCCAAAGTCACTTGTGTCTGGG + Intronic
1097841064 12:64321677-64321699 TTTTAAACTCTCTTATTTCTTGG + Intronic
1097941633 12:65314722-65314744 ATTTAAACTCTCTTGTTACTAGG - Intronic
1099918581 12:88927806-88927828 CTCTAAAGTCTCTTTTATCAGGG + Intergenic
1100016322 12:90015162-90015184 TTCTTATGCCTCTTGTTTGTGGG - Intergenic
1100786596 12:98085153-98085175 TTCTATTATCTCTTGTTGCTAGG + Intergenic
1100928161 12:99574295-99574317 TTGTAGAGTCTTTTTTTTCTGGG + Intronic
1101151267 12:101884730-101884752 TTTTAAAGTGGCTTGATTCTAGG - Intronic
1104470461 12:129025669-129025691 ATATAAAGTCTCTTCTCTCTTGG - Intergenic
1104598509 12:130136556-130136578 TTCTGAAGTCCTGTGTTTCTAGG - Intergenic
1104881540 12:132074832-132074854 GTTTATAGTCTCTTGTTTCCAGG + Intronic
1105718247 13:23088694-23088716 TTTTAGACTCTCTTGTTTTTTGG + Intergenic
1105763341 13:23533399-23533421 TTCTATACTCTCCTTTTTCTTGG - Intergenic
1105934298 13:25085024-25085046 TAGTAAAGGCTCTTGCTTCTGGG + Intergenic
1106373293 13:29158503-29158525 TGCTATAGTCTGTTCTTTCTGGG - Intronic
1106465746 13:30013129-30013151 TTGTAAAGTCCCTTGTATGTGGG - Intergenic
1107125375 13:36840335-36840357 TGCTAAGGTCTCAGGTTTCTAGG + Intergenic
1107625959 13:42284361-42284383 TTTGACAGTCTCTGGTTTCTTGG + Intronic
1110066174 13:71108750-71108772 TGGTATAGTCTATTGTTTCTAGG + Intergenic
1111807690 13:93058078-93058100 TTAAAAAGTCTCTCTTTTCTAGG - Intergenic
1112352067 13:98644243-98644265 TTTGAAAATCTATTGTTTCTTGG + Intergenic
1113274771 13:108716489-108716511 TGCTAAAGTCTCCTTTTCCTGGG + Intronic
1114259800 14:21028213-21028235 TTCTTAGGTTTTTTGTTTCTTGG + Intronic
1114313879 14:21492274-21492296 TTTTAAAGTCTCTTTTTTGCAGG + Exonic
1115939698 14:38594826-38594848 TTTTAAAATCTCTTTTCTCTAGG - Intergenic
1117353906 14:54905378-54905400 TTTTAAAGTCTCTAATTTCTAGG + Intergenic
1117782629 14:59250007-59250029 TACTAAAATCTCTTGTTCTTGGG + Intronic
1118417292 14:65555245-65555267 TTCTAAGGTGTTTTATTTCTTGG + Intronic
1118422692 14:65624178-65624200 TTTTAAAATCTTTTGTTTCTCGG - Intronic
1119194743 14:72709065-72709087 TTCTAAAGTCTCTTGTTTCTTGG - Intronic
1120452078 14:84681102-84681124 TTGTGAATTCTCTAGTTTCTGGG - Intergenic
1123390657 15:19868515-19868537 TTCTAACATTTCTTGTTTTTGGG - Intergenic
1123495674 15:20823084-20823106 TGCAAAAGTCTACTGTTTCTGGG + Intergenic
1123552161 15:21392176-21392198 TGCAAAAGTCTACTGTTTCTGGG + Intergenic
1123588405 15:21829573-21829595 TGCAAAAGTCTACTGTTTCTGGG + Intergenic
1124916506 15:33979957-33979979 TTGTTAAATCTCTGGTTTCTGGG + Intronic
1125218089 15:37301877-37301899 GTCTAAATTCTGTTGTTTCATGG - Intergenic
1125413532 15:39429474-39429496 TGCTTACGTCTCTTATTTCTGGG + Intergenic
1127233282 15:57019797-57019819 TTCTATAGTCTTTTGCTTCTAGG - Intronic
1127551932 15:60047490-60047512 TTCTACAGTCACTTGTTTGATGG - Intronic
1127704109 15:61530367-61530389 TTCTGAAGACTATTGGTTCTAGG + Intergenic
1128209425 15:65884727-65884749 TACTTAAGTCTCTTGTGGCTGGG + Intronic
1129969878 15:79768907-79768929 TTCTAAAGTGGAGTGTTTCTGGG - Intergenic
1130664666 15:85859738-85859760 TTCTAAAGCCTCTTGCCTCAGGG + Intergenic
1130732132 15:86507358-86507380 TTCTCCAGTCTCTAGTTTCTGGG - Intronic
1131064140 15:89422543-89422565 TTCCAAACTCTCTTGGATCTGGG + Intergenic
1131336695 15:91555944-91555966 TTCCAAGGCCTCTGGTTTCTGGG - Intergenic
1202960509 15_KI270727v1_random:119407-119429 TGCAAAAGTCTACTGTTTCTGGG + Intergenic
1133191932 16:4140194-4140216 TTCTCAAGCCTCTTGTCTCATGG - Intergenic
1133635803 16:7663973-7663995 CTCTGAAGTCTCTTCTTTCTGGG + Intronic
1135559974 16:23468768-23468790 CTCTAAAGTCTCTGGTTTGCTGG - Intronic
1135619454 16:23943036-23943058 TTCTAAAGTCCCTCTTTCCTGGG - Intronic
1135904033 16:26493922-26493944 TTTTAATGAATCTTGTTTCTGGG + Intergenic
1138935164 16:61710804-61710826 TTCTAAAATATCTTGTTTGCAGG - Intronic
1139011643 16:62642239-62642261 ATCTAAAGTTTCTTGTTACATGG - Intergenic
1139169549 16:64614489-64614511 TTATAAAGTCCCATATTTCTTGG + Intergenic
1142009268 16:87705583-87705605 TTCAAAAGTCTCTTTTTCCTTGG + Intronic
1142074818 16:88111247-88111269 TTCTAAAGACTTTTTTTTGTGGG + Intronic
1143904268 17:10197408-10197430 TTCTAAAGTCCTTTGTGTGTGGG - Intronic
1144286235 17:13777526-13777548 TTGTAGATTCTATTGTTTCTGGG + Intergenic
1145725678 17:27120875-27120897 TTCTATACTCTTTTGTTTTTTGG + Intergenic
1146895655 17:36539934-36539956 TTATAAAGTCTTATGTGTCTGGG + Intronic
1146976477 17:37117317-37117339 TTTTAAAGTCTCTGATTACTAGG - Intronic
1148260386 17:46177634-46177656 TTCTTTTGTCTTTTGTTTCTTGG + Intronic
1149066285 17:52484251-52484273 TTTTAAGGGCTCTTATTTCTTGG + Intergenic
1149377800 17:56063407-56063429 TTATGAAATCTCTTATTTCTTGG + Intergenic
1149830424 17:59867093-59867115 TTATAAAATCTCTTGCTTTTGGG - Intronic
1150018415 17:61584345-61584367 TTCTAAACTCTATAGTATCTTGG - Intergenic
1150968727 17:70002387-70002409 TACTAAATTTTCTTTTTTCTTGG - Intergenic
1151507083 17:74536030-74536052 TTCTAAATGATTTTGTTTCTAGG - Intergenic
1152159642 17:78659559-78659581 TTCTAAAATCTGTTATTTCATGG - Intergenic
1152446144 17:80345440-80345462 CTCTCAAGTTTCTTGTGTCTGGG - Exonic
1154258082 18:12802690-12802712 CTCTACAGTCTGTTCTTTCTTGG - Intronic
1154453080 18:14495516-14495538 TGCAAAAGTCTACTGTTTCTGGG + Intergenic
1155300954 18:24428134-24428156 TTCTAAATTATCTTTGTTCTTGG + Intronic
1155400943 18:25438153-25438175 TTCTAAATTCCCTTGTCTCCCGG - Intergenic
1156006406 18:32447852-32447874 TTCTAAATTATGTAGTTTCTTGG - Intronic
1156729144 18:40169100-40169122 TTCTGAACTCTCATTTTTCTAGG - Intergenic
1156756888 18:40538530-40538552 TTCTAAAGTCTCATTTATTTTGG - Intergenic
1157133160 18:45027545-45027567 ATATAAAGTCTCTGCTTTCTAGG + Intronic
1157726023 18:49964602-49964624 TTTTAAAGTCTTTGGTTCCTTGG + Intronic
1157893508 18:51441751-51441773 TGCAAAATTCTCTTGTGTCTGGG - Intergenic
1158098782 18:53805650-53805672 TTCTATAGTCCCATATTTCTTGG - Intergenic
1158253801 18:55521794-55521816 TTCTAAAGTCTCATTTTTAAAGG + Intronic
1158479494 18:57807827-57807849 TTCTAATGTCACTTATTGCTAGG - Intergenic
1158764803 18:60437056-60437078 TTTCTAAATCTCTTGTTTCTTGG - Intergenic
1159365245 18:67457229-67457251 TTCTAATGTCTCTTATTTAATGG - Intergenic
1159633716 18:70779869-70779891 TTCTAAAATGTATTTTTTCTTGG - Intergenic
1159739174 18:72143222-72143244 TTCTCTATACTCTTGTTTCTAGG + Intergenic
1160298749 18:77659785-77659807 ATCTAAAGCCTCCTCTTTCTGGG + Intergenic
1160420117 18:78738251-78738273 TCCTAGAGTCTCTTGCTTTTGGG - Intergenic
1166552754 19:43677364-43677386 TTCTTACGTTTCTTGGTTCTTGG - Intergenic
1168050440 19:53825745-53825767 TTATAAAGACTCTTGTGGCTGGG - Intergenic
926246475 2:11125315-11125337 TTCTAAAGTCTGTGCTTTATTGG - Intergenic
927325199 2:21797336-21797358 TTTTTATGTGTCTTGTTTCTAGG - Intergenic
928583112 2:32728442-32728464 CCCTAAAGTCTGTCGTTTCTGGG + Intronic
930856028 2:56019053-56019075 TTCTTTTGTCTCTTGTTTATTGG + Intergenic
931936357 2:67201187-67201209 TTCTAAATTTTCTTTCTTCTTGG - Intergenic
932805771 2:74781619-74781641 GTCTCTGGTCTCTTGTTTCTGGG + Intergenic
934969829 2:98754330-98754352 TTATATAGTCACTTGTTTGTTGG + Intergenic
934977858 2:98817929-98817951 TTCTAGTCTGTCTTGTTTCTGGG - Intronic
935178788 2:100672435-100672457 TTCTAGAGACTCATCTTTCTTGG + Intergenic
935221221 2:101015102-101015124 CTATAAAGTCTGTTGTTCCTAGG + Intronic
935740109 2:106139785-106139807 TTCTATAGTCTTTAGTTTCATGG - Intronic
937801311 2:126083483-126083505 GTCTAAAGTCTCATATTCCTTGG + Intergenic
938529839 2:132173622-132173644 TTCTAACATTTCTTGTTTTTGGG + Intronic
938932538 2:136099479-136099501 TTTTAAGGTCTCTAGTTTATGGG - Intergenic
939109860 2:137993508-137993530 TTATGAAGTCTCATATTTCTTGG - Intronic
939909801 2:147966156-147966178 TTCTATTTTCTTTTGTTTCTAGG - Intronic
941229802 2:162897732-162897754 TTCTAAAGTCTAGCCTTTCTAGG + Intergenic
941432034 2:165424723-165424745 TTCTAAAGACCCCTGTTTTTTGG + Intergenic
942113811 2:172707738-172707760 TTCTCAAGACTTTTGTTTCTGGG - Intergenic
942819253 2:180091938-180091960 GTCTCAACTCTGTTGTTTCTTGG - Intergenic
942970720 2:181954555-181954577 TTCTGAAGTTTCTTGGTTCGTGG - Intronic
943787669 2:191896617-191896639 TTCTAAAATCTAATGTTTCAGGG + Intergenic
944721923 2:202431705-202431727 TTATAAAGTCTATTGCTCCTAGG - Intronic
945311593 2:208319879-208319901 TTTTAAAGTTGCTTATTTCTTGG + Intronic
946167626 2:217874885-217874907 TTCTAAGCTCTATTGTTTATAGG - Intronic
946995928 2:225391031-225391053 TTCCAAAGGCTCTTCTTTCAGGG + Intergenic
1169614216 20:7421069-7421091 TTAAAAATTCTCTGGTTTCTTGG + Intergenic
1169880911 20:10345288-10345310 TTCTGAAATCTGTTTTTTCTGGG + Intergenic
1170035916 20:11989716-11989738 TTCAAAAGTCTCTTTGCTCTTGG - Intergenic
1170252982 20:14306219-14306241 TTGAAAATTCTCTTCTTTCTTGG + Intronic
1170779333 20:19410170-19410192 TGATAAAGTCTCCTGATTCTTGG - Intronic
1171018889 20:21566261-21566283 TTCTAAAAGCTTTTTTTTCTTGG + Intergenic
1173449497 20:43150373-43150395 TGCTGAAGCCTCCTGTTTCTGGG + Intronic
1173725170 20:45292331-45292353 TTCTAGAGGCTTTTGTTTCCTGG - Intergenic
1176442952 21:6792733-6792755 TGCAAAAGTCTACTGTTTCTGGG - Intergenic
1176766665 21:13026309-13026331 TTCTAACATTTCTTGTTTTTGGG - Intergenic
1176821109 21:13657747-13657769 TGCAAAAGTCTACTGTTTCTGGG - Intergenic
1178264466 21:31130069-31130091 TGCTTAACTCTCTTGTCTCTCGG - Intronic
1179384247 21:40927432-40927454 TTCCATAGGCTCTTTTTTCTAGG + Intergenic
1180513796 22:16120586-16120608 TTCTAACATTTCTTGTTTTTGGG - Intergenic
1182164040 22:28154249-28154271 TTCTATAGCCTCTGGTTTTTTGG - Intronic
1182783761 22:32889308-32889330 TTCTAAACACTCTTGCTTCAGGG + Intronic
1183590838 22:38778480-38778502 TTCTACAGTCTCTTGATGTTAGG - Intronic
1183769211 22:39909030-39909052 TTCAAAAGTCTCTTGTATAGTGG - Intronic
1183875035 22:40772967-40772989 TTTCAAAGTATCTTGTATCTAGG + Intronic
1184337305 22:43861655-43861677 TTGTACATTCTCTTGTTTCAGGG - Intronic
1184809568 22:46821897-46821919 TTATGAAGTCTCATATTTCTTGG + Intronic
949619218 3:5791206-5791228 TGCTAAAGTCTTTGCTTTCTGGG + Intergenic
950156668 3:10726138-10726160 TGCTCAACTCTCTTGTTTCCAGG + Intergenic
950977942 3:17269668-17269690 CTCTAGTGTCTCCTGTTTCTGGG + Intronic
951369960 3:21833664-21833686 TTCTAAATTATTTTGTTTCCTGG - Intronic
951622669 3:24622962-24622984 TTTTAACCTCTCTTGTTTCCTGG + Intergenic
952720498 3:36527162-36527184 TTCTAAAATCTAATGTTTCTTGG - Intronic
953164704 3:40454484-40454506 TTATCCAGTCTCTTGTTTATGGG + Intergenic
953804449 3:46055988-46056010 CTCCAAAGTCTCAGGTTTCTAGG + Intergenic
955596135 3:60592703-60592725 TTCTAACCTTCCTTGTTTCTAGG - Intronic
955607662 3:60723029-60723051 GTCTTAATTCACTTGTTTCTGGG + Intronic
955829837 3:62989474-62989496 ATCTAAGGTCCCTTGGTTCTTGG + Intergenic
958443838 3:94190597-94190619 TTATTATGTCTCATGTTTCTAGG - Intergenic
958706062 3:97657209-97657231 TTCTAAAGGCTCTTTTTTTAAGG + Intronic
958835415 3:99139704-99139726 TTCTATAGTCCCATATTTCTTGG + Intergenic
958978100 3:100690035-100690057 TTCTATAGTCCCATATTTCTTGG + Intronic
959418220 3:106103200-106103222 TTGTAAAGTCTCTTATTTCTTGG + Intergenic
959524304 3:107359245-107359267 TTCTAGATTCTTTTATTTCTAGG + Intergenic
959989063 3:112610748-112610770 TTCTAAAATCTTATGGTTCTAGG - Intronic
961228153 3:125273468-125273490 TTCAAAAATCTCTTTTTTTTGGG + Intronic
961298049 3:125903031-125903053 ATCTCAAGTCACTTCTTTCTAGG - Intergenic
961609019 3:128121801-128121823 TTGTAAAGTCTCTTCTACCTTGG - Intronic
961838610 3:129686881-129686903 TTCCAAATTCTCTATTTTCTTGG - Intronic
961941198 3:130638770-130638792 TTCTAACTTCTTTTGTTACTTGG + Intronic
963076651 3:141353454-141353476 TTCTAATGTCTTTTGCTTTTTGG - Intronic
963531141 3:146474797-146474819 TTATAAAGTCCCATATTTCTTGG + Intronic
963998748 3:151742069-151742091 TTATAATGTCTATTTTTTCTTGG - Intronic
964276671 3:155015821-155015843 CAGTAAACTCTCTTGTTTCTAGG + Intergenic
964543523 3:157806504-157806526 TTCTAACATCTGATGTTTCTGGG - Intergenic
964932390 3:162042763-162042785 TTCTACAGTCTCTTGGGTCCTGG - Intergenic
965263478 3:166511963-166511985 TTATGAAGTCTCATATTTCTTGG - Intergenic
965887045 3:173458701-173458723 TTCTTAAGTCACTTGTATCTGGG - Intronic
966424309 3:179764678-179764700 TTTCAGAGTCCCTTGTTTCTTGG - Intronic
966539487 3:181074009-181074031 TTATGAAGTCTCATATTTCTTGG + Intergenic
966607232 3:181833648-181833670 TTCTAATGTCTCTGTTATCTTGG + Intergenic
967775230 3:193379447-193379469 TTTTAAAGCCTCTTTCTTCTTGG - Intergenic
970155252 4:13134796-13134818 TTATGAAGTCTCATATTTCTTGG - Intergenic
970321211 4:14877361-14877383 GCTTACAGTCTCTTGTTTCTAGG + Intergenic
970739346 4:19215769-19215791 TTATAAAGTCTATGGTTTCTGGG + Intergenic
970763559 4:19519118-19519140 TTCTAAGGTCTCTTGTATAAGGG + Intergenic
971439201 4:26661529-26661551 TTCAAAAGTCTGGGGTTTCTAGG - Intronic
971522155 4:27567701-27567723 TGCTCTAGTCTCTTATTTCTGGG - Intergenic
971838844 4:31805846-31805868 TATTAATGTCTCTTGTTTCTTGG - Intergenic
972323914 4:37997302-37997324 ATCTAAAGTTTTTGGTTTCTGGG + Intronic
972356239 4:38281553-38281575 TTAGTAAGTCTCTGGTTTCTAGG + Intergenic
973054136 4:45633094-45633116 TTCTAGATTTTCTTATTTCTTGG - Intergenic
973076110 4:45928139-45928161 TTCCAAAGTCATTTGTTTCATGG + Intergenic
973584815 4:52379043-52379065 TTATAAAGTCCCATATTTCTTGG - Intergenic
973918986 4:55665649-55665671 TTCTAAAATTCCTTGTCTCTGGG - Intergenic
974276034 4:59722210-59722232 GTTTAAAGTCTATTGTTTCTAGG + Intergenic
974618890 4:64329548-64329570 TTCTAAAGTCTATTATGTGTGGG + Intronic
974904943 4:68044080-68044102 GACTAAAGTCACTTTTTTCTTGG + Intergenic
976156311 4:82148488-82148510 TGCTAAAGTCTCATGTATCAGGG - Intergenic
976517893 4:85992341-85992363 ATTTAAACTCTCTTGTATCTTGG - Intronic
978084400 4:104632552-104632574 TTCTAGAGCCTCTTGTCACTGGG + Intergenic
978332755 4:107632628-107632650 TTCTAAAGTTTCATTATTCTAGG - Intronic
978590426 4:110318287-110318309 TCCTAAATTCTCTTGTATCCTGG + Intergenic
978656992 4:111076037-111076059 TTATAAAGTCCCATATTTCTTGG - Intergenic
979239788 4:118438092-118438114 TTGTAAAGTCTGTTGCTGCTGGG + Intergenic
979877284 4:125909227-125909249 CTCTTAAATCTTTTGTTTCTTGG + Intergenic
980173949 4:129322635-129322657 TTTTAAAGTCTGTGGTTGCTGGG + Intergenic
980392776 4:132168580-132168602 TTATGAAGTCTCATATTTCTTGG + Intergenic
980481882 4:133398068-133398090 TGCTAAATTTTCTTTTTTCTTGG + Intergenic
981701537 4:147612541-147612563 TTCCAAACTTTCTTGTTTCATGG - Intergenic
982307290 4:153945960-153945982 TTCTTGATTCTCCTGTTTCTGGG + Intergenic
982462066 4:155682857-155682879 TTCTAAAATGTCTTGCTTATTGG - Intronic
982764791 4:159333346-159333368 TTCTACTGTATTTTGTTTCTGGG + Intronic
982973086 4:162015821-162015843 TTCCAAAGTCTCTGGTTTAAAGG + Intronic
983809085 4:172035432-172035454 TTCTAAAGCCTTTTTATTCTAGG - Intronic
984298741 4:177888130-177888152 TTCTGAGGTCTCTTATTTCCTGG + Intronic
985046652 4:185947589-185947611 TTACAAAATCTCTTTTTTCTTGG + Intronic
987203604 5:15602313-15602335 GTAAAAACTCTCTTGTTTCTTGG + Intronic
987242118 5:16010847-16010869 TTTAAATATCTCTTGTTTCTAGG - Intergenic
987411886 5:17623018-17623040 TTTTAAATTGTATTGTTTCTTGG + Intergenic
988846412 5:35132249-35132271 CTCTAAAGTCTCTAGTCTCTTGG + Intronic
989606877 5:43252890-43252912 TACTCTAGTCTCATGTTTCTAGG + Intronic
991201033 5:63992884-63992906 TTATAAACTTTATTGTTTCTGGG - Intergenic
991314194 5:65281575-65281597 TTTTTAAATGTCTTGTTTCTTGG - Intronic
992151108 5:73904056-73904078 TTCTATAGGCTTTTATTTCTGGG + Intronic
992247636 5:74842968-74842990 TACTAAATTTTCTTGTTGCTTGG - Intronic
992965837 5:81999057-81999079 ATGTATAGTCTGTTGTTTCTGGG - Intronic
994647332 5:102486557-102486579 TTGTGAAGTCTATTGTTTCCAGG + Intronic
994882052 5:105511130-105511152 TTCTACAGACTCTCCTTTCTTGG - Intergenic
996312668 5:122124368-122124390 TTGTAAAGCCTCCTGTTTCAGGG - Intergenic
996350530 5:122536007-122536029 TTCTAAAGTGTTGTCTTTCTAGG - Intergenic
996589025 5:125124839-125124861 TTTTAAAGTCTCTAATTTCCTGG + Intergenic
996704963 5:126488343-126488365 TACAAAAGTCTCGTGTTTCAAGG + Intronic
996893986 5:128457283-128457305 TTATGAAGTCTCATGTTTCCTGG - Intronic
996951360 5:129129816-129129838 TTTTAAATTCTCTTGTTTGTAGG + Intergenic
997291088 5:132736298-132736320 TTCTAAAGTCTCTTCTTGGGAGG + Intronic
997670852 5:135670891-135670913 TGATAAAGTCTCTTGCATCTGGG - Intergenic
997940136 5:138149807-138149829 TTCTAAAGTTTCCTGTTTCCTGG - Intronic
998658823 5:144212750-144212772 TTCTCAAGTATTGTGTTTCTTGG + Intronic
998755476 5:145374641-145374663 TTATGAAGTCTCATATTTCTTGG + Intergenic
1001624203 5:173117076-173117098 TTCTAAAGGTTCTTTATTCTGGG + Intronic
1002740038 5:181428674-181428696 TTGTAAAGTCTGTTGCTGCTGGG + Intergenic
1005111737 6:22289518-22289540 TTCTAAATTTTGTTTTTTCTTGG - Intronic
1006036606 6:31218071-31218093 TTGTAAAGTCTCTTGTCCCATGG + Intergenic
1006909951 6:37557361-37557383 TTCTAAAGTCCCATGTGGCTTGG - Intergenic
1007163500 6:39811663-39811685 TTCTGAAGTCTTTTATGTCTGGG + Intronic
1007720922 6:43885026-43885048 GTCTAATGTCTCTGGGTTCTTGG - Intergenic
1008412546 6:51197207-51197229 TTCTGAAGTCTATGTTTTCTGGG - Intergenic
1008826611 6:55702144-55702166 GTCTAAAGCCTCGTGTTTCAGGG - Intergenic
1010371555 6:75115691-75115713 TTCTAAAGTCCCAGGATTCTGGG + Intronic
1011166740 6:84456144-84456166 TTGAAAAGGCTGTTGTTTCTAGG + Intergenic
1011321250 6:86095747-86095769 TTACAAAGTCCCTTGTTTCTTGG - Intergenic
1011340156 6:86305544-86305566 TCATAGAGTCTCATGTTTCTTGG + Intergenic
1011553796 6:88553917-88553939 TTCTCACGTCTCCTGTCTCTTGG - Intergenic
1011779008 6:90765588-90765610 TTCTAAAGTTTCTTTTTTAGTGG + Intergenic
1012134004 6:95533098-95533120 TTCCAAACTTTCTTGCTTCTTGG - Intergenic
1013128845 6:107212301-107212323 TCCTAAAGTCTTTTTTATCTTGG - Intronic
1013330029 6:109091268-109091290 TTATATAGCCTGTTGTTTCTAGG - Intronic
1013563915 6:111336531-111336553 TTCCAATGTCTCTACTTTCTTGG - Intronic
1013626688 6:111944828-111944850 TGGTATAGTCTGTTGTTTCTAGG + Intergenic
1013730652 6:113161615-113161637 TTCCAAAGTCTATTGATTCTAGG - Intergenic
1014084926 6:117331322-117331344 TTATGAAGTCTCATATTTCTTGG - Intronic
1014226138 6:118849321-118849343 TGTTAAAGTCTCTTATTACTGGG - Intronic
1014267811 6:119301133-119301155 TCGTAAAGTCTCTTGTCTTTCGG - Intronic
1014353955 6:120380383-120380405 TTCAAATGTATCTTGTTTCCTGG - Intergenic
1015174233 6:130288979-130289001 TTCTATAATCTCTTATTTCATGG + Intronic
1015196068 6:130525866-130525888 TTCTAAAGTTCCTTTTTTCAGGG + Intergenic
1017882074 6:158568944-158568966 TTCTGAAGTCTGTGGTTTTTTGG + Intronic
1019245150 6:170704274-170704296 TTGTAAAGTCTGTTGCTGCTGGG + Intergenic
1020633643 7:10671086-10671108 TTATGAAGTCCCATGTTTCTTGG + Intergenic
1023066279 7:36380960-36380982 TTTTAAACTCCCTTTTTTCTTGG + Intronic
1023696546 7:42853876-42853898 TTTTAAAGTCTCTTAATTGTAGG - Intergenic
1024733504 7:52277731-52277753 TTCTAACCTCTCCAGTTTCTTGG - Intergenic
1024811110 7:53213359-53213381 TTTTTAACTCTCCTGTTTCTGGG + Intergenic
1025960857 7:66220376-66220398 TTCAAAAGGCTCTAGTTTCAAGG + Intronic
1027197753 7:76042835-76042857 TTCACAAGTCTCTGCTTTCTTGG + Intronic
1028066368 7:86390416-86390438 TTCTAAAATCTCTGTTTTCTTGG + Intergenic
1028196402 7:87912603-87912625 CTCTAAAATCCCTTATTTCTGGG + Intergenic
1030824391 7:114137885-114137907 TACTAATGTCTGTTGCTTCTAGG - Intronic
1031995737 7:128229551-128229573 TTCTAAAGTCTCCTGGTTATTGG - Intergenic
1032823828 7:135550198-135550220 TTCTATTGTCCCTTGTTTCTGGG + Intergenic
1033418354 7:141184409-141184431 TTCTAAATGCTCTTGACTCTAGG + Intronic
1033517177 7:142118714-142118736 TTCTTTAGTCTCTTATTTGTAGG - Intronic
1034006801 7:147481992-147482014 TTCTGAAATTACTTGTTTCTTGG + Intronic
1034035925 7:147822001-147822023 TTTTAAACACTATTGTTTCTTGG - Intronic
1035091188 7:156312718-156312740 TTCTAAATTCTCTAATTTGTTGG + Intergenic
1035502973 8:103928-103950 TTGTAAAGTCTGTTGCTGCTGGG - Intergenic
1035591615 8:819482-819504 TTCTGAAGTCTCTACTATCTTGG + Intergenic
1036949476 8:13127660-13127682 TTCTGAAGTCTCTTCTTCCGTGG + Intronic
1037113851 8:15200006-15200028 GTCTATACTTTCTTGTTTCTTGG + Intronic
1038287093 8:26215052-26215074 TTCTCAAGTTTCTAGCTTCTTGG - Intergenic
1038458424 8:27694465-27694487 TTTTAAAATTTCTTGTTTCTTGG - Intergenic
1039297842 8:36176404-36176426 ATCTAAAGGCTCTTGTTTCCAGG + Intergenic
1039630189 8:39102645-39102667 TTCTATGGTCTATTGTTTCTTGG - Intronic
1040836677 8:51738846-51738868 TTCTCTAGTCTCCTATTTCTTGG - Intronic
1042456208 8:69006910-69006932 CTCTTAAGTTCCTTGTTTCTTGG - Intergenic
1044006177 8:86939814-86939836 TTTTAAAGTTTATTGTTTGTGGG + Intronic
1044152024 8:88791827-88791849 TTCAAAACTGTTTTGTTTCTTGG - Intergenic
1045876693 8:106990110-106990132 TTCTAAAGACAGTTGTTTGTAGG + Intergenic
1045906996 8:107358003-107358025 TTCTGAAATATCTTGTTTATGGG + Intronic
1045959961 8:107955229-107955251 TTCTAAAATCTGATGATTCTAGG - Intronic
1047811686 8:128417497-128417519 CTCTCAAGTCTCTTTTTACTTGG + Intergenic
1048497241 8:134945533-134945555 ATCTAAAGTCTCTGCTTTCAAGG - Intergenic
1048647191 8:136435228-136435250 TTCCAAAGTCTCTGGGTACTTGG - Intergenic
1049252114 8:141594809-141594831 TTCTGAAGTCACTAGATTCTGGG + Intergenic
1050257162 9:3806900-3806922 TTCTAGAGTTTCTAGCTTCTGGG + Intergenic
1052234508 9:26193758-26193780 TTCTTAAGAATATTGTTTCTTGG - Intergenic
1053294921 9:36905910-36905932 TTCCAAAGTCTCTTGACTCTAGG + Intronic
1053708445 9:40779899-40779921 TTCTAACATTTCTTGTTTTTGGG + Intergenic
1054418354 9:64900694-64900716 TTCTAACATTTCTTGTTTTTGGG + Intergenic
1054704673 9:68450221-68450243 TTCTAGAGATTCTTGTTTTTAGG - Intronic
1055003657 9:71482008-71482030 GTCTGAAGTCTCTTGTTACAGGG + Intergenic
1056169080 9:83965421-83965443 GTCTTAACTCTCCTGTTTCTTGG + Intergenic
1056848963 9:90065040-90065062 TTCAAAAATCTCATGTTCCTAGG + Intergenic
1057953395 9:99387732-99387754 TTCTCAAGAGTCTTGTTTTTTGG - Intergenic
1058243722 9:102599520-102599542 TTATATAGTCCCTTATTTCTTGG + Intergenic
1058930557 9:109714855-109714877 TTCTGAAGTATCTTGCTTCATGG - Intronic
1059596439 9:115725306-115725328 TTATGAAGTCCCTTATTTCTTGG - Intergenic
1203526251 Un_GL000213v1:91798-91820 TGCAAAAGTCTACTGTTTCTGGG + Intergenic
1203605345 Un_KI270748v1:53482-53504 TTGTAAAGTCTGTTGCTGCTGGG + Intergenic
1185800741 X:3008251-3008273 TTCTAAAGTCTCTGGTACCCGGG + Intronic
1186339146 X:8624326-8624348 TTCTAAAGGTTGTTGTTTCATGG + Intronic
1186875350 X:13811059-13811081 TTTTAAAATGTCTTGATTCTGGG + Intronic
1188382986 X:29520258-29520280 TTTTAAGAACTCTTGTTTCTGGG - Intronic
1188689657 X:33114004-33114026 TTCTAAAGTATTTTTTGTCTTGG - Intronic
1189779709 X:44502454-44502476 TTCTACAGTTTTTTGTTTTTTGG + Intergenic
1191079051 X:56489132-56489154 TTACTAAGTCTCTTGTTTCTTGG + Intergenic
1192294718 X:69835373-69835395 TTCCATAGTCCCATGTTTCTTGG + Intronic
1192636216 X:72821454-72821476 TTTTAAACTCTATTTTTTCTGGG + Intronic
1192645498 X:72899360-72899382 TTTTAAACTCTATTTTTTCTGGG - Intronic
1192852290 X:74970090-74970112 ATCTAAAGTCTATTGTTAATGGG - Intergenic
1193070603 X:77301887-77301909 TTTTAAATTCTCTTATTGCTGGG - Intergenic
1193315771 X:80063306-80063328 TTCTAGATTTTCTTGTTTATTGG + Intergenic
1194236204 X:91386766-91386788 TTCTAAATTTTCTAGTTTGTTGG - Intergenic
1194373401 X:93102309-93102331 TTTTAAAGTCTCTCTTTCCTGGG - Intergenic
1194921496 X:99771815-99771837 TTCTAAATTTTATTTTTTCTGGG + Intergenic
1195370056 X:104165003-104165025 TAATCAAGTCTCTTGTTTTTGGG + Intergenic
1195801758 X:108719785-108719807 TTGAAAAGCCTCATGTTTCTAGG + Intergenic
1196764695 X:119232411-119232433 TTCTTTTTTCTCTTGTTTCTTGG - Intergenic
1197006172 X:121501378-121501400 GTAAAAAGTCTTTTGTTTCTGGG + Intergenic
1197379817 X:125726011-125726033 TTCAAATTTCTGTTGTTTCTTGG + Intergenic
1198844323 X:140893940-140893962 ATCTAAAGACACTTGTTTCCAGG + Intergenic
1198992922 X:142537110-142537132 ATCTAAAGCCTCATCTTTCTTGG + Intergenic
1199018270 X:142845922-142845944 GTGTAAAGTCTCTATTTTCTAGG - Intergenic
1199063371 X:143386179-143386201 TTCTAAAGCCTCTTTTTTCTAGG - Intergenic
1199922258 X:152419496-152419518 TTCTAAATTTTCATGTTTTTTGG - Intronic
1200681432 Y:6216351-6216373 TTAAAAAGTCTCTATTTTCTGGG - Intergenic
1200778662 Y:7194637-7194659 TTCCATAGTCTCATATTTCTTGG + Intergenic
1200799822 Y:7376282-7376304 TTTTAAAGTCTCAAGTTACTAGG - Intergenic
1201956367 Y:19628229-19628251 TTGTAAAGACTATTGATTCTAGG - Intergenic
1202135856 Y:21660403-21660425 TACTACAATCTATTGTTTCTCGG - Intergenic
1202387532 Y:24339922-24339944 TTGTAAAGTCTGTTGCTGCTGGG + Intergenic
1202483254 Y:25330206-25330228 TTGTAAAGTCTGTTGCTGCTGGG - Intergenic