ID: 1119194746

View in Genome Browser
Species Human (GRCh38)
Location 14:72709098-72709120
Sequence TAGTATCAGAATAGGGTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 80}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119194746_1119194761 25 Left 1119194746 14:72709098-72709120 CCCTAGACCCTATTCTGATACTA 0: 1
1: 0
2: 1
3: 5
4: 80
Right 1119194761 14:72709146-72709168 CCCCGACTGGGTTTCTAGAAGGG 0: 1
1: 0
2: 0
3: 1
4: 48
1119194746_1119194757 12 Left 1119194746 14:72709098-72709120 CCCTAGACCCTATTCTGATACTA 0: 1
1: 0
2: 1
3: 5
4: 80
Right 1119194757 14:72709133-72709155 GTGGCAACACACTCCCCGACTGG 0: 1
1: 0
2: 0
3: 4
4: 45
1119194746_1119194764 28 Left 1119194746 14:72709098-72709120 CCCTAGACCCTATTCTGATACTA 0: 1
1: 0
2: 1
3: 5
4: 80
Right 1119194764 14:72709149-72709171 CGACTGGGTTTCTAGAAGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 50
1119194746_1119194759 24 Left 1119194746 14:72709098-72709120 CCCTAGACCCTATTCTGATACTA 0: 1
1: 0
2: 1
3: 5
4: 80
Right 1119194759 14:72709145-72709167 TCCCCGACTGGGTTTCTAGAAGG 0: 1
1: 0
2: 0
3: 2
4: 58
1119194746_1119194758 13 Left 1119194746 14:72709098-72709120 CCCTAGACCCTATTCTGATACTA 0: 1
1: 0
2: 1
3: 5
4: 80
Right 1119194758 14:72709134-72709156 TGGCAACACACTCCCCGACTGGG 0: 1
1: 0
2: 0
3: 4
4: 68
1119194746_1119194752 -7 Left 1119194746 14:72709098-72709120 CCCTAGACCCTATTCTGATACTA 0: 1
1: 0
2: 1
3: 5
4: 80
Right 1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119194746 Original CRISPR TAGTATCAGAATAGGGTCTA GGG (reversed) Intronic
905845316 1:41225752-41225774 TGGTTTAAGAATAGGATCTATGG + Intronic
911814328 1:102325787-102325809 CAGAGTCAGAATGGGGTCTATGG - Intergenic
912719933 1:112011627-112011649 CAGCATCAGGATAGGGTCAAGGG - Intergenic
922667995 1:227489094-227489116 TAGTTCCAGAATAGGGGATAGGG - Intergenic
1071320232 10:84448014-84448036 TAGTATGAGAAAAGGGTACACGG - Intronic
1074600214 10:114906535-114906557 TACTGTCAGAATTGGCTCTAGGG + Intergenic
1074833168 10:117263959-117263981 TAGAACCAGAATAGGGGCAATGG - Intronic
1082662976 11:55937049-55937071 TAGTATGTGAACAGGGTTTATGG - Intergenic
1087886386 11:103487881-103487903 AAGTAGAAGAATATGGTCTAGGG - Intergenic
1092622756 12:10290885-10290907 TAAAATCTGAATAAGGTCTATGG + Intergenic
1094403560 12:30089166-30089188 TAATATCTGAATAGGGTGTAAGG + Intergenic
1094600195 12:31901808-31901830 TAGCATCAGAAAATGGACTAAGG + Intergenic
1100434083 12:94555585-94555607 TACTATCACAATTGGGACTAGGG + Intergenic
1108476129 13:50819535-50819557 TAGGACCAGAATAGTGGCTATGG + Intronic
1110223587 13:73097147-73097169 TAGCATCAGATCAGGTTCTAAGG - Intergenic
1114487089 14:23069332-23069354 TTGGATCAGAATAGGGCCAAGGG - Intronic
1117322566 14:54637758-54637780 TAGTATCAAAATAGGGTCAGAGG - Intronic
1118860635 14:69660350-69660372 AAGTGTCAGAATAGGGTGGAAGG - Intronic
1118901074 14:69986410-69986432 TAGAATCTGAATAAGGTCCATGG + Intronic
1119194746 14:72709098-72709120 TAGTATCAGAATAGGGTCTAGGG - Intronic
1127359588 15:58233143-58233165 TAGAATCAGAATAGTGTTTGTGG + Intronic
1135008938 16:18855759-18855781 GAGTATAAGAATGGGGTCAAAGG - Intronic
1138005663 16:53334254-53334276 TAGTAACAGAAAATGGACTAAGG + Intergenic
1138361295 16:56430598-56430620 CAGTATTAGAAGAGGGTATAAGG - Exonic
1143998160 17:11027002-11027024 TAGTGTCAGAAAGGGCTCTAGGG - Intergenic
1144589375 17:16511269-16511291 TAGCATCAAAATAGGCTCTTGGG - Intergenic
1146252642 17:31362973-31362995 TAAAATCAGAATAGGTTTTATGG + Intronic
1147517243 17:41131637-41131659 TAGCATCAGAATAGGGTCTTGGG - Intergenic
1151696035 17:75718099-75718121 AAGTATAAGAATAGGGGCTCAGG + Intergenic
1153405321 18:4732421-4732443 TATTATCAAAATGGGGTCTTTGG + Intergenic
1154980344 18:21498425-21498447 CAGTTTCAGAATAGAGTCAAGGG + Intronic
1157952976 18:52061021-52061043 TAGCATCTGAAGAGGGTCTCAGG - Intergenic
1164339520 19:24375078-24375100 AAGTATCAGAAAAAGGCCTATGG + Intergenic
1168241024 19:55088945-55088967 AAGTATGTGAATAGGATCTAGGG - Intergenic
931571825 2:63676841-63676863 TAAAATCTGAATAGGCTCTATGG + Intronic
931592580 2:63901621-63901643 TTGTATGAGAATAGGGTTTGGGG - Intronic
932002425 2:67896959-67896981 TAGTCCCAGAATAGGGTGTCTGG - Intergenic
935124347 2:100210153-100210175 TAATATCTGATTAGGGTCTGGGG + Intergenic
939737283 2:145863556-145863578 AAGCATCAGAATAGAGTTTACGG - Intergenic
945933916 2:215883856-215883878 AAGAATCAGAATATGTTCTAAGG + Intergenic
1172291248 20:33778645-33778667 TAGTTTCAGAGTGCGGTCTATGG + Intronic
1177080190 21:16630156-16630178 TAGTGACAGAATAGGATCTCTGG - Intergenic
1182675322 22:32034732-32034754 TAGCCTCAGAATTGGGACTAAGG + Intergenic
1185177534 22:49337193-49337215 TCGTATCAGAAAATGGTCTTGGG + Intergenic
949865113 3:8541069-8541091 AAGAATCAGAACAGGGTCTCCGG + Intronic
951784007 3:26397937-26397959 CAGAATCAGAATGGGGTCTTGGG + Intergenic
952684039 3:36129682-36129704 TGGTATCAGAATAAGGTCCCGGG + Intergenic
956357139 3:68406341-68406363 TGGTTTAAGAATAGGGTCAAGGG + Intronic
959880294 3:111437561-111437583 TATTAACAGAATAGGGAATAGGG - Intronic
961389586 3:126544401-126544423 AAGTAACAGAAAAGGGACTAAGG + Intronic
963608078 3:147430594-147430616 TAGTCTCATGGTAGGGTCTAGGG - Intronic
964527297 3:157629306-157629328 TTGTATCAGAATTGTGTCTACGG + Intronic
967472574 3:189879508-189879530 TATTATCAGAATGGGGCCTGTGG - Intronic
968219279 3:196923053-196923075 TAGTATTAGAAAATGGTATAAGG - Intronic
970081990 4:12297962-12297984 CAGTATGAAAAAAGGGTCTAGGG - Intergenic
971964642 4:33537573-33537595 TAGTATCATAACTGGCTCTATGG + Intergenic
976327253 4:83785764-83785786 TTTTATCAAAACAGGGTCTATGG + Intergenic
977066482 4:92322642-92322664 TAGTATTAGAATACTGCCTATGG + Intronic
978493630 4:109335000-109335022 CTGTTTCAGAATAGGGTTTAGGG + Intergenic
982331660 4:154187663-154187685 TAGCATCACAATGGGGACTAAGG - Intergenic
988833286 5:35007656-35007678 TAGTATAAGCATGGGCTCTAAGG - Intronic
992101562 5:73412564-73412586 CAGTATCAGAATGCTGTCTATGG - Intergenic
992825002 5:80540093-80540115 TAGAATCTGAATGGGGTCTGTGG - Intronic
993481271 5:88427421-88427443 TACAATCAGAATAGGGTTTTGGG + Intergenic
994838771 5:104893700-104893722 TAGCTTTAGAATAGGTTCTAAGG - Intergenic
995020142 5:107357910-107357932 TAGAGTCAGAATAAGGACTAAGG + Intergenic
995535435 5:113130980-113131002 TACCATCACAATAGGGGCTAGGG + Intronic
995858849 5:116620900-116620922 TAGAGTAAGATTAGGGTCTAGGG + Intergenic
996913597 5:128683664-128683686 TATTAGCAGCATAGGTTCTATGG + Intronic
997514562 5:134477872-134477894 TACTCTCAGCATAGTGTCTATGG + Intergenic
1000993500 5:167935272-167935294 TAGGCTCACAATAGGGTCTTTGG - Intronic
1001274101 5:170337706-170337728 TAGAAGCAGAATGGGGTCAAAGG - Intergenic
1004275859 6:14234655-14234677 AAGAAGCAGAATAGGGGCTAAGG - Intergenic
1011115402 6:83885383-83885405 GAGTCTCAAAATATGGTCTAGGG - Intronic
1017481480 6:154860560-154860582 TACTATAATATTAGGGTCTATGG - Intronic
1017675389 6:156807910-156807932 AAGGATCAGGATAGGGTCTTTGG + Intronic
1023919400 7:44615499-44615521 TGGTGTCAGAATAGGGACCAGGG - Intronic
1028124713 7:87099405-87099427 TTGAAGCAGAATAGGGACTAGGG + Intergenic
1038283528 8:26186815-26186837 TTGGATCAGAATGGGGTGTAGGG - Intergenic
1043000530 8:74754524-74754546 CATTATGAGAATAGGTTCTATGG + Intronic
1048085777 8:131177605-131177627 TAGTACCATAATAGGATGTATGG - Intergenic
1050028553 9:1361282-1361304 TAGTATCAGAATGGGGATTTGGG + Intergenic
1050132887 9:2430927-2430949 GAGTATGAGAATATGGTATAAGG - Intergenic
1053334600 9:37254980-37255002 TAGTATCAGAAGAGCCTCTTGGG + Intronic
1057035663 9:91810180-91810202 CAGAATCAGAATGGGGTCTATGG + Intronic
1060367485 9:123033327-123033349 TAGTAACAGAACAGGGTGTCAGG - Intronic
1197593016 X:128432052-128432074 TAGTGTAAGAGTAGGGTCTAGGG + Intergenic