ID: 1119194747

View in Genome Browser
Species Human (GRCh38)
Location 14:72709099-72709121
Sequence GTAGTATCAGAATAGGGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119194747_1119194764 27 Left 1119194747 14:72709099-72709121 CCTAGACCCTATTCTGATACTAC 0: 1
1: 0
2: 2
3: 5
4: 137
Right 1119194764 14:72709149-72709171 CGACTGGGTTTCTAGAAGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 50
1119194747_1119194761 24 Left 1119194747 14:72709099-72709121 CCTAGACCCTATTCTGATACTAC 0: 1
1: 0
2: 2
3: 5
4: 137
Right 1119194761 14:72709146-72709168 CCCCGACTGGGTTTCTAGAAGGG 0: 1
1: 0
2: 0
3: 1
4: 48
1119194747_1119194752 -8 Left 1119194747 14:72709099-72709121 CCTAGACCCTATTCTGATACTAC 0: 1
1: 0
2: 2
3: 5
4: 137
Right 1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 56
1119194747_1119194758 12 Left 1119194747 14:72709099-72709121 CCTAGACCCTATTCTGATACTAC 0: 1
1: 0
2: 2
3: 5
4: 137
Right 1119194758 14:72709134-72709156 TGGCAACACACTCCCCGACTGGG 0: 1
1: 0
2: 0
3: 4
4: 68
1119194747_1119194757 11 Left 1119194747 14:72709099-72709121 CCTAGACCCTATTCTGATACTAC 0: 1
1: 0
2: 2
3: 5
4: 137
Right 1119194757 14:72709133-72709155 GTGGCAACACACTCCCCGACTGG 0: 1
1: 0
2: 0
3: 4
4: 45
1119194747_1119194759 23 Left 1119194747 14:72709099-72709121 CCTAGACCCTATTCTGATACTAC 0: 1
1: 0
2: 2
3: 5
4: 137
Right 1119194759 14:72709145-72709167 TCCCCGACTGGGTTTCTAGAAGG 0: 1
1: 0
2: 0
3: 2
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119194747 Original CRISPR GTAGTATCAGAATAGGGTCT AGG (reversed) Intronic
900015015 1:142159-142181 GTAGTGTCAGAATAAAGTCATGG + Intergenic
900045281 1:500768-500790 GTAGTGTCAGAATAAAGTCATGG + Intergenic
900067478 1:742498-742520 GTAGTGTCAGAATAAAGTCATGG + Intergenic
905570701 1:39002428-39002450 GTATTATAAGAAGAAGGTCTAGG + Intronic
909484390 1:76157055-76157077 GTGGTATTAGAATAGGGTCTGGG + Intronic
913189146 1:116398813-116398835 GCAGTATCTGAATAAGATCTTGG - Intronic
915055339 1:153123661-153123683 GGAGTATACGAATAGGGTGTGGG + Intergenic
918597612 1:186310065-186310087 GTAGTATCAGTTCAGGGTCTTGG - Intronic
921104235 1:211959794-211959816 GTAGTATAAGCATAGGGGCGTGG - Intronic
921629686 1:217418398-217418420 ATTGTTTCAGAATATGGTCTCGG - Intergenic
921975630 1:221199951-221199973 GTTGTATCACAAAAGGGTATTGG + Intergenic
922263165 1:223960382-223960404 GTAGTGTCAGAATAAAGTCATGG + Intergenic
923419568 1:233799054-233799076 GGAGTGTCCGAATAGGGTGTGGG + Intergenic
924345006 1:243065392-243065414 GTAGTGTCAGAATAAAGTCATGG + Intergenic
1066183635 10:32987472-32987494 GTAGTATAAGAATGTGGACTTGG - Intronic
1066731329 10:38439685-38439707 GTAGTGTCAGAATAAAGTCATGG - Intergenic
1072266181 10:93730167-93730189 GTAGAATCAGGATAGGTTTTTGG - Intergenic
1076971608 11:137259-137281 GTAGTGTCAGAATAAAGTCATGG + Intergenic
1080909219 11:36578776-36578798 CTAGTATAAAACTAGGGTCTAGG - Exonic
1081009898 11:37797966-37797988 GGAGTATATGAATAGGGTGTGGG + Intergenic
1087791294 11:102408838-102408860 GTATTAACAGAAAAAGGTCTGGG - Intronic
1089367507 11:117930077-117930099 TGAGGATCAGAATAGGGTATAGG - Intergenic
1090172999 11:124621430-124621452 GTGGTATCATAATAGGCACTAGG + Intergenic
1092825301 12:12393446-12393468 GTTGTATAAGGATAGGGTGTGGG - Intronic
1095326840 12:40904723-40904745 CTAAAATAAGAATAGGGTCTGGG - Intronic
1096605370 12:52761105-52761127 GGAGTATACGAATAGGGTGTGGG + Intergenic
1098333746 12:69380901-69380923 GGAGTGTATGAATAGGGTCTGGG + Intronic
1099117783 12:78649078-78649100 GGAGTATATGAATAGGGTGTGGG - Intergenic
1106424081 13:29609217-29609239 GTAGTAAATGAATAGGGTGTTGG - Intergenic
1106975149 13:35202599-35202621 GTGGTATAAGGATAGGGTATTGG - Intronic
1108044347 13:46369085-46369107 GTAGAAAGAGAATAGGGTCCTGG + Intronic
1113332881 13:109347680-109347702 GTGCTATTAAAATAGGGTCTTGG - Intergenic
1114687155 14:24544017-24544039 GGAGTATATGAATAGGGTGTGGG - Intergenic
1119194747 14:72709099-72709121 GTAGTATCAGAATAGGGTCTAGG - Intronic
1121285149 14:92729364-92729386 GTGGAATCAGAGTAGAGTCTGGG - Intronic
1125831504 15:42719986-42720008 GTAGATTCAGAACAGAGTCTTGG - Exonic
1127002377 15:54524578-54524600 TTAGTATCAGAAAATAGTCTTGG + Intronic
1131128177 15:89874104-89874126 GTAGCTTAAGAATAGGGTTTTGG + Intronic
1131471511 15:92701599-92701621 CTAGAATCAGAATAGGTTCAGGG + Intronic
1133582318 16:7157576-7157598 AAAATATCCGAATAGGGTCTGGG + Intronic
1135333175 16:21578311-21578333 CTAATATTAGAAAAGGGTCTTGG + Intergenic
1135377950 16:21966016-21966038 TAAGTATCATAATAGGGGCTGGG + Intronic
1136395850 16:29992005-29992027 GAAGGATCAGGATGGGGTCTTGG + Intronic
1138638828 16:58366060-58366082 GTAATATCTGAAAAGGGTGTAGG + Intronic
1142360711 16:89625275-89625297 GGAGCAGGAGAATAGGGTCTGGG - Intronic
1142448640 16:90160263-90160285 GTAGTGTCAGAATAAAGTCATGG - Intergenic
1142458845 17:75026-75048 GTAGTGTCAGAATAAAGTCATGG + Intergenic
1143157538 17:4847879-4847901 GAAGTTTCAGAAAAAGGTCTGGG + Intronic
1144589376 17:16511270-16511292 CTAGCATCAAAATAGGCTCTTGG - Intergenic
1147517244 17:41131638-41131660 ATAGCATCAGAATAGGGTCTTGG - Intergenic
1147801460 17:43092678-43092700 GTAGTATCAAAGGAGGCTCTAGG - Exonic
1150129373 17:62658800-62658822 GTAGTAACAGAAAATGGCCTTGG - Intronic
1154980343 18:21498424-21498446 GCAGTTTCAGAATAGAGTCAAGG + Intronic
1160648564 19:207539-207561 GTAGTGTCAGAATAAAGTCATGG + Intergenic
1164329778 19:24243475-24243497 GGAGTATAGGAATAGGGTGTGGG - Intergenic
1164365682 19:27579523-27579545 GGAGTATAGGAATAGGGTGTGGG - Intergenic
1166623324 19:44325232-44325254 ATAGTGTAAGACTAGGGTCTGGG - Intergenic
1166632635 19:44420665-44420687 GTAGTGTACGAATAGGGTGTGGG - Intronic
1167599854 19:50448328-50448350 GTGGTATAAGAATGGGGTCGAGG + Exonic
1168241025 19:55088946-55088968 GAAGTATGTGAATAGGATCTAGG - Intergenic
928154454 2:28863546-28863568 ATAGTATCAGAAGAGTGTCATGG - Intronic
928276785 2:29908471-29908493 GTAATTTGAGAATAGGGTCTTGG - Intronic
930643520 2:53878924-53878946 GCAGTATATGAATAGGGTGTGGG - Intronic
931592581 2:63901622-63901644 TTTGTATGAGAATAGGGTTTGGG - Intronic
933507759 2:83200525-83200547 GTAGTAGCAGAAGAAGATCTAGG - Intergenic
933920329 2:87039418-87039440 GTGGGATCAGAATAAGGTCCTGG + Intergenic
933931295 2:87154368-87154390 GTGGGATCAGAATAAGGTCCTGG - Intergenic
934002668 2:87730481-87730503 GTGGGATCAGAATAAGGTCCTGG - Intergenic
935124346 2:100210152-100210174 ATAATATCTGATTAGGGTCTGGG + Intergenic
936361826 2:111811063-111811085 GTGGGATCAGAATAAGGTCCTGG + Intronic
937085416 2:119168752-119168774 GTAGAACCACAATAGGGCCTGGG - Intergenic
942152571 2:173091746-173091768 GTAAAATCAGAAAAGGGTCTTGG + Intronic
942780994 2:179642987-179643009 GTTCTATCAGAAAAGGATCTAGG - Intronic
943261916 2:185676482-185676504 ATAGTATAATAATAGGGCCTTGG - Intergenic
944401379 2:199329944-199329966 GCAGTATAAGAACAGGGTTTAGG + Intronic
945726438 2:213476341-213476363 GTGGGATCAGAATAAGGTCCTGG - Intronic
1170136954 20:13085185-13085207 GTAGTATCTGAAATGGGTCTAGG - Intronic
1172678761 20:36695852-36695874 GGAGTATACGAATAGGGTGTGGG - Intronic
1174550825 20:51360285-51360307 GTAGTAGCAGCCTGGGGTCTTGG + Intergenic
1174615701 20:51833812-51833834 GTCCTATTGGAATAGGGTCTTGG + Intergenic
1175255944 20:57647275-57647297 GTGCTATCAGAACTGGGTCTGGG + Intergenic
1180711844 22:17844487-17844509 GTAGTCACAGGATAAGGTCTTGG + Intronic
1183261447 22:36798314-36798336 GTCTTTTCAAAATAGGGTCTTGG + Intergenic
1185177533 22:49337192-49337214 TTCGTATCAGAAAATGGTCTTGG + Intergenic
951784006 3:26397936-26397958 CCAGAATCAGAATGGGGTCTTGG + Intergenic
952552618 3:34496308-34496330 GCAGCAGCAGAGTAGGGTCTGGG + Intergenic
952684038 3:36129681-36129703 ATGGTATCAGAATAAGGTCCCGG + Intergenic
959936775 3:112037602-112037624 GTAGTGTATGAATAGGGTGTGGG - Intronic
960156049 3:114298021-114298043 ATAGTATTAGGATAGGGACTTGG - Intronic
963051745 3:141149063-141149085 TTAGAGTCAGGATAGGGTCTGGG + Intergenic
966051271 3:175619866-175619888 GTGGGATCAGAATAAGGTCCTGG - Intronic
968369284 3:198212576-198212598 GTAGTGTCAGAATAAAGTCATGG - Intergenic
975997376 4:80331883-80331905 GTAGAGTCAGCAAAGGGTCTAGG + Intronic
977941307 4:102862653-102862675 GTAGTTTCACAATGGGTTCTTGG + Intronic
979257711 4:118622303-118622325 GTAGTGTCAGAATAAAGTCATGG - Intergenic
979330636 4:119418259-119418281 GTAGTGTCAGAATAAAGTCATGG + Intergenic
979428236 4:120594322-120594344 GAAGTATAAGAATACAGTCTGGG + Intergenic
981429509 4:144644195-144644217 GTAGTTTGAGAATAAGGACTCGG - Intergenic
981592807 4:146383276-146383298 GAAGCAGGAGAATAGGGTCTAGG + Intronic
986362240 5:6990324-6990346 GTATTAACAGTATAGGGTTTTGG + Intergenic
988085401 5:26469260-26469282 TTAGTAGTAGAATAGAGTCTCGG - Intergenic
990109008 5:52300138-52300160 GAAGTATAAGAAAAGGATCTTGG + Intergenic
993481270 5:88427420-88427442 ATACAATCAGAATAGGGTTTTGG + Intergenic
995120032 5:108526353-108526375 GGAGTGTATGAATAGGGTCTGGG - Intergenic
996550235 5:124722764-124722786 GGAGAATCAGAATAGGGGTTAGG + Intronic
1000631443 5:163595427-163595449 ATAGTATCAGAACAGGGTGATGG - Intergenic
1000836250 5:166157979-166158001 AAAGTATCAGAGTGGGGTCTGGG + Intergenic
1002728563 5:181318161-181318183 GTAGTGTCAGAATAAAGTCATGG - Intergenic
1012083495 6:94792000-94792022 GTAGTTTTGGAGTAGGGTCTGGG - Intergenic
1013833219 6:114299450-114299472 GGAGTGTAAGAATAGGGTGTGGG - Intronic
1016120945 6:140340502-140340524 GTGGGATCAGAATAAGGTCCTGG - Intergenic
1020502789 7:8944105-8944127 GTAGTACAAGAAAAGGGGCTGGG - Intergenic
1021020063 7:15586892-15586914 GGAGTATGCGAATAGGGTGTGGG + Intergenic
1021372233 7:19863104-19863126 GAAGTCTCTGAATAGGTTCTGGG - Intergenic
1023399695 7:39783566-39783588 GTAGTGTCAGAATAAAGTCATGG - Intergenic
1025760096 7:64381690-64381712 GGAGTATACGAATAGGGTGTGGG - Intergenic
1028400890 7:90424269-90424291 GGAGTGTAAGAATAGGGTGTGGG - Intronic
1031513927 7:122679595-122679617 GGAGTATACGAATAGGGTGTGGG - Intronic
1033032607 7:137842087-137842109 GTAGGATCAGATTAAGATCTTGG - Intronic
1034609435 7:152352439-152352461 GGAGTATATGAATAGGGTGTGGG - Intronic
1038516602 8:28192924-28192946 GGAGGAGGAGAATAGGGTCTTGG - Intergenic
1039983092 8:42425710-42425732 GTAGTATTAGGATAGCTTCTTGG - Intronic
1040634347 8:49254838-49254860 GGAGTGTAAGAATAGGGTTTGGG - Intergenic
1040679043 8:49786980-49787002 GGAGTGTAAGAATAGGGTGTGGG + Intergenic
1040757549 8:50797685-50797707 GTAGTATCTGACTCGTGTCTAGG - Intergenic
1040840115 8:51776295-51776317 GGAGTATACGAATAGGGTGTGGG - Intronic
1041649720 8:60289918-60289940 GTAGTATACGAATAGGGTGTGGG + Intergenic
1043327491 8:79070531-79070553 GGAGTATACGAATAGGGTGTGGG - Intergenic
1043434251 8:80223051-80223073 GTAGTATAAGAATTGTGGCTGGG + Intronic
1044142258 8:88670663-88670685 GGAGTATATGAATAGGGTGTGGG + Intergenic
1044499624 8:92938601-92938623 GTAGTCTCAGAATAGTGGCAGGG - Intronic
1046100078 8:109603845-109603867 GTAGTCAGAGAATAGGATCTGGG + Intronic
1050028552 9:1361281-1361303 TTAGTATCAGAATGGGGATTTGG + Intergenic
1052423524 9:28274280-28274302 TTACTATCAGAAATGGGTCTTGG - Intronic
1053334599 9:37254979-37255001 CTAGTATCAGAAGAGCCTCTTGG + Intronic
1053820834 9:41965716-41965738 GAAGTAACAGAAGAGGGGCTGGG + Intronic
1059405067 9:114094308-114094330 GTAGGATGGGGATAGGGTCTGGG - Intronic
1059618540 9:115977553-115977575 ATACTATCACATTAGGGTCTGGG - Intergenic
1062753625 9:138275260-138275282 GTAGTGTCAGAATAAAGTCATGG - Intergenic
1203576138 Un_KI270745v1:10039-10061 GTAGTGTCAGAATAAAGTCATGG - Intergenic
1185978418 X:4747889-4747911 GTAGTATCAGATTGTGGTTTTGG + Intergenic
1188232451 X:27681835-27681857 GTAGCATAAAAATAGGCTCTGGG - Intronic
1188445755 X:30251313-30251335 GTGGTTTCAGCATAGGCTCTCGG - Exonic
1190166638 X:48078588-48078610 GGAGTATACGAATAGGGTGTGGG - Intergenic
1197593015 X:128432051-128432073 TTAGTGTAAGAGTAGGGTCTAGG + Intergenic