ID: 1119194752

View in Genome Browser
Species Human (GRCh38)
Location 14:72709114-72709136
Sequence GATACTACCCCCACTGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 56}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119194747_1119194752 -8 Left 1119194747 14:72709099-72709121 CCTAGACCCTATTCTGATACTAC 0: 1
1: 0
2: 2
3: 5
4: 137
Right 1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 56
1119194746_1119194752 -7 Left 1119194746 14:72709098-72709120 CCCTAGACCCTATTCTGATACTA 0: 1
1: 0
2: 1
3: 5
4: 80
Right 1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 56
1119194743_1119194752 26 Left 1119194743 14:72709065-72709087 CCAAGAAACAAGAGACTTTAGAA 0: 1
1: 0
2: 3
3: 33
4: 381
Right 1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119194752 Original CRISPR GATACTACCCCCACTGGGTG TGG Intronic