ID: 1119194752

View in Genome Browser
Species Human (GRCh38)
Location 14:72709114-72709136
Sequence GATACTACCCCCACTGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 56}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119194743_1119194752 26 Left 1119194743 14:72709065-72709087 CCAAGAAACAAGAGACTTTAGAA 0: 1
1: 0
2: 3
3: 33
4: 381
Right 1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 56
1119194747_1119194752 -8 Left 1119194747 14:72709099-72709121 CCTAGACCCTATTCTGATACTAC 0: 1
1: 0
2: 2
3: 5
4: 137
Right 1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 56
1119194746_1119194752 -7 Left 1119194746 14:72709098-72709120 CCCTAGACCCTATTCTGATACTA 0: 1
1: 0
2: 1
3: 5
4: 80
Right 1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119194752 Original CRISPR GATACTACCCCCACTGGGTG TGG Intronic
900604526 1:3517924-3517946 CATCAAACCCCCACTGGGTGGGG - Intronic
903826314 1:26148088-26148110 GAGACTACCACAGCTGGGTGCGG + Intergenic
903892801 1:26581201-26581223 GCAACTACCTCCACTGGGGGTGG - Intergenic
908822461 1:68102518-68102540 GATACAACCCCAGCTGGGTCTGG - Intronic
914919484 1:151837975-151837997 GCTGCTGCCCCCGCTGGGTGGGG - Exonic
922882494 1:228991197-228991219 TATACAACACCCAGTGGGTGTGG - Intergenic
1067496407 10:46764282-46764304 TATACTACCACAACTGGCTGTGG + Intergenic
1067598247 10:47576115-47576137 TATACTACCACAACTGGCTGTGG - Intergenic
1071612858 10:87047366-87047388 TATACTACCACAACTGGCTGTGG + Intergenic
1087151341 11:94862187-94862209 CAGACTACCCCTTCTGGGTGGGG + Intronic
1088715964 11:112549985-112550007 GATTCTTCCTCCTCTGGGTGTGG + Intergenic
1104781694 12:131425573-131425595 GTCTCTACCCTCACTGGGTGTGG - Intergenic
1110339267 13:74370109-74370131 GTGCCTACCCTCACTGGGTGAGG - Intergenic
1110756879 13:79185030-79185052 GAAACTACCTCTGCTGGGTGTGG - Intergenic
1111658559 13:91181007-91181029 GATACTACCACCTATGGGTTTGG + Intergenic
1115971429 14:38948993-38949015 GATACTATGCCCACTGCCTGGGG + Intergenic
1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG + Intronic
1120940612 14:89945117-89945139 ACTACTACCCACACTGAGTGGGG - Intronic
1122398046 14:101449204-101449226 GTTATTCCCCCCTCTGGGTGTGG - Intergenic
1122688441 14:103520846-103520868 GCTCCTACCCCCACTGTGGGGGG - Intronic
1135920992 16:26648938-26648960 GATAGCACCTCCTCTGGGTGGGG - Intergenic
1142376661 16:89710191-89710213 GATCCAACCCCCTGTGGGTGGGG + Intronic
1146696054 17:34909740-34909762 AACTCTGCCCCCACTGGGTGTGG - Intergenic
1148397018 17:47317073-47317095 AATACAATCCCCACTGGGTGTGG - Intronic
1153293940 18:3527881-3527903 TAAAATACCCCCACTGGGCGTGG - Intronic
1158674787 18:59508305-59508327 GAAACTTGCCTCACTGGGTGTGG + Intronic
1161365417 19:3876471-3876493 CATACCACACCCAGTGGGTGTGG - Intergenic
927798967 2:26079275-26079297 GCTCCTACCCCCACTCCGTGAGG - Intronic
938501230 2:131832129-131832151 CATGCAGCCCCCACTGGGTGTGG - Intergenic
943298249 2:186164614-186164636 GATACTACCCCTGCTGGGAAGGG - Intergenic
947625861 2:231618272-231618294 GAGACGCCCCCCATTGGGTGTGG + Intergenic
947959161 2:234220422-234220444 CATACCATCCCCTCTGGGTGAGG - Intergenic
1181005608 22:20012087-20012109 CACACTTCCCCAACTGGGTGGGG - Intronic
1183773854 22:39949687-39949709 GATACTACCTCCACTTGCTGAGG - Intronic
953868922 3:46609453-46609475 GTTCCTGCCCCCACTGGGGGAGG + Intronic
959810314 3:110611388-110611410 GATACTACCTACACTTGCTGAGG + Intergenic
961919628 3:130412390-130412412 GCTGCTAACCACACTGGGTGAGG + Intronic
987300056 5:16589249-16589271 GATTATAATCCCACTGGGTGCGG + Intronic
996165292 5:120215132-120215154 GATATTGCCACTACTGGGTGTGG + Intergenic
999418427 5:151419888-151419910 GATACCTCCCCCAGTGGGCGTGG + Intergenic
1006419184 6:33922940-33922962 GACACAACCCCCACTGGGCCCGG + Intergenic
1006788940 6:36686282-36686304 GATGATGCCCCCACTCGGTGAGG - Exonic
1007429543 6:41768772-41768794 GATCCTACCTCCTCTGAGTGGGG - Intergenic
1007789951 6:44303147-44303169 GATACCACCCGCACAGGGTCTGG + Exonic
1019645278 7:2125576-2125598 GCTACAACCCCCACCAGGTGAGG + Intronic
1020111641 7:5451203-5451225 GACTCCACCCCCACTGTGTGGGG + Intronic
1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG + Intronic
1030711649 7:112757317-112757339 GTGAGTACCCCCACTGGGAGGGG + Intergenic
1035061808 7:156074955-156074977 GAAACTCCCCCCACTGATTGAGG - Intergenic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1040332987 8:46401728-46401750 GGTGCTCCCCCCTCTGGGTGGGG - Intergenic
1045826506 8:106404152-106404174 GATGCTGCTACCACTGGGTGTGG + Intronic
1055095449 9:72408689-72408711 GAAATTACCCCGGCTGGGTGTGG - Intergenic
1061971890 9:134049576-134049598 GAAACAGCCCCCACTGGGGGAGG + Intronic
1062498427 9:136842389-136842411 GGTGCAGCCCCCACTGGGTGCGG + Intronic
1189440478 X:41031400-41031422 GAAATTACCCACACTGCGTGCGG - Intergenic
1190287878 X:48972462-48972484 GAGACTACCCCCTCGGAGTGGGG - Intergenic
1193875761 X:86861084-86861106 GATATTACTGCCACTGAGTGGGG - Intergenic
1199847915 X:151704443-151704465 GATGCTCCACCCACTGGGAGAGG - Exonic