ID: 1119196143

View in Genome Browser
Species Human (GRCh38)
Location 14:72718001-72718023
Sequence GATCCTACCTCCAAGGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119196138_1119196143 0 Left 1119196138 14:72717978-72718000 CCTGATTCAAGCTGGGCCAATCA 0: 1
1: 6
2: 12
3: 65
4: 198
Right 1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG 0: 1
1: 0
2: 3
3: 14
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119196143 Original CRISPR GATCCTACCTCCAAGGGGTT TGG Intronic
903577286 1:24346743-24346765 AAACCTAGCTCCAAGGGGTAAGG - Intronic
905254446 1:36671174-36671196 GATCCTGTCTCCAAGGTTTTTGG + Intergenic
907386824 1:54131194-54131216 ATTCCTACCTGCAAGGCGTTTGG - Intergenic
908319052 1:62963370-62963392 GATCCTGCCTCCTAGTGGTCAGG - Intergenic
920416400 1:205801541-205801563 GTTTCTATCTCCAAGGGCTTTGG + Intronic
922171994 1:223163291-223163313 GATCCTGCATGCAAGGGATTTGG + Intergenic
923149065 1:231217791-231217813 GCTGCTCCCTCAAAGGGGTTAGG - Intronic
1063607378 10:7534572-7534594 GGCCCTCCCTCCAAGGCGTTTGG - Intergenic
1064164551 10:12974952-12974974 ATTCCTACCTCGCAGGGGTTAGG - Intronic
1064541609 10:16411562-16411584 GTGCCTACCTGCAAGGGATTTGG - Intergenic
1068726830 10:60312463-60312485 GTTCCTACCTTAAAGGGGTTTGG + Intronic
1069931052 10:71881871-71881893 GATCCTGCCCCCAAGTGGCTGGG + Intergenic
1075655179 10:124156508-124156530 GATCCAAGCTGCAGGGGGTTCGG + Intergenic
1077032598 11:476233-476255 GGTCTTGCCTCCAAGGGGTTTGG + Intronic
1077414530 11:2418519-2418541 GCCCCTACCTCCAAGGTGTTGGG + Exonic
1078058046 11:8023305-8023327 GCTCCTGCCTCCAAGAGGTAAGG - Intronic
1078451286 11:11442827-11442849 GTCCCTCCCTCCCAGGGGTTAGG - Intronic
1081702539 11:45161269-45161291 GATCCCACCTCCATGGGCTGGGG + Intronic
1083334391 11:61914268-61914290 ACTCCAACCTCCCAGGGGTTGGG - Intronic
1084326962 11:68406086-68406108 GCTCCTACCTCCAAGGTGAATGG + Intronic
1094325352 12:29232023-29232045 GAACATATCTCAAAGGGGTTGGG + Intronic
1097090919 12:56504078-56504100 GCCTCGACCTCCAAGGGGTTAGG + Intergenic
1101319838 12:103663857-103663879 GATCCTAAATCCCAGGGGTTGGG - Intronic
1102232508 12:111273312-111273334 GAACCTACCTCCCAGGGTATGGG - Intronic
1111350409 13:87021277-87021299 GATCCTACATGCTATGGGTTTGG + Intergenic
1111658559 13:91181007-91181029 GATACTACCACCTATGGGTTTGG + Intergenic
1116277861 14:42859964-42859986 GTTCCTACCTCCATGGTGTATGG + Intergenic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1124911290 15:33923700-33923722 GTTCCTAACCCCTAGGGGTTGGG - Intronic
1126072301 15:44875691-44875713 GCTCCTAACTCCAAAGAGTTGGG + Intergenic
1127196973 15:56597739-56597761 TATCCTAGCTCAAAGGGGGTTGG + Intergenic
1131600002 15:93837593-93837615 CATCCAAACTCCAAGGGATTAGG + Intergenic
1133489321 16:6251570-6251592 CCCCCTACCTCCAAGGGGTAGGG - Intronic
1134409645 16:13993351-13993373 GTCCCTACCTCATAGGGGTTTGG + Intergenic
1146401210 17:32501426-32501448 ATTCCTTCCTCCAAGGTGTTGGG - Intronic
1147705215 17:42421483-42421505 GATCCCGCCTCCCTGGGGTTAGG + Intronic
1156460604 18:37319460-37319482 GATCCTACCCACTAGGGCTTGGG - Intronic
1157878323 18:51294369-51294391 CATACCACCTCCAAGGGGTTTGG + Intergenic
1160605473 18:80046557-80046579 GAGCCCAGCTCCAGGGGGTTGGG - Intronic
1162913715 19:13863603-13863625 AATCATACCTCCATGGGGTTGGG - Intronic
925907502 2:8548026-8548048 CATCCTCCCTCCCAGGGTTTAGG + Intergenic
927722926 2:25398371-25398393 GATCCTAACGCCAAGGGCTGGGG - Intronic
931559291 2:63540857-63540879 GATCCTCCCTCCAAGTAGCTGGG + Intronic
940067605 2:149647454-149647476 GAACCTACCTGCAAGGGTTCTGG + Intergenic
943572035 2:189584907-189584929 GATCATACCACTAAGAGGTTGGG - Intergenic
945512119 2:210715375-210715397 GCTTCTTCCTCCAAGGGGTTGGG + Intergenic
945615873 2:212065807-212065829 AATCCTAGCTCTATGGGGTTGGG - Intronic
947166917 2:227271920-227271942 GATCTTACCTCAAAGAGGTTTGG + Intronic
1172069262 20:32244539-32244561 CCTCCCACCTCCAAGGGGTTAGG + Intergenic
1173722100 20:45268548-45268570 GACCCTACCTTCAGGGGGTCTGG - Intergenic
1174465207 20:50712022-50712044 GATCCTCCTTCCAAAGTGTTGGG + Intergenic
1179275177 21:39885555-39885577 TGTCCTACCTCCATGTGGTTTGG + Intronic
1182029855 22:27149912-27149934 GATTCTACATCCAAGGGCTCTGG + Intergenic
1185250655 22:49799925-49799947 GACCCTACCTCAAAGGGGAGAGG + Intronic
1185376316 22:50484110-50484132 GTTCCTACCTCCAAGGGGGAGGG + Exonic
949555818 3:5151722-5151744 GATCCTATCTCCAAGGGGGGGGG - Intronic
953108066 3:39905082-39905104 GCTCCTACCTCCAGGTGCTTTGG + Intronic
953796431 3:45989561-45989583 AATCATAGGTCCAAGGGGTTGGG - Intronic
954096876 3:48335522-48335544 GCTCCTAACCCCAAAGGGTTGGG + Intergenic
955287036 3:57651956-57651978 GATCCTCCCACCTAGGTGTTGGG - Intronic
961600769 3:128059964-128059986 GATACTACCTCCAAGGGGCTCGG - Intronic
962750678 3:138432933-138432955 GATCCTGTCTCCAAGGGGTTTGG + Intergenic
967979760 3:195058776-195058798 GCTCCTGCCTCCCAGGGGTGCGG + Intergenic
970868523 4:20785813-20785835 GATCCTTCCACCAAGGTCTTAGG - Intronic
977316135 4:95450218-95450240 GATCCCATCTTCAAGGGGGTTGG - Intronic
980286561 4:130785551-130785573 TATCCTCCCTCCCAGGGATTAGG + Intergenic
988205975 5:28135064-28135086 TATCCTACTTCTAAGGGGGTAGG - Intergenic
995111048 5:108428872-108428894 CATCCCTCCTCCAAGGAGTTCGG + Intergenic
998507425 5:142683246-142683268 TATGCTAGCTCCCAGGGGTTAGG - Intronic
999696039 5:154189929-154189951 CATTCTAACTCCAAGGGGGTTGG + Intronic
1000833706 5:166131806-166131828 GAGCCTCCCTCCAAGGGGATTGG - Intergenic
1002060837 5:176625034-176625056 GACCCTGCCTCCATGGGGATGGG - Intronic
1005159534 6:22843136-22843158 GATCCCACCTCCAAGTACTTTGG + Intergenic
1006913440 6:37579040-37579062 CATCCTACCTCCCTGGGGTGAGG + Intergenic
1010931928 6:81814252-81814274 GATCCTACCCTCAAGGGGTCTGG - Intergenic
1012805330 6:103886067-103886089 GATTCTACCTCCAGTGGATTTGG - Intergenic
1015419768 6:132993634-132993656 GTACTTACCTTCAAGGGGTTCGG - Intergenic
1018727050 6:166620997-166621019 AATCCTACCTCCACGGGGCAAGG + Intronic
1023319719 7:38981116-38981138 CATCCTACCTTCAAGGGGTTAGG - Intronic
1024447726 7:49501064-49501086 AATTCTACCTGCAAGGGATTTGG + Intergenic
1027842763 7:83335024-83335046 GTTCCTACTTCAAATGGGTTTGG - Intergenic
1030068257 7:105677029-105677051 GATCCTCCCTCCACGGGGCCTGG - Intronic
1037211994 8:16400056-16400078 GATCCTACCTCCAACAGTGTGGG - Intronic
1039469611 8:37805079-37805101 GATGCTATCTCCTAGGTGTTGGG + Intronic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1044598291 8:93979609-93979631 CATCTAAGCTCCAAGGGGTTTGG + Intergenic
1054782434 9:69177323-69177345 GATCCTAAATCCAAGGGTTAGGG + Intronic
1057790121 9:98119143-98119165 GCTCCGACCTCCCAGGGGTCCGG + Exonic
1058598157 9:106638376-106638398 GATCCTACCATCTAGGGGTTAGG + Intergenic
1059763086 9:117357853-117357875 GTTCATCCCTCCAAAGGGTTAGG - Intronic
1060095525 9:120785777-120785799 GATCCACCCTCCAAAGTGTTGGG - Intronic
1060386345 9:123232577-123232599 GATTCTACCTCCCAGGAATTTGG + Intronic
1060563396 9:124567259-124567281 GATCAGAACTCCAAGGGGTGGGG + Intronic
1061252765 9:129436386-129436408 GATCCTCGCTCTGAGGGGTTTGG - Intergenic
1188904345 X:35774300-35774322 GATCCTATATCCAAAGGATTTGG + Intergenic
1195498236 X:105563187-105563209 GATCCTACCTCACAGGATTTTGG - Intronic
1198385895 X:136129160-136129182 GAAACCACCTCCAAGGGGATGGG + Intergenic