ID: 1119197284

View in Genome Browser
Species Human (GRCh38)
Location 14:72726456-72726478
Sequence GCTGATGGGCAGAGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1088
Summary {0: 1, 1: 0, 2: 10, 3: 118, 4: 959}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119197284_1119197295 29 Left 1119197284 14:72726456-72726478 CCATCCTCCCTCTGCCCATCAGC 0: 1
1: 0
2: 10
3: 118
4: 959
Right 1119197295 14:72726508-72726530 GCCCTGGGCCTCAGATGTGATGG 0: 1
1: 0
2: 2
3: 41
4: 313
1119197284_1119197293 14 Left 1119197284 14:72726456-72726478 CCATCCTCCCTCTGCCCATCAGC 0: 1
1: 0
2: 10
3: 118
4: 959
Right 1119197293 14:72726493-72726515 AAAGCCTCTGTCTATGCCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 219
1119197284_1119197292 13 Left 1119197284 14:72726456-72726478 CCATCCTCCCTCTGCCCATCAGC 0: 1
1: 0
2: 10
3: 118
4: 959
Right 1119197292 14:72726492-72726514 TAAAGCCTCTGTCTATGCCCTGG 0: 1
1: 0
2: 0
3: 7
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119197284 Original CRISPR GCTGATGGGCAGAGGGAGGA TGG (reversed) Intronic
900092491 1:926476-926498 GCTGAAGGCCAGAGGGTGCAAGG + Intronic
900154400 1:1198216-1198238 GCTGAGGGGCACAGGGTGGTGGG - Intergenic
900367081 1:2315702-2315724 GCTGATGGCCTGAGGGAGATAGG - Intergenic
900399922 1:2468747-2468769 GCTGCTGGGCAGACTGGGGACGG + Intronic
900507760 1:3038254-3038276 ACTGATGTGCAGACGGAGGTAGG - Intergenic
900672094 1:3860780-3860802 GCTGGTGGGCAGGGGTAGGCAGG - Intronic
900738643 1:4316832-4316854 GCCAGTGGGCAGTGGGAGGAAGG + Intergenic
900900175 1:5510705-5510727 GCAGATGAGCAGACTGAGGAAGG + Intergenic
900939186 1:5786906-5786928 GCTGGTGTGCAGAGGAAGGCAGG - Intergenic
900942713 1:5811401-5811423 GCTGATGGGCGGGGGGTGGGGGG - Intergenic
901053341 1:6436987-6437009 GCTGATGGGCTGAGGGGGAGGGG - Intronic
901343480 1:8516939-8516961 GATGGTGGGGAGAGGGAGGGAGG + Intronic
901491228 1:9597365-9597387 GTCCCTGGGCAGAGGGAGGAAGG + Intronic
901773156 1:11541266-11541288 GCTGCAGGGCTGAGGGTGGAGGG + Intergenic
901911475 1:12462242-12462264 GGTGATGGGGAGAAGGAGGGTGG + Intronic
902210234 1:14899702-14899724 AGTGGTGGACAGAGGGAGGAGGG - Intronic
902245445 1:15117721-15117743 TCTGATGGGAAGAGGGAGGTGGG - Exonic
902383516 1:16063802-16063824 GCTGAGGGGCACAGGCAGGAGGG - Intronic
902599627 1:17532154-17532176 GCTGCTGAGGAGAGGGAGCAGGG - Intergenic
902684094 1:18064605-18064627 GATGCTGGGCAGGGGGAGGAGGG - Intergenic
902722839 1:18315577-18315599 GTGGATGGGTAGAGGGTGGATGG + Intronic
902841243 1:19075325-19075347 GGAGGTGGGCAGAGGAAGGAGGG - Intronic
902981133 1:20124174-20124196 GCTGATGGGCAGAAGCAAGGGGG - Intergenic
902982781 1:20137882-20137904 GCAGCTGGGCAGAGGAAGGGTGG + Intergenic
903118361 1:21196706-21196728 GATGATGGAGAGAGGGGGGATGG - Intergenic
903214032 1:21833326-21833348 GATGGTGGGCAGCGGTAGGAAGG + Exonic
903271372 1:22190452-22190474 GCATCTGGGCAGATGGAGGACGG + Intergenic
903541033 1:24096448-24096470 ACGGGTGGGCAGAGGGAGGCAGG + Intronic
903577335 1:24346935-24346957 TCTGATGGGGAGTGGGAGAAGGG + Intronic
903622417 1:24707571-24707593 CCTGGTGGGCAGAGGGAGCCAGG + Intergenic
903776168 1:25795209-25795231 GGGGATGGACAGAGGAAGGAGGG - Intergenic
904277698 1:29394978-29395000 GCAGGTGGACAGAGGCAGGAAGG + Intergenic
904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG + Intergenic
904678757 1:32214629-32214651 GCTGGTGGGAAGAGGCAGCAAGG + Intronic
904775129 1:32901547-32901569 GCCGGTGGGCTGAGGGAGGGCGG - Intergenic
904934005 1:34113583-34113605 GCTGAGGGGCAGTGGGGGAAAGG + Intronic
905160069 1:36024952-36024974 ACTGATGGGTAGAGATAGGAAGG - Intronic
905592601 1:39177577-39177599 GCTAATGGAGAGAGGGATGATGG + Intronic
905717082 1:40161381-40161403 GCTGGTGGGCCGTGGGAAGATGG + Exonic
905731034 1:40299747-40299769 GTTGAGGGGAGGAGGGAGGAGGG + Intergenic
905746510 1:40422928-40422950 GCAGATGGGGAGAGGGTGGGAGG - Exonic
906078671 1:43069501-43069523 GCTCAGGGGAGGAGGGAGGATGG + Intergenic
906290810 1:44618126-44618148 GCTGTTGGGCAAAGGGAGGCAGG - Intronic
906323990 1:44832939-44832961 GGTGTGGGGGAGAGGGAGGATGG + Intronic
906689684 1:47784414-47784436 GGGGCTGGGCAGAGGGAGGAGGG + Intronic
906692481 1:47801686-47801708 TCTGAAGTCCAGAGGGAGGAGGG - Intronic
906747245 1:48230702-48230724 GCAGGTAGGCAGAGGGAAGAGGG + Exonic
907425693 1:54378111-54378133 GCTGATGGCCAGAGGTCCGAGGG - Intronic
907698987 1:56765102-56765124 ACTGCTGGGCAGAAGTAGGAAGG + Intronic
907705275 1:56827236-56827258 GCACATGGGCAGAGGGACAAAGG - Intergenic
907744160 1:57196032-57196054 GGTGATGGGGAGTAGGAGGAAGG + Intronic
908085239 1:60625281-60625303 GCAAATGGGAAGAGGGAAGAGGG + Intergenic
908107993 1:60865625-60865647 GCAGAGTGGCAGAGAGAGGATGG - Intronic
908360053 1:63359993-63360015 GCTGAGGTTCAGAAGGAGGAGGG - Intergenic
908750679 1:67420040-67420062 GCTGATGGGCAGTGGAAGAAGGG - Exonic
908916903 1:69138583-69138605 GCTGAAGAGCTGAGGGATGATGG - Intergenic
909118857 1:71575117-71575139 GCTGATCTACAGAGAGAGGAAGG + Intronic
909323627 1:74321521-74321543 GCTGATGGATAGAGAGAGGGAGG - Intronic
909706068 1:78586183-78586205 GCCGGTGGGTAGAGGGAGGGCGG - Intergenic
909996156 1:82282160-82282182 ACTGATGGGGAGAGTGAGAAAGG + Intergenic
910449595 1:87331845-87331867 GCTGAGGGGGAGAGGGAAGAAGG - Intronic
910667070 1:89737158-89737180 GGTGCTGTGCAGAGGCAGGATGG - Intronic
911639742 1:100275227-100275249 GCTAATGGGAGGAGGGTGGAAGG + Intronic
911725890 1:101240238-101240260 GCTGCAAGCCAGAGGGAGGAAGG + Exonic
912497133 1:110098808-110098830 GCTGATGGGCAGAGGTGGATGGG + Intergenic
912735324 1:112145097-112145119 CCAGCTGGGCAGGGGGAGGATGG + Intergenic
913099172 1:115547272-115547294 GATGAGGGGGAGAGGGAGCAGGG - Intergenic
913519917 1:119635305-119635327 GCTCATGGGAAGTGGGAGAAGGG + Intronic
913553088 1:119936069-119936091 GCTTAGGGGTAGAGGGAGGTGGG + Intronic
913684669 1:121220410-121220432 GAAGCTGGGCAGAGGGTGGAAGG + Intronic
914036505 1:144008026-144008048 GAAGCTGGGCAGAGGGTGGAAGG + Intergenic
914152949 1:145059920-145059942 GAAGCTGGGCAGAGGGTGGAAGG - Intronic
914347985 1:146816074-146816096 GCTGAAGGGGAGAGAGAGGAAGG - Intergenic
914831422 1:151173615-151173637 CCTGATGGGGAGATGAAGGATGG + Exonic
914847966 1:151293242-151293264 GCATGTGGGCAGAGGAAGGAAGG + Intronic
915300202 1:154947398-154947420 GCAGGTGGGCACAGGCAGGAGGG - Exonic
915302169 1:154957925-154957947 ACAGATGGGCTGGGGGAGGAGGG + Exonic
915624676 1:157107335-157107357 ACTACTGGGCAGAGGGAGGCAGG - Intergenic
915642749 1:157241913-157241935 GCTGTTGGGTAGGGGGAGGAAGG - Intergenic
915940290 1:160114517-160114539 GATGAGGGGCACAGAGAGGAAGG - Intergenic
916245069 1:162679187-162679209 GAGGATGGTCAGTGGGAGGAGGG - Intronic
916291764 1:163174663-163174685 GCTGATGAGAAGAGGCAGGGAGG + Intronic
916759713 1:167805374-167805396 GCTGATGGGCAAAGGAAGGTAGG - Intergenic
917441664 1:175074031-175074053 GCTGCATGGCAGAGAGAGGAAGG - Intronic
917609188 1:176669007-176669029 ACTGGTGGGTTGAGGGAGGATGG + Intronic
918143422 1:181736501-181736523 GGTGAAGGGGAGAGGAAGGATGG + Intronic
918289310 1:183091477-183091499 GAGGAAGGGCAGAGGGAGGGAGG - Intronic
918511297 1:185316854-185316876 GCGGATGGGAAGAGGGTGGGAGG - Intronic
919239183 1:194889553-194889575 GCTCCTGGGCAGAAGGAGGCAGG + Intergenic
919630364 1:199954871-199954893 GCTGGAGAGCAGAGGGAAGAGGG - Intergenic
919919532 1:202160033-202160055 GGGGATGGGCAGGAGGAGGAAGG - Intronic
920033940 1:203053668-203053690 GCTGGTGGGTAGAGGTAGGGAGG + Intronic
920084959 1:203408684-203408706 GCTGATGTGGGGAGGGAAGAAGG + Intergenic
920260469 1:204685053-204685075 GCCGAGGGGCAGAGGGACGGAGG - Intronic
920312869 1:205058715-205058737 GATGCTTGGCAGAGGAAGGATGG + Intronic
920471980 1:206238960-206238982 GAAGCTGGGCAGAGGGTGGAAGG + Intronic
921477991 1:215633220-215633242 TCTGATGGGCTCAGGGAGGAAGG + Intronic
922041703 1:221903889-221903911 GCTCCTGGGCAGAAGGGGGAGGG - Intergenic
922224418 1:223632929-223632951 CCAGATGGGAAGAAGGAGGAAGG - Intronic
922481275 1:225941271-225941293 GGTGAAGGGAAGAGGGAGGGAGG + Exonic
922504458 1:226118550-226118572 GGAGATGGGAAGAGGGAGGAAGG + Intergenic
922700128 1:227754432-227754454 ACGGATGGACAGATGGAGGAAGG - Intronic
922784442 1:228276114-228276136 GCTGAGGGGAGGAGGGAGGAGGG + Intronic
922784460 1:228276181-228276203 GCTGAGGGGAAGAGAGAGGAGGG + Intronic
923107519 1:230866100-230866122 GCTCCTGGGCACAGGGATGATGG - Intronic
923473733 1:234314050-234314072 GCTGATGTCCAGAGAGTGGAAGG + Intronic
923644631 1:235805402-235805424 GCTGATGCGCAGATGGTGAATGG + Intronic
1062894788 10:1094986-1095008 GGTGATGGGGATAGCGAGGAGGG + Intronic
1062940201 10:1415107-1415129 ATGGATGGGCAGAGGGATGATGG + Intronic
1063498028 10:6528094-6528116 GCAGGAGGGAAGAGGGAGGAGGG - Intronic
1063786135 10:9385418-9385440 GCTAATGGGCAGAGCAATGAAGG - Intergenic
1063819686 10:9819945-9819967 GCAGTTTGGCGGAGGGAGGAGGG - Intergenic
1064016307 10:11775070-11775092 GCTGATGGCAAGGTGGAGGAGGG - Intergenic
1064048828 10:12042872-12042894 GCTGGCGGGCGGAGGGAGGAGGG - Intronic
1064321154 10:14305973-14305995 GCGGATGGGCAGTGGGAGAAGGG + Intronic
1064503872 10:16008593-16008615 GCGGTTGGGGAGAGGGAGGGAGG + Intergenic
1064799748 10:19055843-19055865 ACTGAAGGGAAGAGGGAGGTGGG + Intronic
1065181567 10:23131343-23131365 GTTGGAGGGCAGAGGGTGGAAGG + Intergenic
1065838683 10:29682011-29682033 TCTGATGGGCTGAGGGAGTGGGG - Intronic
1066226313 10:33386874-33386896 CCTGACAGGCAGAGGGAAGATGG + Intergenic
1066534179 10:36372485-36372507 GGTGGTGGGAAGAGGTAGGAGGG - Intergenic
1066610999 10:37248474-37248496 GCTGATGGGGGGAAGCAGGAAGG - Intronic
1067066460 10:43106696-43106718 AGTGCTGGGCAGAGGGTGGAGGG - Intronic
1067426507 10:46215359-46215381 ACTGATGTGGAGTGGGAGGAAGG - Intergenic
1067552938 10:47247848-47247870 CCTGAGGGGCAGAGGGAGGCAGG + Intergenic
1067908118 10:50315542-50315564 GATAGTGGGCAGATGGAGGAAGG - Intronic
1068025479 10:51637761-51637783 CCTGTTGGGCAGGGGGTGGAAGG + Intronic
1068425577 10:56859334-56859356 GCTGATGGGCAGAGGCTGGAAGG - Intergenic
1068658554 10:59599697-59599719 GCAGTTGGGCAGAGGGATGGGGG + Intergenic
1069086892 10:64151117-64151139 GCTGGTGGGCAGAGGGTGTAGGG - Intergenic
1069634908 10:69919130-69919152 GGTCATGGGCAGAGGTGGGAGGG + Intronic
1069691816 10:70358693-70358715 GCTGGTGGGCAGAGAGGGGAGGG - Intronic
1069945438 10:71982285-71982307 GCTGGTTTGCAGATGGAGGAAGG + Intronic
1070240381 10:74674292-74674314 GCTGGTGTGGAGAGGGAGCAGGG - Intronic
1070416708 10:76197306-76197328 GCAGAAGGTCAGATGGAGGAAGG - Intronic
1070666738 10:78350412-78350434 GCTGTGGGGCAGAGGGGAGAGGG - Intergenic
1070781798 10:79141933-79141955 GGTGATGGGAACAGGGACGAAGG + Intronic
1071710081 10:88041468-88041490 GATGGTGGTGAGAGGGAGGAGGG + Intergenic
1072225044 10:93361105-93361127 GTTGTGGGGTAGAGGGAGGATGG + Intronic
1072307548 10:94121934-94121956 CCAGCTGGGCAGAGAGAGGAAGG + Intronic
1072696757 10:97609608-97609630 GCTGGTGGGAAGGTGGAGGAAGG - Intronic
1072780698 10:98249353-98249375 GCAGAAGGTCAGAGGGTGGAAGG + Intronic
1073006514 10:100329480-100329502 GCTGATGGGAAGAGCAAGCATGG - Intronic
1073265570 10:102226415-102226437 ACTCCTGGGCAAAGGGAGGAGGG - Exonic
1073632016 10:105158663-105158685 GTTGGGGGGCAGAGGCAGGAGGG + Intronic
1074276448 10:112006870-112006892 GCAAAAGAGCAGAGGGAGGAAGG + Intergenic
1074531605 10:114302218-114302240 GCTGCTGGGCAGAGTGGGGTGGG + Intronic
1074715618 10:116215874-116215896 GCTGGTGGGGAGAGGGAGCCGGG - Intronic
1074846947 10:117406825-117406847 GCTCTGGGGCAGAGGGCGGAGGG + Intergenic
1074919323 10:117991370-117991392 GCAGAGGGGCAGAGGGAAGGAGG + Intergenic
1075287410 10:121198927-121198949 GCTTATGGCCAGGGTGAGGAAGG + Intergenic
1075350460 10:121720103-121720125 GTTAATGGGCTGAGGGTGGAAGG - Intergenic
1075689444 10:124385719-124385741 GCTGAGGGGCAGTGGTGGGAAGG + Intergenic
1075962427 10:126580884-126580906 ACTTATGGGTAGAGGGAGGGAGG - Intronic
1076402472 10:130193076-130193098 GCAGATGGGCAGAGAGAGTGGGG - Intergenic
1076502696 10:130949704-130949726 GGTGCGGGGCAGAGGGAGGCTGG - Intergenic
1076672536 10:132131170-132131192 GCTCATGGGGTGAGGGAGTATGG + Intronic
1076676062 10:132148442-132148464 GAGGACGGGCAGATGGAGGACGG - Intronic
1076683485 10:132186811-132186833 GCTGATGGGCGGGGTGAGGCGGG + Intergenic
1076792372 10:132784345-132784367 GCTGATGCGCAGAGGGACTTTGG + Intergenic
1076825122 10:132963369-132963391 GTTGATGGACAGATGGAGGGAGG - Intergenic
1076874900 10:133211132-133211154 GGTGGTGGGCTGAGGGGGGAGGG + Intronic
1077015139 11:395995-396017 GTGGGTGGGCAGAGGGTGGAGGG - Intronic
1077116913 11:889333-889355 GCTGGTCGGCCGAGGGAAGAGGG - Intronic
1077199029 11:1296393-1296415 TCTGAGGGGAAGAGAGAGGATGG + Intronic
1077218799 11:1406138-1406160 GCGGCTGGGCAGGGAGAGGAAGG - Intronic
1077280515 11:1742952-1742974 GAGGATGGACAGATGGAGGATGG + Intronic
1077280591 11:1743354-1743376 GAGGATGGACAGATGGAGGATGG + Intronic
1077280606 11:1743430-1743452 GATGAAGGACAGATGGAGGATGG + Intronic
1077285027 11:1761799-1761821 GCGCAGGTGCAGAGGGAGGACGG - Intronic
1077425006 11:2471327-2471349 GCAGATGGGGAGAGGGAGGAGGG - Intronic
1077478715 11:2803101-2803123 GGTGAGGGGCAGAGTGAGCAAGG + Intronic
1078491265 11:11771115-11771137 GCAGATGGGAAGCGGGAGAAAGG - Intergenic
1078507354 11:11962198-11962220 GGCCATGGGCAGAGGGAGGGAGG - Intergenic
1078604306 11:12761638-12761660 GAGGGTGGGCAGAGGGATGATGG + Intronic
1078655875 11:13238575-13238597 GAGGGTGGGCAGCGGGAGGATGG + Intergenic
1079097718 11:17521621-17521643 GATGCTGGGCTGTGGGAGGAGGG + Intronic
1079297932 11:19251114-19251136 ACTAATGGGAGGAGGGAGGAAGG + Intergenic
1079302273 11:19288464-19288486 CCAGATGGGGAGTGGGAGGAGGG + Intergenic
1079335536 11:19567456-19567478 GCTGATGGGAAAAGAGAGAAGGG - Intronic
1079963501 11:26952642-26952664 GATGATGGGCACAGGAAGGTGGG - Intergenic
1080639910 11:34152584-34152606 TCTGTAGGGCAGAGAGAGGAGGG + Exonic
1080691972 11:34565877-34565899 CCTGGTGGGCACAGGGAAGAGGG + Intergenic
1080770089 11:35332701-35332723 GCAGATGGGGAGAGGGAGGATGG - Intronic
1081590848 11:44422087-44422109 TGTTATGGGCAGGGGGAGGAGGG - Intergenic
1082791271 11:57348091-57348113 GGGGAAGGGAAGAGGGAGGAAGG + Intronic
1082988072 11:59184980-59185002 GGTCATGGGCAGAGAGAGGAGGG - Intronic
1083159834 11:60848180-60848202 TCTGAAGGCCGGAGGGAGGAAGG + Intronic
1083324312 11:61865732-61865754 GGTGATGGCCAGAGGAATGATGG + Exonic
1083656630 11:64232886-64232908 GGTGATGGGCAGAGGGCAGGAGG + Intronic
1083668901 11:64289620-64289642 GCTGGTGGGCTGGGAGAGGAGGG + Intergenic
1083822695 11:65181894-65181916 GCGGAGGGGCGGCGGGAGGAGGG + Intronic
1083876896 11:65529028-65529050 GCTGTAGGGAGGAGGGAGGAAGG + Intronic
1083881768 11:65552452-65552474 GCAGCTGGGCAGAGGGACGTGGG - Intronic
1084410431 11:69003400-69003422 GCTGAGGAGCAGGGGCAGGAGGG + Intergenic
1084422456 11:69067139-69067161 GCTACGGGGCAGAGGCAGGAGGG - Intronic
1084664558 11:70569447-70569469 TGTGCTGGGCAGAGGGTGGATGG + Intronic
1084666447 11:70578972-70578994 ACAGCTGGGCAGAGGGTGGATGG - Intronic
1084948572 11:72652249-72652271 GCTGATGGGCCCATGGAGAAGGG - Intronic
1084953932 11:72681384-72681406 GCAGACGGGCAGGGGGAGGAGGG + Intergenic
1084954193 11:72682915-72682937 GCTGGGGGGCAGAGGGGAGAGGG - Intergenic
1084956462 11:72694132-72694154 GTGGATTGGGAGAGGGAGGAGGG - Intronic
1085147916 11:74219745-74219767 GTGGATGGGGAGAGGGAGGTGGG + Intronic
1085217993 11:74849062-74849084 GCTGAGGAGGAGAGGGAGAATGG - Intronic
1085681085 11:78575450-78575472 GTTGGAGGGCAGAGGGAAGAGGG - Intergenic
1085850668 11:80115802-80115824 GTACATGGGCAGAGGGTGGATGG + Intergenic
1086152150 11:83623812-83623834 GCAGTTGGGCAGGGGGAAGAGGG + Intronic
1086203780 11:84234346-84234368 ACTGATGGGCAGAAGGCAGAAGG - Intronic
1086224994 11:84497185-84497207 TCCTATGGGAAGAGGGAGGAAGG - Intronic
1086402473 11:86472097-86472119 GCGGATGGAAGGAGGGAGGAGGG + Intronic
1086486330 11:87306617-87306639 GGTGATGGGGGAAGGGAGGAGGG - Intronic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1087965064 11:104402959-104402981 GCTGATTAGCAGAAGGAGGTGGG - Intergenic
1088876621 11:113941688-113941710 GGAGATGGGAGGAGGGAGGAGGG + Intronic
1088917419 11:114238186-114238208 GCTGATGGGCCACTGGAGGAGGG - Intronic
1089135542 11:116246227-116246249 GCTGGTGGGAGGAGTGAGGATGG - Intergenic
1089215472 11:116832138-116832160 ACTGATGGGCAGGGGCAGGATGG - Intronic
1089218555 11:116851478-116851500 ACTTAGGGGCAGAGGCAGGATGG + Intronic
1089230232 11:116967819-116967841 CCTGATGGGCACAGGGAGGCTGG - Intronic
1089360878 11:117885655-117885677 GCTGAGGCACAGAGGTAGGAAGG + Intergenic
1089399707 11:118157353-118157375 GGAGGAGGGCAGAGGGAGGAGGG + Intergenic
1089441904 11:118524586-118524608 GTTCATGGGCAAAAGGAGGAAGG - Exonic
1089539797 11:119182949-119182971 GCTGCTGGCCAGTGGGAGGCAGG - Intronic
1089843314 11:121437850-121437872 GTTGATGGGAAGTGGGAGTAGGG + Intergenic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090263295 11:125338186-125338208 GAAGATGGGCAGAGGGAGACAGG - Intronic
1090600152 11:128361769-128361791 GCTGATGAGAAGTGGGCGGAAGG + Intergenic
1090983834 11:131748556-131748578 GTGGATGGGCACAGGGAGGAGGG - Intronic
1091239624 11:134043794-134043816 GCTGAGGGCTAGAGGAAGGAAGG + Intergenic
1091358464 11:134956215-134956237 ATTGATGGGCAGAGGGTGAAGGG + Intergenic
1091454947 12:599948-599970 GCAGCTGGGCAGAAGGAGGCGGG - Intronic
1091571536 12:1691140-1691162 GCTGAGGGGAGGGGGGAGGAGGG - Exonic
1091574451 12:1720334-1720356 ACTGGTGGGCAGGGGGTGGAGGG + Intronic
1091613559 12:2032072-2032094 GCTGCAAGGTAGAGGGAGGAGGG + Intronic
1091770323 12:3147231-3147253 GCTGCTGGGCAGCAGGAGGCAGG + Intronic
1091846227 12:3658132-3658154 GCAGAAGGGGAGAGGGAGGCTGG + Intronic
1091995408 12:4989023-4989045 GCTGATAGGCAGAGGCAGAAAGG - Intergenic
1092260839 12:6952545-6952567 GGTGAGGGGCAGACGGAGGAAGG - Intronic
1092732220 12:11545645-11545667 GCTGAGTGGCAGGGGGAGGAAGG - Intergenic
1092768079 12:11871073-11871095 GGTCATGGGCTCAGGGAGGAGGG - Intronic
1093317254 12:17666845-17666867 GCTGATGAGTGGAGGGAGGCTGG - Intergenic
1093493030 12:19726162-19726184 GCTCCTGGGCAGAAGGAGGTGGG - Intergenic
1094610524 12:31991085-31991107 GCTGCTTGGCAGACTGAGGAAGG + Intronic
1095968017 12:47882593-47882615 GGTGGTGGGCAGGGGAAGGAAGG - Intronic
1096529262 12:52233104-52233126 GCGGGCGGGCAGAGGGCGGAGGG + Exonic
1097189885 12:57214609-57214631 GCTGGCTGGCAGAGGGTGGAGGG - Intergenic
1097391532 12:59021058-59021080 GCTTATGGAGAGAGAGAGGAAGG + Intergenic
1097401729 12:59135620-59135642 GTTAATGGGCAGAGGTTGGAGGG - Intergenic
1097981827 12:65742910-65742932 GATGGCGGGCTGAGGGAGGAGGG + Intergenic
1098100205 12:67007141-67007163 GGTGATGGGCAGAGGGTAGAGGG + Intergenic
1098439703 12:70504653-70504675 GCTCCTGGGCAGGGGAAGGACGG - Intergenic
1098544819 12:71700096-71700118 ACTGATGGAGAGGGGGAGGAAGG - Intronic
1099494062 12:83322882-83322904 TCTGATGAGTAGATGGAGGAAGG + Intergenic
1100877353 12:98975838-98975860 GTGGTTGGGCAGAGGGAGCAGGG + Intronic
1101298671 12:103454484-103454506 GCTGGTGGGAATAGGGAAGATGG - Intronic
1101756455 12:107624496-107624518 GCTGAAGGGTGGAGGCAGGAGGG - Intronic
1101839891 12:108320583-108320605 GCTGAGGGGAAGATGGAAGAAGG - Intronic
1101888504 12:108690356-108690378 GCTGCTGGGGAGAGGGAGTATGG + Intronic
1102027545 12:109722109-109722131 TCTGACGGGCAGAGCCAGGAAGG + Intronic
1102465338 12:113127780-113127802 GGACATGGGCAGAGGGAGGAGGG - Intronic
1102677474 12:114668415-114668437 GCTGATGGGCGGGGGGTGGAGGG - Intergenic
1103051213 12:117781446-117781468 GATGATGGGGAGAGGGAAGGGGG + Intronic
1103176812 12:118871446-118871468 GGTGATGGGCAGAGACAGGCAGG + Intergenic
1103205643 12:119126666-119126688 GTTGATGAGAAGAAGGAGGAAGG + Intronic
1103393785 12:120592436-120592458 GCGGCTGGGGGGAGGGAGGATGG - Intergenic
1103621445 12:122189683-122189705 GATGCTGGGGAGTGGGAGGAGGG - Intronic
1103724358 12:122990399-122990421 CCTGGTGGGTAGAGGGAGGGAGG - Intronic
1103767539 12:123291746-123291768 GCTGAAGGGAAGAGGGAAAAGGG + Exonic
1103914342 12:124368752-124368774 GGTGATGGGCAGATGGGGCATGG - Intronic
1103919166 12:124390549-124390571 GCCGATGAGCAGTGGGACGAGGG - Intronic
1103936377 12:124479746-124479768 GATGCCAGGCAGAGGGAGGAGGG + Intronic
1104053793 12:125214277-125214299 GCTGAGAGACAGAGGGAGGCTGG - Intronic
1104211856 12:126696603-126696625 GCTGAACTGCAGAGGCAGGAAGG + Intergenic
1104583601 12:130029444-130029466 GCTGTTGGAAAGAGTGAGGAGGG - Intergenic
1104654170 12:130560777-130560799 GCTCTTGGGCATAGGGAGGGAGG - Intronic
1106071492 13:26416339-26416361 GCTGTTGGGGAGAGTGAGGAGGG - Intergenic
1106824935 13:33510004-33510026 GCTGCTGGGCAAAGAGAGCAAGG - Intergenic
1106861423 13:33912860-33912882 GATGAAGGGAAGAGGAAGGATGG + Intronic
1107991879 13:45825949-45825971 GTTGAGGGCCAGGGGGAGGAAGG - Intronic
1108160972 13:47638731-47638753 GGGGAAGGGGAGAGGGAGGAGGG + Intergenic
1108426482 13:50306927-50306949 GGGGATTAGCAGAGGGAGGAAGG - Intronic
1109081348 13:57905299-57905321 ACTGGAGGGCAGAGGGTGGAAGG + Intergenic
1109083848 13:57944174-57944196 GATAATGGGTAGAGGCAGGAGGG + Intergenic
1109821627 13:67664629-67664651 CCTGAAGGGCAGAGAGAAGAGGG + Intergenic
1112945286 13:104920142-104920164 GCTGTTGGGGAGAGGCAGGGTGG + Intergenic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1113409548 13:110072733-110072755 GATGGTGGGCAGAGGATGGAAGG + Intergenic
1113850136 13:113413260-113413282 GCTGAAGGGCACAGCGAGGTTGG - Intergenic
1114746318 14:25151708-25151730 GCTGCAGGGGAGAAGGAGGAGGG + Intergenic
1115029298 14:28774981-28775003 GTTGTTGGCCAGAGGGAGGCCGG + Intronic
1116791772 14:49346942-49346964 CCTGAGGGGCAGAAGGAGAAGGG - Intergenic
1117828583 14:59727719-59727741 ACAGATGGACAGAGAGAGGAGGG + Intronic
1117948122 14:61053032-61053054 GCTGGTGGGTAGAGGGTGGGAGG - Intronic
1118073398 14:62271120-62271142 GAGGATGGAGAGAGGGAGGATGG - Intergenic
1118157890 14:63258585-63258607 GCTGTTGGGGAGAGGGAAGCTGG - Intronic
1118708800 14:68503034-68503056 GCTTCAGGTCAGAGGGAGGAGGG - Intronic
1119109949 14:71962285-71962307 GTGGCTGGGCAGAGGGAGGCCGG + Intronic
1119197284 14:72726456-72726478 GCTGATGGGCAGAGGGAGGATGG - Intronic
1119389518 14:74281528-74281550 GCCTCTGGGCAGAGGAAGGAGGG - Intergenic
1119417477 14:74482877-74482899 GCAGCTGGGAGGAGGGAGGAGGG + Intronic
1119850114 14:77861096-77861118 GCTAATCGGCAGGGGGTGGAGGG - Intronic
1121303075 14:92887295-92887317 GCTCATGGACAGAAGGATGAAGG + Intergenic
1121521161 14:94587134-94587156 GATGACGGGGAGAGGAAGGAGGG - Intronic
1121787713 14:96674861-96674883 GCAGATGGCAAGAGGGATGAAGG - Intergenic
1121847558 14:97186696-97186718 GCAGATGGGAGGAGGGAGGGAGG - Intergenic
1121954176 14:98198957-98198979 GCAGATGTGCAAAGTGAGGATGG + Intergenic
1122021426 14:98840874-98840896 GCTGATGGGCACATGGGGGCAGG - Intergenic
1122047514 14:99034531-99034553 GGGGAGGGGCAGAGGGAGGGAGG - Intergenic
1122282851 14:100634462-100634484 ACTGAACGGCAGAGGCAGGATGG - Intergenic
1122309467 14:100785395-100785417 ACTGCTGGGCAGAGTCAGGAAGG - Intergenic
1122322747 14:100865531-100865553 TCTGATGGGCAGAAGGACAAAGG - Intergenic
1123017347 14:105381766-105381788 ACTGATGGGCAGTGGGAACATGG - Intronic
1123439876 15:20282499-20282521 GCTGATGGGCAGAGGTGGGGAGG + Intergenic
1123499588 15:20867422-20867444 ACTGATGGGGAGATGCAGGAAGG + Intergenic
1123556840 15:21441152-21441174 ACTGATGGGGAGATGCAGGAAGG + Intergenic
1123593063 15:21878388-21878410 ACTGATGGGGAGATGCAGGAAGG + Intergenic
1123707339 15:22959779-22959801 GCTGGTGGGGAGGGGGAGCACGG - Intronic
1124440699 15:29684165-29684187 GCAGATTGGCAGAGGAAAGATGG - Intergenic
1124824099 15:33076102-33076124 GCTGGGGGGCAGGGGGATGAGGG + Intronic
1124882945 15:33659108-33659130 GCTGATGTGCAGTGGGCAGAGGG + Intronic
1125095046 15:35841123-35841145 CCTGATGGGCATTAGGAGGAAGG + Intergenic
1125500693 15:40238909-40238931 GCTGAAGGGGAGGAGGAGGAAGG - Intronic
1125539600 15:40462312-40462334 GCTGATGACGAGAGGGAGGGAGG + Intronic
1125832652 15:42727769-42727791 GCTGTGGGGCAGAGGGAGAATGG + Exonic
1125889700 15:43256506-43256528 GCTTGTGGGGAGAGGGAGCAGGG - Intronic
1126878286 15:53067476-53067498 GCTGATTGGCAGAAGGAGGCTGG + Intergenic
1127262349 15:57335550-57335572 GCTGGAGAGCAGAGGGAGAACGG - Intergenic
1127302256 15:57666485-57666507 GATTTGGGGCAGAGGGAGGAGGG - Intronic
1127760720 15:62136875-62136897 GCTGATGGGCAATGGGAAGCAGG + Intergenic
1128527167 15:68420458-68420480 ACAAATGGGCAGAGCGAGGAAGG - Intronic
1128557250 15:68640185-68640207 GGTGATGGACAGAGGCTGGAAGG - Intronic
1128645179 15:69373061-69373083 GCTGATGTGAAGATGGAGGAAGG - Intronic
1128780861 15:70357699-70357721 GCTGATGTGCAGATGGGTGATGG + Intergenic
1129245470 15:74276458-74276480 GCTGTGGGGCTGAGAGAGGAGGG - Intronic
1129467697 15:75733103-75733125 GCTGATGCCCAGAGAAAGGAGGG + Intergenic
1130078497 15:80710474-80710496 GCTGATATGTCGAGGGAGGAAGG + Intronic
1130397182 15:83512785-83512807 GCTGATAGGGAGAGGGAGGGAGG - Intronic
1130887844 15:88108971-88108993 GTGGATGGGCAGAGAGAGGGAGG - Intronic
1131537910 15:93252993-93253015 GTTGCTGGGAAGAGGAAGGAAGG - Intergenic
1131642531 15:94307763-94307785 GCTGATGGGCTGTGGGCAGAGGG + Intronic
1131965775 15:97840754-97840776 ACTGGTGGGCAAAGGGAAGAGGG + Intergenic
1132226997 15:100150571-100150593 GAGGAGGGACAGAGGGAGGAAGG - Intronic
1202965183 15_KI270727v1_random:168341-168363 ACTGATGGGGAGATGCAGGAAGG + Intergenic
1132465712 16:76631-76653 CTTGATGGGCAGGGAGAGGATGG - Intergenic
1132590111 16:722903-722925 GCAGGTGGGCAGAGGGAGCTGGG - Exonic
1132716100 16:1290553-1290575 GCTGAGGGGCAGAAGGCAGAAGG + Intergenic
1132724971 16:1334471-1334493 GTCGGTGAGCAGAGGGAGGAGGG + Intronic
1132780461 16:1621588-1621610 GCCGAGGGGCAGAGGGAGCTTGG + Intronic
1132854339 16:2038127-2038149 CCTGGTGGGCAGGGGCAGGATGG - Exonic
1133227069 16:4346123-4346145 GCTGCAGGGCAGAGGGGGGCTGG + Intronic
1133297687 16:4762879-4762901 ACGGCTGGGCAGAGGGAGGGAGG - Intronic
1133339491 16:5027389-5027411 GGAGATGGGAGGAGGGAGGAGGG + Intronic
1133424194 16:5673444-5673466 GCTGAAAGCCAGAGAGAGGAAGG - Intergenic
1134104501 16:11476189-11476211 GCAGATGCGAGGAGGGAGGAGGG + Intronic
1134105844 16:11485546-11485568 GCGGACGGGCAGATGGAAGACGG - Intronic
1134227130 16:12399825-12399847 GCTTGTGGGCAGGGGGAGCATGG + Intronic
1134449355 16:14354095-14354117 GGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1134610857 16:15606843-15606865 GCTGTGGGGCTGAGGGAGCAAGG - Intronic
1134803960 16:17108923-17108945 GTTGATGGGCAGGCTGAGGACGG + Exonic
1135042653 16:19129890-19129912 GCTGAGGGGCAGAAGGCAGAAGG - Intronic
1135247414 16:20868992-20869014 GCTGATGTGCAGAGGAGGGAGGG - Intronic
1135359205 16:21796900-21796922 GCAGAGGGGGAGAGGGAGGGTGG + Intergenic
1135389336 16:22076437-22076459 GCTGGTGGGTAGAGGCAGGGAGG + Intronic
1135404257 16:22186842-22186864 GATGGTGGGGAGAGGTAGGAAGG - Intronic
1135457757 16:22613337-22613359 GCAGAGGGGGAGAGGGAGGGTGG + Intergenic
1135725988 16:24854192-24854214 GGAGTGGGGCAGAGGGAGGAGGG - Intronic
1136083639 16:27869010-27869032 ACTAAGAGGCAGAGGGAGGAGGG + Intronic
1136103648 16:28013349-28013371 GCTGGCGAGCAGAGGGAGGTGGG + Intronic
1136296901 16:29309002-29309024 AGGGATGGGCAGAGGGAGCACGG - Intergenic
1136375592 16:29863314-29863336 GCAGAGGAGGAGAGGGAGGAAGG + Exonic
1137065554 16:35838438-35838460 TCTGAAAGGCAGAGGCAGGATGG + Intergenic
1137253439 16:46756972-46756994 GGTGAGGGGCAGGAGGAGGAAGG + Intronic
1137531253 16:49280386-49280408 GGTGAGGGGTAGAGAGAGGAGGG - Intronic
1137579717 16:49626590-49626612 GTGGATGGGTAGATGGAGGATGG - Intronic
1137579842 16:49627162-49627184 ATTGATGGGTAGATGGAGGATGG - Intronic
1137655210 16:50153377-50153399 GCGGAGGGGCGGAGGGAGGGGGG + Intronic
1138265837 16:55658821-55658843 GGTCATGGGCAGAGAGAGAAAGG + Intronic
1138389669 16:56661303-56661325 GATGGTGCGCAGAGGGAGGAAGG - Intronic
1139319031 16:66097941-66097963 GCCGACGGGCAGGGGGAGGCTGG - Intergenic
1139558228 16:67726254-67726276 GGTGGTGGGCAGAGAAAGGAAGG + Exonic
1139657413 16:68397427-68397449 GCTGTGGGGCTGAGGGATGATGG + Intronic
1139829464 16:69785265-69785287 GATGATGGAAGGAGGGAGGAAGG + Intronic
1139939215 16:70592372-70592394 TCTCATGGGCAGAGAGAGGAGGG - Intronic
1139986050 16:70899458-70899480 GCTGAAGGGGAGAGAGAGGAAGG + Intronic
1140014527 16:71168702-71168724 GCTGCAGGGCAGAAGGAGGAGGG + Intronic
1140028246 16:71311576-71311598 GCGGCTGAGCAGAGGGAGCAAGG + Intergenic
1140124818 16:72110411-72110433 GCTGATGGGAGGATGGATGAGGG + Intronic
1140247795 16:73267168-73267190 GCGGAAGGGCAGAAGGAGAAGGG + Intergenic
1140312097 16:73859406-73859428 GCTGATAGGCAGAGAGAGACAGG - Intergenic
1140655139 16:77132368-77132390 GGGGATGGGGAGGGGGAGGAGGG - Intergenic
1140930201 16:79620475-79620497 GCTGGTGGGATGAGAGAGGAGGG - Intergenic
1141049529 16:80747850-80747872 CCAGGTGGGCAGAGGTAGGAAGG - Intronic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1141428918 16:83960877-83960899 GGGGCTGGGTAGAGGGAGGAGGG - Intronic
1141703011 16:85651048-85651070 GCGGAGGGGGAGGGGGAGGAGGG - Intronic
1141703024 16:85651071-85651093 GCGGAGGGGGAGGGGGAGGAGGG - Intronic
1142008260 16:87700639-87700661 GCTGGAGGGCAGAGGGAGGAGGG + Intronic
1142020777 16:87780876-87780898 ACTTGTGGGCAGAGGGAGGAAGG - Intergenic
1142112663 16:88340614-88340636 GCTGAGGCCCAGAGGGAGGAAGG + Intergenic
1142252643 16:88999706-88999728 GGGGCGGGGCAGAGGGAGGAGGG + Intergenic
1142252656 16:88999730-88999752 GGGGCGGGGCAGAGGGAGGAGGG + Intergenic
1142252674 16:88999769-88999791 GGGGCGGGGCAGAGGGAGGAGGG + Intergenic
1142252700 16:88999824-88999846 GGGGCGGGGCAGAGGGAGGAGGG + Intergenic
1142597279 17:1035766-1035788 GGGGAGGGGCTGAGGGAGGATGG - Intronic
1142900713 17:3009748-3009770 GCTGATGGACAGTGGGAGCCCGG + Intronic
1143099159 17:4495731-4495753 GAGGATGGGCAGAGGGCAGATGG + Intergenic
1143253516 17:5539375-5539397 CCTTCTGGGCAGAGGGAAGAGGG - Intronic
1143260568 17:5595533-5595555 TCTGCTGGGCAATGGGAGGAAGG - Intronic
1143365453 17:6405622-6405644 GCTTGTGGGCAGAGGGAAGGAGG - Intronic
1143505477 17:7362338-7362360 AGTGATGGGCTCAGGGAGGAAGG + Intergenic
1143861891 17:9897261-9897283 GCTGGAGGGTAGAAGGAGGAGGG - Exonic
1143881803 17:10035555-10035577 GCTGATGGGCCCAGGGAGGTGGG + Intronic
1143907962 17:10224963-10224985 GCAGATGTGCAGAGGGTGGGCGG - Intergenic
1144232321 17:13220478-13220500 GCTTCTGGGAAGAGGGAGGCTGG + Intergenic
1144429417 17:15177421-15177443 TGTGATAGGGAGAGGGAGGAAGG - Intergenic
1144467713 17:15509544-15509566 GTTAATAGGCAGAGGAAGGATGG - Intronic
1144730438 17:17522917-17522939 GCACTTGGGCAGAGGGAGGAGGG - Intronic
1144755449 17:17677761-17677783 CCTCATGAGCAGAGGCAGGAAGG + Intergenic
1145823977 17:27862681-27862703 GCAGATGGACTGGGGGAGGAGGG + Intronic
1145921655 17:28614323-28614345 GCTTCAGGGCAGAGGAAGGAAGG + Intergenic
1146265920 17:31452684-31452706 GCTGCTGGATGGAGGGAGGAGGG - Intronic
1146490694 17:33279467-33279489 GAGGATGGGAAGAGGGAGGTCGG + Intronic
1146519335 17:33514358-33514380 GAGGATGGGGAGATGGAGGAAGG - Intronic
1146541718 17:33701836-33701858 ACTGATGTGCAGAGGCAGGCTGG - Intronic
1146547536 17:33751862-33751884 GCTGAGAGGCAGCGGGAGGCTGG + Intronic
1146702157 17:34970670-34970692 GCGGATGGTCACATGGAGGAAGG - Intronic
1146789675 17:35744194-35744216 GCTGGGGGGCAGGGGGAGGCAGG + Intronic
1146948984 17:36892751-36892773 GCTGGTGGGATGAGGGAGCAGGG - Intergenic
1146967572 17:37045929-37045951 TCTGATTTGCAGAGGCAGGAAGG + Intronic
1146974532 17:37099476-37099498 GCTGATGGGAGGAGGGCTGATGG + Intronic
1146974545 17:37099521-37099543 GCTGATGGGAGGAGGGCTGATGG + Intronic
1146974582 17:37099641-37099663 GCTGATGGGAGGAGGGCTGATGG + Intronic
1146974590 17:37099671-37099693 GCTGATGGCAAGAGGGCTGATGG + Intronic
1146974596 17:37099686-37099708 GCTGATGGGAGGAGGGCTGAGGG + Intronic
1147250036 17:39147651-39147673 GCAGAAGGGAAGAGGGAGGGAGG + Intronic
1147261568 17:39212176-39212198 GGAGAGGGACAGAGGGAGGAAGG + Exonic
1147343618 17:39771669-39771691 CCTGGAGTGCAGAGGGAGGATGG + Intronic
1147639619 17:41987787-41987809 TCTGATGGGTAGGGGGAAGAGGG - Intronic
1147668396 17:42163179-42163201 GTGGATGGGCAGATGGATGACGG + Intronic
1148049184 17:44760763-44760785 TGGGCTGGGCAGAGGGAGGAAGG + Intronic
1148343968 17:46891067-46891089 CCTGATGGGGAGAGACAGGAGGG + Intergenic
1148577599 17:48722772-48722794 TTTTATGGGAAGAGGGAGGAAGG - Intergenic
1148805449 17:50261537-50261559 ACTGATGGGCAGAAGGATGGGGG + Intergenic
1149283718 17:55137288-55137310 GCAGAAGGACAGAGGGAGGGAGG - Intronic
1149553079 17:57554447-57554469 GCTGAGGAGGAGAGGGGGGATGG - Intronic
1149630940 17:58122652-58122674 GGAGATTGGCAAAGGGAGGAGGG - Intergenic
1149736961 17:59004103-59004125 CCTGAGGGACAGAGGAAGGAAGG + Intronic
1150316225 17:64171495-64171517 GGTAATGGGCAGAGGGAACACGG + Intronic
1150835093 17:68556780-68556802 GCTGATTGGGAGAGGTAGGTGGG + Intronic
1151024402 17:70660232-70660254 GCTTAGGGACAGAGGGAGTATGG + Intergenic
1151322178 17:73358829-73358851 GCTGCTAGGAGGAGGGAGGAAGG + Intronic
1151352392 17:73539479-73539501 GCTGATGGGGAGAGGAGAGAGGG + Intronic
1151423073 17:74011360-74011382 TCTGTTGGGCAGAGAGAGGGTGG - Intergenic
1151499178 17:74478028-74478050 GCGGATGGGGAGAGGGAGGTGGG - Intronic
1152197862 17:78928150-78928172 GTTGATGGATGGAGGGAGGAGGG - Intergenic
1152258984 17:79256391-79256413 GCTGAAGCCCAGAGTGAGGATGG + Intronic
1152319791 17:79602223-79602245 GCTGATGGCCAAAGGGCGGGAGG - Intergenic
1152340455 17:79721328-79721350 GATGGTGGACAGAGGGAGAAAGG + Intergenic
1152371886 17:79893392-79893414 GCTGTGGAGCACAGGGAGGAAGG - Intergenic
1152400767 17:80065052-80065074 GAGGAGGGGGAGAGGGAGGAGGG - Intronic
1153160533 18:2199909-2199931 GCTGGTGGGAAGAGGTAGGAGGG + Intergenic
1153191775 18:2548818-2548840 GTTGAAGGGTAAAGGGAGGATGG - Intronic
1153928662 18:9858903-9858925 GCTGATGAGCGGAGGCTGGATGG + Intronic
1154432786 18:14321129-14321151 GGTGGTGGGCAGAAGGAAGAGGG + Intergenic
1154457645 18:14544297-14544319 ACTGATGGGGAGATGCAGGAAGG + Intergenic
1154483291 18:14856682-14856704 GATGATGGGCAGCTGGAGGGAGG + Intergenic
1154483710 18:14858302-14858324 GATGATGGGCAGCTGGAGGGAGG + Intergenic
1154484131 18:14859922-14859944 GATGATGGGCAGCTGGAGGGAGG + Intergenic
1154484197 18:14860191-14860213 GATGATGGGCAGCAGGAGAAAGG + Intergenic
1154496481 18:14965003-14965025 ATTGATGGGCAGAGGGTGAAGGG - Intergenic
1154999759 18:21674844-21674866 CCTGATAGCCAGAGGGAGGAGGG - Intronic
1155105591 18:22662328-22662350 GTTGTAGGGTAGAGGGAGGAGGG + Intergenic
1155169789 18:23258993-23259015 GGTGGTGGGGGGAGGGAGGAGGG + Exonic
1155258428 18:24018537-24018559 GCTGATGGTGATAGGGAGGCTGG + Intronic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1156449682 18:37259763-37259785 GCTGCAGGCCAGGGGGAGGATGG - Intronic
1156524492 18:37753961-37753983 GATGATGGGTGGAGGGATGATGG - Intergenic
1157172858 18:45424070-45424092 TGAGATGGGCAGAGGGAGGGAGG + Intronic
1157423439 18:47564921-47564943 CCTGATGGGCAGAGGACAGAGGG + Intergenic
1158480060 18:57814241-57814263 GCTGAAGAGGAGAGGAAGGAGGG - Intergenic
1159102619 18:63972167-63972189 GCGGATGTGATGAGGGAGGAGGG - Intronic
1159700644 18:71622377-71622399 GGTCATGGCCAGAGGGTGGAAGG - Intergenic
1159851634 18:73532856-73532878 GGAGAAGGGAAGAGGGAGGAAGG + Intergenic
1160187078 18:76684324-76684346 GCTGATGCGCAGAGGCACGTGGG + Intergenic
1160362104 18:78292364-78292386 GTTGATGCGCAGAGCAAGGAAGG + Intergenic
1160427881 18:78790716-78790738 ACAGATGGGGAGCGGGAGGAGGG + Intergenic
1160562427 18:79766971-79766993 CCTGGTGGGCAGAGCAAGGATGG - Intergenic
1160816875 19:1040150-1040172 GCTGCTGGGCGGAGGGAAGGCGG + Exonic
1160879848 19:1314405-1314427 GCAGAGGGGTAGAGGGAGGGAGG + Intergenic
1160996379 19:1883983-1884005 GCAGAGGAGCAGAGGCAGGAAGG - Intronic
1161171668 19:2815314-2815336 GCTGCTGGGCCGTGGGCGGATGG + Exonic
1161505816 19:4642843-4642865 GGTGGTGGGCAGGGGAAGGATGG + Intronic
1161526564 19:4759739-4759761 GCTGAGGGAGGGAGGGAGGAGGG + Intergenic
1161711148 19:5848853-5848875 ACTGTTGGGCAGATGGAGGAGGG - Intronic
1161719460 19:5895025-5895047 ACTGATGCACAGAGGGAGGCCGG + Intronic
1161785842 19:6325090-6325112 GCAGATGGGCAGAGAGAGCCAGG - Intronic
1162186337 19:8907726-8907748 GGGGCTGGGCAGAGTGAGGAGGG + Intronic
1162299180 19:9834726-9834748 ACAGGTGGGAAGAGGGAGGATGG + Intergenic
1162535583 19:11261700-11261722 GCTGGTGGGCAGACGGGGGAGGG - Intronic
1162825616 19:13249745-13249767 GCTGAGGTGGAGGGGGAGGATGG + Intronic
1162854789 19:13460050-13460072 GCGGGTGAGCAGAGGGAGGGGGG - Intronic
1163427220 19:17246118-17246140 GGGGAGGGGCAGAGGGAGGCGGG - Intronic
1163477103 19:17532845-17532867 GCTCAGGGACTGAGGGAGGAAGG + Intronic
1163592787 19:18203814-18203836 ACTGATGGGCTGATGGAGGTGGG - Intronic
1163609880 19:18295299-18295321 GTGGATGGGCAGATGGTGGATGG - Intergenic
1163849876 19:19656766-19656788 CCTGCAGGGCAGAGGCAGGAGGG + Exonic
1164683201 19:30149708-30149730 GGTGGTGGGCAGGGAGAGGAGGG - Intergenic
1164693828 19:30228785-30228807 GCGGCTGGGCGGCGGGAGGACGG + Intronic
1164767597 19:30783764-30783786 GCTGAAGTTCAGAGGGAGGAAGG + Intergenic
1165135472 19:33665757-33665779 CCTGATGGGTAGAGGGTGGAGGG + Intronic
1165307968 19:35013722-35013744 ACTGATAGGAAGAGAGAGGAGGG + Intronic
1165382133 19:35489001-35489023 GCGGATGTGCAGGGTGAGGAGGG + Intronic
1165735123 19:38170831-38170853 GATGAGGGGGACAGGGAGGAGGG + Intronic
1165770306 19:38376138-38376160 GCTGATGGGGAGGGGAGGGAGGG - Exonic
1165858657 19:38895079-38895101 GCTGAAGGGCTGTGGCAGGAGGG - Intronic
1166111445 19:40625752-40625774 GCTGATAGGCAGAGGGTGCCTGG + Intronic
1166114224 19:40642957-40642979 GCTGAGGCTCAGAGAGAGGAAGG + Intergenic
1166210401 19:41303208-41303230 GCTCATGGTCAGATGGGGGAAGG - Intronic
1166224905 19:41388879-41388901 GCTGATGTGCAGAGAAAGGCAGG + Intronic
1166316593 19:41993051-41993073 GCTGATGGGCCCAGGGATGGAGG - Intronic
1166364390 19:42271061-42271083 CCAGAGGGGCAGAGGGAGGGTGG + Intronic
1166683792 19:44782976-44782998 GCTGAGGTGCAGGGGTAGGACGG + Intronic
1166705422 19:44905650-44905672 ACAGCAGGGCAGAGGGAGGAAGG - Intergenic
1166713028 19:44949123-44949145 ACAGATGGTTAGAGGGAGGAGGG - Intronic
1166719219 19:44987917-44987939 GCAGATGGGGAGAGAGAGGAGGG - Intronic
1166880925 19:45929484-45929506 GCAGAGGGACAGAGGGAGGGAGG + Intergenic
1167220783 19:48196829-48196851 GGTGGTGGGCAGAGGCATGAAGG - Intronic
1167252452 19:48407303-48407325 GGAGATGGACAGAGGGAGGGAGG - Intronic
1167284574 19:48591788-48591810 CCTGATGGGCAGAGGGACAGAGG + Intronic
1167421141 19:49404118-49404140 GGTGAAGGGCAGAGGAAGGACGG - Intronic
1167471455 19:49678161-49678183 CCTGGCGGGCGGAGGGAGGAGGG + Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167686549 19:50960127-50960149 GAGGATGGGGAGGGGGAGGAGGG + Intronic
1167738521 19:51311227-51311249 ACTCCTGGGCTGAGGGAGGAGGG + Intergenic
1168233817 19:55049432-55049454 GCTGAGTGGTACAGGGAGGAAGG - Intronic
1168250185 19:55137481-55137503 ACTCCTGGGCTGAGGGAGGAGGG - Intronic
1168250270 19:55137732-55137754 ACTCCTGGGCTGAGGGAGGAGGG - Intronic
1168276851 19:55283715-55283737 GCTGAGGCAGAGAGGGAGGAAGG - Intronic
1168519912 19:57041634-57041656 GGTGATGGACAGGGTGAGGAGGG - Intergenic
925053476 2:835559-835581 GGTTATGGGCAGAGGGAGGAAGG + Intergenic
925181766 2:1822116-1822138 GCTGTTGGGGAGGGAGAGGATGG - Intronic
925194021 2:1908712-1908734 GCTGATGGGGAGAGGGAGGGTGG + Intronic
925612977 2:5718682-5718704 CCTGAAGGACACAGGGAGGATGG - Intergenic
925745279 2:7038751-7038773 ATTGATGGGCAGATGGATGATGG + Intronic
925887991 2:8410182-8410204 GCTGATTGGCCCAGGGAGAAGGG + Intergenic
925926837 2:8676957-8676979 GCTGGTGGGCAGAGGGGGGGTGG + Intergenic
925984008 2:9200571-9200593 GCTGATGTGCACAGGCAGGGAGG + Intergenic
926115389 2:10209985-10210007 GCTGCTGGGCAGCAGGAGCAGGG - Intronic
926395739 2:12440657-12440679 GCTGCTGGGGAGAGGGAGGGAGG - Intergenic
927108900 2:19850454-19850476 GCTGCAGAGCAGAGGGAGCAGGG - Intergenic
927253762 2:21021570-21021592 GATGATGGGGAGAGGTAGGCAGG - Intronic
927666476 2:25036363-25036385 GCTGATGGGCTGTGTGAGGCTGG + Intergenic
928310408 2:30204965-30204987 GCTGATGGGCATGGGGAGGCAGG - Intergenic
928374206 2:30761851-30761873 ACAGATGGGTAGAGAGAGGAAGG + Intronic
929046648 2:37797119-37797141 GCTGAAGTGTAGAGGGAGGGAGG - Intergenic
929109663 2:38396125-38396147 GTTTGTGGGGAGAGGGAGGAGGG - Intergenic
929814530 2:45220515-45220537 GCAATGGGGCAGAGGGAGGAAGG - Intergenic
929835293 2:45391001-45391023 GATCAGGGGCAGAGGTAGGACGG + Intronic
929917883 2:46151355-46151377 GGTGATGAGCAGAGGTGGGAGGG - Intronic
929945195 2:46365867-46365889 GGCGATGGGCAGAGTGTGGAAGG + Intronic
930035609 2:47083520-47083542 GGTGATGGGAGGAGGGAGGACGG - Intronic
930445873 2:51471496-51471518 GCTGATGTAGAGAGGGACGATGG + Intergenic
930611991 2:53554162-53554184 GCTCCTGGGCAGAAGGGGGAGGG + Intronic
930757149 2:54987553-54987575 GCTGATGGTCACAGAGAGCAGGG + Exonic
931157795 2:59655029-59655051 ACTGAAGGGCTCAGGGAGGAAGG - Intergenic
931774270 2:65526723-65526745 GATGATTGGGAGAGGGAGGGTGG + Intergenic
931858235 2:66326612-66326634 GCTGGTGGGGTGAGGGAGGTTGG + Intergenic
932125741 2:69144236-69144258 GCCACTGGGCAGAGGGAGGCTGG - Intronic
932165766 2:69505088-69505110 GCTGTTGGGGAGAAGGAGGGAGG - Intronic
932287516 2:70549401-70549423 GCTGATGGGGAAAGGGCAGAAGG - Intronic
932377643 2:71251715-71251737 GATGATGGAGAGAGGGAGAAAGG - Intergenic
933069187 2:77836332-77836354 GCTGAGGGGCATAGGGCAGAGGG - Intergenic
933804465 2:85988027-85988049 ACTGCCGGGCAGAGGGAGGATGG + Intergenic
934066800 2:88348847-88348869 ACTGGTGGGGGGAGGGAGGAGGG + Intergenic
934912822 2:98274959-98274981 CCTGAGGAGCAGAGGAAGGATGG - Intronic
934939881 2:98493027-98493049 CCTGATGGGCAGCTGGTGGAGGG - Intronic
935027077 2:99287101-99287123 GCTGATGGGGAGAGGGAAACTGG + Intronic
935534984 2:104283569-104283591 GCTCAGGAGCAGAGGGAGGGGGG + Intergenic
936521284 2:113213360-113213382 GGTGATGGGGAGAGGGAGAAGGG + Intergenic
936537246 2:113321888-113321910 GAGCATGGGCAGAGGGAGGCCGG + Intergenic
936656421 2:114493284-114493306 GATGGTGGGCAGAGAGAGAAAGG + Intronic
937225912 2:120368567-120368589 GGTGAGGGGAAGAGGGAGGAGGG + Intergenic
937885844 2:126899591-126899613 TCTGATGGGCTGAAGGAGAAGGG + Exonic
937920043 2:127122418-127122440 GCTGATGTGCAGGGAGAGGGAGG - Intergenic
938072260 2:128314924-128314946 GCAGACGGGAAGAGGAAGGAGGG + Intronic
938192340 2:129295125-129295147 GTAGTGGGGCAGAGGGAGGAGGG + Intergenic
938882089 2:135600938-135600960 GCTGCAGGGGAGAGTGAGGAAGG - Intronic
940421160 2:153479942-153479964 GCTGAAAGAAAGAGGGAGGAAGG - Intergenic
941588198 2:167385618-167385640 GCTGAGGGGCAGAGGGTTTATGG + Intergenic
941974498 2:171387965-171387987 GCTGCTGGGAAGAGGGAGAGTGG - Intronic
942371935 2:175294690-175294712 GGTGATGAGCAGAGCCAGGAAGG - Intergenic
942685259 2:178523822-178523844 GCTGAGGGGCTGAGGAGGGATGG - Intergenic
942787674 2:179719154-179719176 GCTCATGGGTGGAGGCAGGAAGG - Intronic
943334243 2:186594521-186594543 AATGATGGGCAGAGGGATGGGGG - Intronic
943785653 2:191875645-191875667 GCTGAGTGGCAGAGCCAGGATGG - Intergenic
944412393 2:199457548-199457570 GATGATGGGGGGAGGGAGGAGGG + Exonic
945188438 2:207163405-207163427 GCAGAGGAGCAGGGGGAGGAGGG + Intronic
945197589 2:207251665-207251687 GCTAATGAGCAGTGGGAGGTTGG - Intergenic
946175060 2:217917465-217917487 GCTGAGGGGCAGTGGAAGCATGG + Intronic
946231150 2:218292045-218292067 GCTGGTGAGAAGAGGGAAGAGGG - Intronic
946334425 2:219027905-219027927 ACTGATGGGCGGGGGGAAGATGG + Exonic
946362031 2:219224672-219224694 GCGGAAGCGCAGAGGCAGGAGGG + Exonic
947152345 2:227128705-227128727 GGTGCTTGGCAGTGGGAGGAAGG - Intronic
947373974 2:229476347-229476369 GCTGAGAGGCAGGGGGAGGGCGG - Intronic
947522448 2:230857768-230857790 GGTGATGGGAAGAGGAATGAGGG + Intergenic
948044922 2:234936276-234936298 ACAGAGGGGCAGAGGGCGGAGGG - Intergenic
948189354 2:236046018-236046040 GCTGCTGGGGGGAGGTAGGAGGG + Intronic
948462640 2:238137771-238137793 GCCGATGGGTAGAGGGCTGAGGG + Intergenic
948575419 2:238946760-238946782 GCTCCTGGGCAGAAGGGGGAGGG - Intergenic
948678282 2:239611883-239611905 CCTGGTGGGCAGAAGGAGGCCGG + Intergenic
948680575 2:239631563-239631585 GTTGATGGGCTGATGGAGGTAGG + Intergenic
948751271 2:240134770-240134792 GCTGATGGGGACAGGGAGGGTGG - Intronic
948800434 2:240430928-240430950 GCAGAAGGGCAGTGGGAGGCGGG + Intergenic
1168749337 20:271075-271097 GAGGAAGGGCAGAGGGAGCAGGG + Exonic
1169068415 20:2707347-2707369 GCTTCTGGGCAGAGGGAGGCTGG + Intronic
1169251207 20:4062817-4062839 GCTGATTGGCAGGGGGTGGAGGG + Intergenic
1169398849 20:5262230-5262252 TCTGATAGGCAGTTGGAGGAGGG + Intergenic
1169941492 20:10942600-10942622 ATTGAAGAGCAGAGGGAGGAAGG - Intergenic
1169990249 20:11495270-11495292 GGTGAGAGACAGAGGGAGGAAGG + Intergenic
1170295138 20:14816180-14816202 GTTGCGGGGCAGAGGGAGGATGG + Intronic
1171227885 20:23456552-23456574 GAGGCTGGGCAGAGGCAGGAAGG - Intergenic
1171458026 20:25282839-25282861 GGTGGAGGGCAGCGGGAGGATGG + Intronic
1172168936 20:32917274-32917296 GCATATGGCCAGAGGCAGGAGGG - Intronic
1172292161 20:33784201-33784223 GGAGATGGGGAGAGGGAGGGAGG - Intronic
1172946118 20:38690783-38690805 GATGATTGGCAGATGGAGGAAGG - Intergenic
1173162697 20:40664257-40664279 GGTGATGGGGATGGGGAGGATGG - Intergenic
1173197324 20:40926446-40926468 GCTGGTGGGGAGCAGGAGGAGGG + Intergenic
1173242857 20:41313176-41313198 GCTGAAGGGGAGAGTAAGGAAGG + Intronic
1173308370 20:41873189-41873211 GCTGCTGGAGAGAGGGAGGGAGG + Intergenic
1173437624 20:43047076-43047098 TCTGAGGGGAAGAGGGAGGAGGG - Intronic
1173475572 20:43356765-43356787 GCTGGAGGGCAGAGGGAGCTTGG - Intergenic
1173483603 20:43423470-43423492 GCTGATGGGCACAGTGTGGGTGG + Intergenic
1173531295 20:43771767-43771789 GCTGATAGGCTGGGGGAAGAGGG + Intergenic
1173741668 20:45406429-45406451 CCGGCTGGGCGGAGGGAGGAAGG + Intronic
1175048011 20:56125542-56125564 GCTGATGGGCAGATAATGGAAGG + Intergenic
1175056275 20:56201496-56201518 CATCATGGGGAGAGGGAGGAAGG + Intergenic
1175159067 20:56994554-56994576 GCTGCTGGGGAGAGGGAGTGAGG + Intergenic
1175756508 20:61533575-61533597 CCTCATGGGCAGAGGAAGGCAGG - Intronic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1175790318 20:61736588-61736610 GATGAAGGGGAGAGGGAGGGAGG + Intronic
1175924058 20:62463336-62463358 GGTGATGGGCAGGGGGAGATGGG + Intergenic
1175924101 20:62463436-62463458 GGTGATGGGCAGGGGGAGATGGG + Intergenic
1175984085 20:62755507-62755529 AGTGATGGACGGAGGGAGGATGG - Intronic
1175984107 20:62755577-62755599 GATGATGGAGGGAGGGAGGATGG - Intronic
1175984143 20:62755678-62755700 GATGATGGAGGGAGGGAGGATGG - Intronic
1175984204 20:62755853-62755875 GATGATGGGTGGAGGGAGGGAGG - Intronic
1176170828 20:63695693-63695715 GGTGATGGGCTGAGGGGGAAAGG + Intronic
1176797328 21:13379925-13379947 GATGATGGGCAGCCGGAGAAAGG - Intergenic
1176816512 21:13609041-13609063 ACTGATGGGGAGATGCAGGAAGG - Intergenic
1177406257 21:20672573-20672595 GGTAATGGGCAGAGGTTGGAAGG + Intergenic
1178375960 21:32067684-32067706 GCTGGGGGGCAGAGGGAGAGAGG + Intergenic
1178467104 21:32858787-32858809 GCTCCTGGGCAGAAGGAGGTGGG - Intergenic
1179210131 21:39317466-39317488 GCTGAGGCGCAGAGGAAGTATGG + Intronic
1179437680 21:41373569-41373591 GCTGAAGGGCAGAGGGGAGTTGG - Intronic
1179496327 21:41773602-41773624 GCTGAGGGACAGAGGGAATAGGG + Intergenic
1180019276 21:45110985-45111007 GCTGATGAGCTGAGAGACGAAGG - Intronic
1180075424 21:45459279-45459301 GGTGAGGGGCAGGAGGAGGAGGG + Intronic
1180182162 21:46122965-46122987 GCAGCTGGGCAGAGGCAGGGAGG + Intronic
1180207218 21:46268498-46268520 GCAGATGGGCAGGGAGAGCAGGG + Intronic
1180655652 22:17418753-17418775 TCTGTTGGAGAGAGGGAGGACGG + Intronic
1180681912 22:17633952-17633974 GGTGGTGTGCAAAGGGAGGAGGG - Intronic
1180694268 22:17742024-17742046 GCTGGTGGCCAGAGGGAGAGAGG - Intronic
1180715758 22:17871166-17871188 CGTGATGGGCAGAGGCAGGCTGG - Intronic
1180948459 22:19709539-19709561 GCTGAGGGTCTGAGGGAGGTGGG - Intergenic
1180959369 22:19755647-19755669 GCTGATGGCGGGAGGGAGGACGG + Intergenic
1181064130 22:20297710-20297732 CCTGATGAGGAGAGGAAGGAGGG + Intergenic
1181079042 22:20401608-20401630 GCTGATGGGGATGGGGAGGCAGG + Intronic
1181164594 22:20976626-20976648 GGTGATGGGCAGGGGGTGGCAGG - Intronic
1181440632 22:22933653-22933675 ACTGAAGGGCAGAGAGAGGACGG + Intergenic
1181468330 22:23122717-23122739 GTGGATGGGCAGTGGGAAGATGG + Intronic
1181469540 22:23129242-23129264 GACAATGAGCAGAGGGAGGAAGG - Intronic
1181473867 22:23156922-23156944 GCAGATGGGAAGAGAAAGGAAGG - Intronic
1181545439 22:23599688-23599710 GCTGGAGGGCAGAGGGAGGAAGG - Intergenic
1181640009 22:24191347-24191369 GCAGAAGGGCAAAGGGAGGAAGG + Intergenic
1181704968 22:24644489-24644511 TGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1181728409 22:24827379-24827401 GCAGGTGGGGAGAGGGAGGGAGG + Intronic
1181762450 22:25067606-25067628 GGCGCAGGGCAGAGGGAGGAAGG - Intronic
1181814871 22:25430211-25430233 GCTGGAGGGCAGAGGGAGGAAGG + Intergenic
1181886246 22:26024500-26024522 GGTGATGGTCAGAGAGAGAAAGG + Intronic
1181910798 22:26236650-26236672 AGTGATGGGCAGGGAGAGGAGGG + Intronic
1182130632 22:27847839-27847861 GCTGAAGGGCAGAGCTATGATGG - Intergenic
1182148685 22:28013559-28013581 GCTGAGGGCAAGAGGGAGGTGGG + Intronic
1182243181 22:28933791-28933813 GATGAGGGGGAGGGGGAGGAGGG - Intronic
1182266512 22:29120044-29120066 GATGATGGAAACAGGGAGGAGGG + Intronic
1182266531 22:29120127-29120149 GATGATGGAAACAGGGAGGAGGG + Intronic
1182266570 22:29120295-29120317 GATGATGGAAACAGGGAGGAGGG + Intronic
1182266577 22:29120324-29120346 GATGATGGAAACAGGGAGGAGGG + Intronic
1182266604 22:29120438-29120460 GATGATGGAAACAGGGAGGAGGG + Intronic
1182266609 22:29120467-29120489 GATGATGGAAACAGGGAGGAAGG + Intronic
1182750932 22:32641640-32641662 GCTGTTGGGGTGTGGGAGGAGGG + Intronic
1182755142 22:32673228-32673250 GCTGTGGGGAAGAGGGAAGAGGG + Intronic
1182766691 22:32762681-32762703 GCTGATGGACAGAGCGAGGTGGG + Intronic
1183085366 22:35483645-35483667 GGGGAGGGACAGAGGGAGGAAGG + Intergenic
1183173933 22:36208525-36208547 GCTGATGGCCACAGGGAGCTGGG + Intergenic
1183597626 22:38822108-38822130 GCTGGTGGAAAGAGGGAGGAGGG + Exonic
1184092491 22:42299844-42299866 GCGGAGGGGAGGAGGGAGGAGGG + Intronic
1184184298 22:42854128-42854150 GATGAAGGGCAGATGCAGGACGG - Intronic
1184258520 22:43301255-43301277 GAGGATGGACAGAGGCAGGATGG - Intronic
1184293244 22:43509158-43509180 GATGATGGACGGAGGGAGGGAGG - Intergenic
1184380209 22:44140646-44140668 GATGAGGAGCAGAGAGAGGAAGG - Intronic
1184412911 22:44336289-44336311 GGTGAAGGGCGGAGGGAGGGAGG - Intergenic
1184414731 22:44345646-44345668 GATGATGGGCGGATGGATGATGG + Intergenic
1184507675 22:44914101-44914123 GGTGAGGGGCACAGGGAGGAAGG + Intronic
1184552750 22:45213287-45213309 ACTGTTGGGCAGAGGGCTGAGGG - Intronic
1184696375 22:46141406-46141428 GCTGAGGGGCAGAGGCAGGGAGG + Intergenic
1185193439 22:49453132-49453154 GTGGATGGGCAGATGGATGATGG + Intronic
1185193478 22:49453345-49453367 GTGGATGGGCAGATGGATGATGG + Intronic
949405056 3:3705444-3705466 GGAGAGGGGCAAAGGGAGGAAGG + Intronic
949419225 3:3847840-3847862 CCTAATGGGCAGTGGGAGGGTGG + Intronic
950453100 3:13076509-13076531 GCATTTGGGAAGAGGGAGGACGG + Intergenic
951821589 3:26819846-26819868 GCACTTGGGCAGAGGGAGGTTGG - Intergenic
952165101 3:30739322-30739344 GAGGATGGGCACAGGAAGGAGGG - Intronic
952766370 3:36957364-36957386 ACTTATGGGGGGAGGGAGGAGGG + Intergenic
952822572 3:37498050-37498072 GCTGTGGGGTAGAGGAAGGAGGG + Intronic
953203757 3:40801586-40801608 GGGTATGGGCAGAGGAAGGAAGG + Intergenic
953384772 3:42500316-42500338 GCTGGTGGGCAGGGTGGGGAGGG - Intronic
953408696 3:42675196-42675218 GCTGTGGGCAAGAGGGAGGAGGG - Intergenic
953430498 3:42835882-42835904 TCGGGTGGGCAGAAGGAGGAAGG - Intronic
953842499 3:46400455-46400477 GCTGATAGTCAGAGGCTGGAAGG + Intergenic
954163855 3:48740514-48740536 GCAGTTCTGCAGAGGGAGGAAGG + Intergenic
954575872 3:51675941-51675963 GCTGAAGGGCAGGTGGAGGAGGG + Intronic
954580320 3:51699689-51699711 TATGCTTGGCAGAGGGAGGAAGG + Intronic
954781399 3:53064530-53064552 GCTGATGGGCAGTGGAAGAAGGG - Intronic
955429572 3:58828643-58828665 GCTAAAGGAGAGAGGGAGGAAGG + Intronic
956142342 3:66158738-66158760 GTAGAGGGGCAGAGGGAAGAAGG + Intronic
956468672 3:69542720-69542742 GGGGAGGGGGAGAGGGAGGAAGG + Intergenic
956494994 3:69815402-69815424 GCTGAGGGGGAGAAGGAAGAGGG - Intronic
956587604 3:70881112-70881134 GGTGATGGGCAGAGGGGTGATGG + Intergenic
956621331 3:71223914-71223936 GCTCATGGGCAATGGAAGGATGG + Intronic
957024504 3:75166133-75166155 GCTGATTGGAAGTGGGAGTAAGG + Intergenic
957426996 3:80051677-80051699 GCTCCTGGGCAGAAGGAGGCTGG + Intergenic
957835128 3:85577449-85577471 GCTGCATGGCAGAAGGAGGAAGG - Intronic
958192018 3:90195807-90195829 GGTGGTGGGGAGAGGGGGGAGGG - Intergenic
958708084 3:97681843-97681865 ACTGATTGGGAGAGGGATGAAGG + Intronic
958876952 3:99627336-99627358 TCTGATGGGGACAGGCAGGATGG - Intergenic
958905349 3:99935955-99935977 GCTGAGGGGCTGCTGGAGGAAGG - Intronic
960145049 3:114192003-114192025 GCTCAATGGCAGAGAGAGGAGGG + Intronic
960975492 3:123169836-123169858 GTTGACCGGCAGAGGGAGGGAGG + Intronic
961459732 3:127042754-127042776 CCAGAGGGGCAGGGGGAGGAGGG - Intergenic
961509436 3:127391965-127391987 GCTGGAGGGCAGAGGGCGGGCGG + Intergenic
962310467 3:134323357-134323379 GGTGATGGGGATAGTGAGGAGGG + Intergenic
962600022 3:136984638-136984660 GCTGAAGAGCAGAGGAGGGAAGG + Intronic
962760050 3:138503190-138503212 GGTGATGGCTAGAGGGAGGAGGG - Intronic
962899594 3:139747735-139747757 GCTGATTGTCAGGGAGAGGATGG + Intergenic
962961478 3:140315110-140315132 GCTGATGAGGGAAGGGAGGATGG + Intronic
963124130 3:141799196-141799218 GCAAATGGGGAGAGGGAAGAAGG + Intronic
964526022 3:157616044-157616066 CCTGATGGAGACAGGGAGGAAGG + Intronic
964662407 3:159135023-159135045 GCTGATGGGAATAGGAAGGCTGG + Intronic
965231106 3:166054016-166054038 GCTAAAGGTTAGAGGGAGGAAGG - Intergenic
966851741 3:184169022-184169044 GCTGCTGGGCAGGGTGAGTAGGG - Intronic
966905091 3:184516839-184516861 ACTGGTGGGCAGAGGGAGGAAGG + Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967985620 3:195093824-195093846 GGAGAAGGGCAGCGGGAGGACGG - Intronic
968080019 3:195839599-195839621 GCTGAAGGGCGAGGGGAGGAGGG - Intergenic
968335879 3:197913150-197913172 GCAGATGGGAAGAGGGAAGCAGG - Intronic
968384950 4:127507-127529 GCATTTGGGCAAAGGGAGGAGGG - Intronic
968427673 4:534320-534342 GCTGGTGGCCAGATGGAGGGCGG + Intronic
968479134 4:826127-826149 GCTGAAGGGCACCGCGAGGAGGG + Exonic
968889247 4:3359087-3359109 GGTGAGGAGGAGAGGGAGGAGGG - Intronic
968903551 4:3441965-3441987 CCTGAGGGGCAGTGGGAGGCGGG - Exonic
968912062 4:3481406-3481428 GGTGATGGACAAGGGGAGGAGGG + Intronic
968951911 4:3699817-3699839 ACTGAGGGGCAGAGGCAAGAGGG + Intergenic
968985547 4:3872563-3872585 GCAGAGAGACAGAGGGAGGATGG + Intergenic
969043070 4:4316231-4316253 CCAGATGGGAAGAGGGAGGGTGG + Intronic
969102437 4:4779162-4779184 GCTGATGCGCTGAGGGATGGAGG - Intergenic
969291553 4:6243244-6243266 GCTGTTGGGCAGTGGGGGGCTGG + Intergenic
969399296 4:6943325-6943347 GGAGAGGGGCAGAGGGAGGAAGG - Intronic
969457080 4:7306295-7306317 GTTGATGGTCCGAGGGTGGAGGG + Intronic
969630170 4:8331254-8331276 GCAGAAGGCCAGAGGAAGGAAGG + Intergenic
969848398 4:9937584-9937606 GGAGCTGGGCAGAGGGAGGTGGG - Intronic
970410291 4:15799868-15799890 GCTCAGGCACAGAGGGAGGAGGG + Intronic
970671647 4:18403607-18403629 CCTCATGGGCATAGGGAGGTTGG - Intergenic
971218737 4:24685838-24685860 GCTGGTGGGGAAAGTGAGGAGGG + Intergenic
971325313 4:25638670-25638692 TGTGAGGGGCAGAGGGGGGAAGG + Intergenic
972330784 4:38062877-38062899 GCTGAGGGGAAGAGGGCTGAGGG + Intronic
972531094 4:39962167-39962189 GCTGCTGGGCAGGTGGAGGCAGG - Intronic
972639391 4:40911886-40911908 GTGTAGGGGCAGAGGGAGGAGGG - Intronic
972997143 4:44894721-44894743 GCAGATGGGCAGAGAGAATATGG + Intergenic
975812177 4:78181127-78181149 GCTGATGGGCAGTGGAAGAAGGG - Intronic
976443262 4:85101668-85101690 GCTGAAGTGCAAAGTGAGGATGG + Intergenic
976613081 4:87049756-87049778 GCTGTTGGTGAGTGGGAGGATGG + Intronic
976781292 4:88761521-88761543 GCTGGAGGGGTGAGGGAGGACGG + Intronic
977033882 4:91924826-91924848 GCTGAGGGGCAGGTGGAGGGTGG + Intergenic
978543070 4:109839607-109839629 GTTGAAGGGTAGAGGGAGGGAGG - Intronic
978637352 4:110825178-110825200 ACTGGTGGGTAGAGAGAGGAGGG - Intergenic
979873739 4:125860894-125860916 GATGATGGGCATAGAAAGGAGGG + Intergenic
981659538 4:147149237-147149259 GCAGAGGGGCAGAGGGAAGTTGG - Intergenic
981880446 4:149604864-149604886 GGTGATGGGGGGTGGGAGGAGGG + Intergenic
981901479 4:149870204-149870226 GCAGATGTACAGAGGGAAGACGG - Intergenic
981947585 4:150366548-150366570 GCTGGTGGACAGTGAGAGGAGGG + Intronic
982764908 4:159335198-159335220 GGTGATGTGCATAGAGAGGAAGG + Intronic
982791728 4:159600011-159600033 GCTGAGGGGCAGAGGTAAGAAGG - Intergenic
984463065 4:180059453-180059475 GCTGATGGGAACCGAGAGGAGGG + Intergenic
984709362 4:182872260-182872282 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
984888975 4:184474634-184474656 GAGGAAGGGCGGAGGGAGGAGGG - Intergenic
985223390 4:187732042-187732064 GCTGAGGGGGAGGAGGAGGACGG - Intergenic
985487126 5:158192-158214 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487145 5:158233-158255 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487236 5:158510-158532 TGGGATGGGCAGAGGGAGGAGGG - Intronic
985487255 5:158552-158574 CAGGACGGGCAGAGGGAGGAGGG - Intronic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985676246 5:1232688-1232710 GCTTCTGGGCAGAGGGAGCTGGG + Intronic
985818163 5:2141937-2141959 GCGGATGAGCAGATGGAGGCAGG + Intergenic
985839572 5:2296075-2296097 TATGATGGGCAGAGAGGGGAAGG + Intergenic
985920384 5:2966710-2966732 GCTGATGGGCAGGGAAAGGTGGG + Intergenic
986059116 5:4171325-4171347 GCTGAAGGGAAGACAGAGGATGG + Intergenic
986439174 5:7763574-7763596 GGGGCTGGGGAGAGGGAGGATGG - Intronic
986636103 5:9823717-9823739 ACAGATGGACGGAGGGAGGAAGG + Intergenic
986670571 5:10139530-10139552 GGTGGAGAGCAGAGGGAGGAAGG + Intergenic
986798430 5:11234818-11234840 GATGTGGGGCAGAGGAAGGAAGG - Intronic
986986563 5:13506939-13506961 GCAGATTTGCACAGGGAGGAGGG + Intergenic
987194395 5:15511005-15511027 GGTGATGGGCAGGGTGAGGAGGG - Intronic
988010569 5:25476511-25476533 GCTGTGGGGTAGGGGGAGGAGGG + Intergenic
988629672 5:32915304-32915326 GCTGAGGGGCAGAAGGTAGATGG - Intergenic
989130294 5:38100443-38100465 GCTGATGGGAAAGGGGAGGCTGG + Intergenic
989609101 5:43274333-43274355 TATGATGGCCACAGGGAGGATGG + Intronic
990570223 5:57071036-57071058 GCTTTTAGGCAGATGGAGGAAGG + Intergenic
991048237 5:62245262-62245284 ACTGATGGGCAGAAGGCAGAAGG - Intergenic
991085726 5:62646916-62646938 GCTGTGTGGCAGAGGGAGGAAGG - Intergenic
991214322 5:64144759-64144781 GCTGGTGATCAGAGGGTGGAAGG - Intergenic
991987870 5:72308406-72308428 GCTGATTGGGGGACGGAGGAGGG - Intronic
992270978 5:75062615-75062637 ACAGATGGGCAAAGAGAGGAGGG + Intergenic
992987789 5:82251244-82251266 GCTGAGGGGTAGAGGCAGCAAGG + Intronic
993191235 5:84684576-84684598 TTTGAGGGGTAGAGGGAGGAAGG + Intergenic
994204827 5:97023062-97023084 GCTGGTGGGGAGAGGGAGTGAGG - Intronic
994572698 5:101534851-101534873 TCTGATGGGCTGCTGGAGGAGGG + Intergenic
995478887 5:112575876-112575898 GGTGAGGGACAGAGGGAGAAGGG - Intergenic
995548209 5:113253575-113253597 GCAGATGAGCACAAGGAGGAGGG + Intronic
996147511 5:119993862-119993884 GCTGATCTGCAGAGAAAGGAGGG - Intergenic
996176705 5:120368398-120368420 GCTGATGAGCTCAGGGAGGGAGG + Intergenic
996616703 5:125450626-125450648 ATTGAAGAGCAGAGGGAGGAAGG + Intergenic
996708774 5:126523403-126523425 TCTGATGCACAGAGAGAGGATGG - Intergenic
996900631 5:128538434-128538456 GGTGAGGGGAAGAGGAAGGAAGG + Intronic
997579892 5:135010628-135010650 GCTGATGGGCAGTGGGTGGGTGG + Intronic
997645545 5:135479249-135479271 GCTGGTGGGCAGAATGAGGCAGG - Intergenic
997716157 5:136044508-136044530 GCCGATGGGATGTGGGAGGAGGG + Intronic
997824002 5:137090402-137090424 TGTGATCTGCAGAGGGAGGAAGG - Intronic
997830580 5:137146241-137146263 GTTCCTGGGGAGAGGGAGGAAGG - Intronic
998733065 5:145103375-145103397 AGTGATGGGCAGGGGGAGGTCGG + Intergenic
998819398 5:146044653-146044675 GCAGAGGGACAGAGGGAGGAAGG - Intronic
999080341 5:148837619-148837641 GCTGCTGTGCAGAGAAAGGAAGG + Intergenic
999290501 5:150422337-150422359 CCTGATGGGGAGATGGAGTAAGG + Intergenic
999462724 5:151771176-151771198 GCTGCGGGGCAGAGGAAGGAGGG - Intronic
999516470 5:152306913-152306935 GCAGAAGGGCAAAGAGAGGAGGG + Intergenic
999656470 5:153815511-153815533 GGAGAGGGGAAGAGGGAGGAAGG + Intergenic
1000272820 5:159702741-159702763 GCAGGTGGGCAGGGGGAGGGAGG + Intergenic
1000289547 5:159857898-159857920 GTCCATGGTCAGAGGGAGGAAGG - Intergenic
1000293369 5:159891700-159891722 GCTGAAGACCTGAGGGAGGAGGG - Intergenic
1000822955 5:166007993-166008015 GCTGGAGGGCAGAGGGAAGAGGG - Intergenic
1000833605 5:166131118-166131140 TCTAATGGGCTGAGGAAGGAGGG + Intergenic
1001028501 5:168244535-168244557 GCTGCTGGGCAGCCAGAGGAAGG - Exonic
1001163952 5:169346644-169346666 TCTAAGGGGCAGAGGGAGAAGGG - Intergenic
1001863850 5:175085439-175085461 GTTGAGGGGTAGAGGGAGGGGGG - Intergenic
1001971194 5:175956392-175956414 GCTGGAGGGAAGAGGGAGGGAGG - Intronic
1002151790 5:177239618-177239640 TCTTATGGGAAGAGGCAGGATGG - Intronic
1002241433 5:177844653-177844675 GCAAATGGGAAGAGGGAGCAAGG - Intergenic
1002246248 5:177887385-177887407 GCTGGAGGGAAGAGGGAGGGAGG + Intergenic
1002575678 5:180172457-180172479 GCTGAGGGGCAGAGGGACAGGGG + Intronic
1002911639 6:1495342-1495364 GCTGATGGGGATAGGGATGTGGG - Intergenic
1003980097 6:11381249-11381271 GCTTCTGGGCAGGGGAAGGAGGG + Intronic
1004196967 6:13513931-13513953 GCTGCTGGGCAAAGGGAAGTAGG + Intergenic
1004492342 6:16128981-16129003 GCTGATCGGGCGGGGGAGGAGGG + Intergenic
1004498525 6:16187541-16187563 GCTGATGGGTTGAGGGCAGAAGG - Intergenic
1004562243 6:16761536-16761558 GCGGGCGGGCGGAGGGAGGAGGG - Intergenic
1005599027 6:27407422-27407444 GCAGATGGGCAGGGGGAGCCGGG - Intergenic
1005821908 6:29605757-29605779 GGTGAAGGGCAGAGAGGGGATGG - Intronic
1006101369 6:31688171-31688193 TCTGGTGGGCAGAGGTAGAAGGG + Intronic
1006150399 6:31983945-31983967 GCTGGTGGGCAGAGGTGGGGAGG - Intronic
1006156700 6:32016683-32016705 GCTGGTGGGCAGAGGTGGGGAGG - Intronic
1006162452 6:32046453-32046475 GGAGCTGTGCAGAGGGAGGAGGG + Intronic
1006338261 6:33432044-33432066 GCTGAGGGGCAGAGGGAGGTGGG + Intronic
1006371926 6:33650150-33650172 GCTGAAGGGCAGAGAGAAGGAGG - Intronic
1006378967 6:33686982-33687004 GTGGAGGGGCAGAGGGAGGCAGG - Intronic
1006404709 6:33838196-33838218 GTTTGCGGGCAGAGGGAGGAGGG + Intergenic
1006502173 6:34466078-34466100 GCTGAGGCGGAGAGGGGGGAAGG - Exonic
1006623131 6:35381094-35381116 GATGAGGGACAGAGGCAGGAGGG - Intronic
1006822314 6:36907073-36907095 GAAGTTGGGGAGAGGGAGGAAGG - Intronic
1006898717 6:37486559-37486581 GCTGCAGGGCAGGGGGTGGATGG - Intronic
1007095090 6:39208062-39208084 GCACAGGGGGAGAGGGAGGAGGG - Intronic
1007217024 6:40248332-40248354 GAGAATGGGCAAAGGGAGGAAGG - Intergenic
1007292745 6:40799589-40799611 TCTGAAGGGAAGAGGGAGGGAGG - Intergenic
1007382174 6:41497517-41497539 GCTGGAGGGCAGAGAGAGGTGGG - Intergenic
1007396126 6:41578820-41578842 GCTGCTGGGCAGAGGGGGAGGGG - Intronic
1007415576 6:41689426-41689448 GCGAAGGGGCAGAGGGAGGCAGG - Intronic
1007442944 6:41879589-41879611 GCTGCTGGGCAGAGGATGGGAGG + Intronic
1007652883 6:43434108-43434130 GCTAATGGGCCCAGGGAAGATGG - Intronic
1007741022 6:44009574-44009596 GAGGAAGGGAAGAGGGAGGAAGG + Intergenic
1009562368 6:65263791-65263813 CTTGATAGGCAGAGGCAGGACGG + Intronic
1009890753 6:69678312-69678334 GCTGATGGGAAGGGGAAGGATGG + Intronic
1009893321 6:69715769-69715791 ACTGGAGGGCAGAGGGTGGAAGG - Intronic
1010921013 6:81680637-81680659 GCTAGAGGACAGAGGGAGGAAGG + Intronic
1011096668 6:83673760-83673782 TCTGATGGGCAGAGAAGGGATGG - Intronic
1011429153 6:87266818-87266840 GGAGATGGGCAGTGGGGGGATGG - Intergenic
1011525813 6:88263763-88263785 GCTGCAGGGCAGAAGGAGGGAGG + Intergenic
1011563938 6:88654589-88654611 GTTACTGGGAAGAGGGAGGAAGG - Intronic
1012178399 6:96119684-96119706 GCAGATGGGCATAGTGATGAAGG - Intronic
1016312123 6:142745538-142745560 TGTGATTGGCAGAGGGAGGAGGG + Intergenic
1016515861 6:144892630-144892652 GCTGATGGGCTGGGGGTGGTGGG + Intergenic
1017234265 6:152103398-152103420 GGTGTTGGGCAGAGGGAGTGAGG - Intronic
1017622860 6:156317072-156317094 ACTGATGGGAAGAGAGAGGCAGG + Intergenic
1018677562 6:166236117-166236139 GCTGGTGGGCAGGGGGTGGGGGG - Intergenic
1018736448 6:166690107-166690129 GCTGAGGGGTGGAGGGAGGAGGG + Intronic
1018846573 6:167561027-167561049 ACTGAGGCACAGAGGGAGGAAGG - Intergenic
1018867734 6:167758941-167758963 GACGGGGGGCAGAGGGAGGAGGG - Intergenic
1019165297 6:170094389-170094411 GCTGATGGGCAGAGCTCGGACGG - Intergenic
1019165313 6:170094466-170094488 GCTGATGGGCAGAGCTCGGAGGG - Intergenic
1019165330 6:170094543-170094565 GCTGATGGGCAGAGCTCGGATGG - Intergenic
1019404706 7:877351-877373 GACGAGGGGCAGGGGGAGGACGG - Intronic
1019415617 7:925438-925460 GCCGGAGGGAAGAGGGAGGAGGG - Intronic
1019776108 7:2912983-2913005 GGTGATGGGGAGGAGGAGGAGGG + Intronic
1020315762 7:6904376-6904398 GTTGATGGACAGAGAGAGGTTGG - Intergenic
1021135017 7:16954975-16954997 GTGGATGGGAAGAGGGTGGATGG - Intergenic
1021297614 7:18927834-18927856 GCTGAATGGCAGAGTGAGGATGG + Intronic
1022180295 7:27912551-27912573 GGTGATGCAGAGAGGGAGGAAGG + Intronic
1022250827 7:28606538-28606560 ACTGAGAGGCAGAGGGAAGATGG - Intronic
1022290812 7:29000840-29000862 GCTGATGGGGAGAGGGGGAGTGG - Intronic
1022485391 7:30773662-30773684 GCAGGGTGGCAGAGGGAGGATGG - Intronic
1022831853 7:34075645-34075667 CGTGATAGGCAGAGGGAGGGAGG - Intronic
1022842847 7:34181171-34181193 GATAATAGGCAGAGGCAGGAAGG + Intergenic
1023821499 7:43983105-43983127 GCTGATGGGCAGGTAGGGGAGGG - Intergenic
1023940754 7:44767207-44767229 GCTGATGCACAGAGGGAGTGTGG + Intronic
1023965570 7:44961736-44961758 GCTGAGGGGCTGAGGGCTGAGGG + Intergenic
1023965598 7:44961832-44961854 GCTGAGGGGCTGAGGGCTGAGGG + Intergenic
1024054335 7:45649987-45650009 GATGCTGGGCAGAAGCAGGAAGG + Intronic
1024695996 7:51857260-51857282 GGTGTTGGGCAGAGGCAGGGAGG + Intergenic
1025212220 7:57026270-57026292 GGTGAGCTGCAGAGGGAGGATGG + Intergenic
1025659734 7:63550558-63550580 GGTGAGCTGCAGAGGGAGGATGG - Intergenic
1026236063 7:68528355-68528377 GGTGATGGGGACAGGGATGAAGG + Intergenic
1027052433 7:75028669-75028691 GACGACGGGCTGAGGGAGGAAGG - Intronic
1027539178 7:79446159-79446181 CCTGTTGTGCAGTGGGAGGAGGG + Intronic
1028157364 7:87446719-87446741 ACTCAACGGCAGAGGGAGGATGG + Intronic
1029015481 7:97311577-97311599 GGTCCTGGGCAGAGGGAGCATGG + Intergenic
1029148635 7:98464693-98464715 GCTGGTGAGCACAGGGAGGCAGG + Intergenic
1029675399 7:102065036-102065058 GGTGAGCTGCAGAGGGAGGATGG + Intronic
1029685835 7:102147321-102147343 GCTGATGGGGAAGGGGAGGAGGG - Intronic
1029749761 7:102536526-102536548 GCTGATGGGCAGGTAGGGGAGGG - Intergenic
1029767711 7:102635631-102635653 GCTGATGGGCAGGTAGGGGAGGG - Intronic
1031074484 7:117199565-117199587 GCTGATGGACAGCAGCAGGAAGG - Intronic
1031427309 7:121621363-121621385 CCAGCTGTGCAGAGGGAGGACGG - Intergenic
1031836435 7:126685803-126685825 GCTCCTGGGCAGAAGGGGGAAGG + Intronic
1032695755 7:134334836-134334858 GGGGATGGGCAGGGGGAGGTGGG - Intergenic
1033024035 7:137755402-137755424 GTTTAAGGGCAGAGGGAGGAGGG + Intronic
1033216192 7:139495369-139495391 GCTGATGGGTAGAGAGAGTCTGG - Intergenic
1033666562 7:143446280-143446302 GCTGGTGGGAAGAGGAGGGAGGG - Intergenic
1033955231 7:146839686-146839708 GAAGATGGGCAGAGGTAAGATGG - Intronic
1034198251 7:149264371-149264393 GCTGATGTGAAGTTGGAGGAGGG + Intronic
1034296161 7:149974006-149974028 GATGATGGCCAGAGGGGGAAGGG + Intergenic
1034420859 7:150989905-150989927 GCTGAGGGTCACAGGGAGGATGG - Intergenic
1034422223 7:150996031-150996053 GGGTAGGGGCAGAGGGAGGAGGG - Intronic
1034422249 7:150996097-150996119 GGGTAGGGGCAGAGGGAGGAGGG - Intronic
1034809870 7:154122803-154122825 GATGATGGCCAGAGGGGGAAGGG - Intronic
1035587133 8:785458-785480 GCTGAGGGGAGGAGGGAGGCCGG - Intergenic
1036057915 8:5280376-5280398 CCTGAATGTCAGAGGGAGGAGGG - Intergenic
1036463483 8:8974710-8974732 GGTGAAGGGGAAAGGGAGGAGGG - Intergenic
1036517227 8:9455513-9455535 ACTACTGGGGAGAGGGAGGAGGG + Intergenic
1036635540 8:10547705-10547727 GGGGAAGGGGAGAGGGAGGAAGG - Intronic
1037768801 8:21787372-21787394 GCTGGTGGGAAGAGGCGGGAGGG - Intronic
1037773886 8:21820017-21820039 GCTGATGGGGAGCGGGTTGAGGG - Intergenic
1038332040 8:26616728-26616750 GCAGGAGGGAAGAGGGAGGATGG - Intronic
1038426655 8:27468324-27468346 GCTGAGGGCCAGAGGGAAGCAGG - Intronic
1038671373 8:29585764-29585786 GGTGATGGGAAGATGGAGGCAGG + Intergenic
1038676944 8:29631464-29631486 GCTGAGAGGCCGAGGGAGGCAGG + Intergenic
1039382943 8:37102856-37102878 GGGGTTGGGGAGAGGGAGGATGG - Intergenic
1039401675 8:37275179-37275201 GCTGCTGGGCAGAGCCAGGCAGG + Intergenic
1039443546 8:37612345-37612367 GCCCATGGGGAGAAGGAGGAAGG + Intergenic
1039454035 8:37696336-37696358 GCTGGCGGGCTGAGTGAGGAGGG + Intronic
1039984546 8:42436569-42436591 GCCGATGGACACAGGAAGGAAGG - Intronic
1040050589 8:43009818-43009840 GCGGCTGGGGAGAGGAAGGAAGG - Intronic
1040727341 8:50398278-50398300 TATGATGGGCAGATGGTGGACGG - Intronic
1041172288 8:55156419-55156441 GGGGGTGGGGAGAGGGAGGAAGG + Intronic
1041882749 8:62770890-62770912 GCTGGTGGGCGGGGGGTGGAGGG + Intronic
1043510695 8:80947399-80947421 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
1043827651 8:84948717-84948739 GATGATGGGCATAGGGCAGAAGG + Intergenic
1045224640 8:100232502-100232524 GCTGACTGGAAGAGGGAGGTAGG - Intronic
1045297848 8:100887981-100888003 AATGAAGGGCAGAGAGAGGAAGG + Intergenic
1046097792 8:109580840-109580862 GCTGTAGTACAGAGGGAGGAGGG - Intronic
1046622949 8:116547170-116547192 GCTGATGGGCTGTGAGAGAAAGG + Intergenic
1046827616 8:118708804-118708826 GCTGATGGGCAAGGGATGGAGGG - Intergenic
1047009463 8:120655517-120655539 ACTAATGGGAAGAGGCAGGATGG - Intronic
1047224976 8:122948343-122948365 GCTGATGGGCTAAAGGAGGTGGG - Intronic
1047306769 8:123659022-123659044 GATGATGGATGGAGGGAGGATGG - Intergenic
1047343915 8:124009209-124009231 GCTGGAGTGCAGAAGGAGGATGG - Intronic
1047346918 8:124037796-124037818 CCTGATTGGCAGGGTGAGGAGGG - Intronic
1048274459 8:133055803-133055825 GGTGATGAGGAGGGGGAGGAAGG - Intronic
1048280001 8:133098672-133098694 GCTGATGGGGCTAGGGAGGAGGG + Intronic
1048291893 8:133187446-133187468 ACGGATGGGCAGAGGGATGGAGG - Intergenic
1048426581 8:134329125-134329147 GCTGAGGGTCAGAGGAAGAAAGG - Intergenic
1048436083 8:134419164-134419186 GAGGATGGACAGTGGGAGGAGGG + Intergenic
1048571162 8:135658002-135658024 GCTGATGGGCAGATGGGAGGAGG + Intergenic
1049032233 8:140046459-140046481 GCTGCTGGAGACAGGGAGGAAGG - Intronic
1049049846 8:140185770-140185792 GCTGATGGGGAGATGGGGAAGGG + Intronic
1049097789 8:140558948-140558970 GCTGATGGGCAGAAGGACCCCGG + Intronic
1049203585 8:141353178-141353200 TCTGATGGGCAGGGGATGGAGGG - Intergenic
1049344630 8:142131895-142131917 GCTGCTGGGCACAGGAGGGAAGG - Intergenic
1049358018 8:142198329-142198351 GCTGCTGGGCTGGGGCAGGAAGG + Intergenic
1049371973 8:142272301-142272323 GTGGATGGGTAGATGGAGGAAGG - Intronic
1049431791 8:142568757-142568779 GCAGATGGGCAAGGGCAGGAAGG - Intergenic
1049851232 8:144831901-144831923 GCTACTGGGGAGAGCGAGGAGGG + Intronic
1050829523 9:9992800-9992822 GGGGATGGGGAGAGGGGGGAGGG + Intronic
1051589036 9:18757514-18757536 ACAGATGCGCAGAGGGATGAAGG - Intronic
1053130864 9:35614915-35614937 GCTGATGGGAAGAGAGAAAAAGG + Intronic
1053442992 9:38131093-38131115 GCTCAAGGGCAGAGGAAGGGAGG - Intergenic
1055217517 9:73884395-73884417 GATGAGGGGCAGAGCGAGGTAGG - Intergenic
1055857440 9:80707232-80707254 TCTGGTGGGAAGAGGGAGGCTGG - Intergenic
1056472041 9:86915073-86915095 GGTGATGGGGAGAGGATGGAAGG + Intergenic
1056599434 9:88035133-88035155 GCTGCTGGCCAGAGCTAGGAGGG + Intergenic
1057020773 9:91696036-91696058 GCTGGTGGGCAGAGGGACCTGGG - Intronic
1057214186 9:93219040-93219062 GCTGAGGGGCAGAGGGACACAGG - Intronic
1057319038 9:93995228-93995250 GCAGATGTGCAGAGGGATCAGGG + Intergenic
1057380173 9:94560246-94560268 GCTGCTGTTCAGAGGAAGGAAGG + Intronic
1057964196 9:99487599-99487621 GCTGACCGGCACAGGGTGGAAGG - Intergenic
1058354424 9:104066071-104066093 GCTGAGGTGCAGAAGGATGAAGG - Intergenic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1058669705 9:107350541-107350563 GGTGGTGGGCAGATGGAGGGTGG - Intergenic
1058680792 9:107438606-107438628 GGTGCTGGGTAGAGGGATGAAGG - Intergenic
1058791778 9:108454135-108454157 GATGATGGGCACAGGGGGCAGGG - Intergenic
1059341918 9:113602154-113602176 CCTGCGGGGCAGAGGGAGGGAGG + Intergenic
1059535256 9:115074659-115074681 GCAGAGGGGCAAAGGGAGGGAGG + Intronic
1059713073 9:116887404-116887426 GCTTTTGGACAGAGGGAGAAAGG + Intronic
1059729566 9:117043508-117043530 GCTGAGGGGCACAGGTAGAATGG + Intronic
1059803680 9:117775675-117775697 GCTGAATGGAAGAGGAAGGAAGG - Intergenic
1059933258 9:119282496-119282518 GAAGAAGGACAGAGGGAGGAGGG + Intronic
1061257345 9:129460422-129460444 GCGGGAGGGCGGAGGGAGGAAGG - Intergenic
1061390605 9:130315315-130315337 GGGGGAGGGCAGAGGGAGGAGGG - Intronic
1061395784 9:130342715-130342737 GCTGATGGGCACAGGGGGGCAGG - Intronic
1061843240 9:133372426-133372448 TCAGATGGGCAGAGGGAGGTTGG - Intronic
1061917471 9:133762830-133762852 GCAGCTGGCCAGAGGGAGAAGGG + Exonic
1061955172 9:133957537-133957559 GCTGCAGGGCAGGGCGAGGAGGG + Intronic
1061964066 9:134003373-134003395 GTGGATGGGTAGAGGGTGGATGG - Intergenic
1062002842 9:134225457-134225479 TCTGCTGGGCAGTGGGAGGTGGG + Intergenic
1062121580 9:134836676-134836698 GATGCTGGGCAGGGGGAGGCGGG - Intronic
1062139115 9:134945687-134945709 GGTGGAGGGCAGAGGGCGGAGGG + Intergenic
1062447879 9:136603288-136603310 CCTGGGGGGCAGAGGGAGGTTGG + Intergenic
1062520757 9:136956959-136956981 GATGATGGGTAGATGGTGGATGG + Intronic
1062520780 9:136957047-136957069 GATGATGGGTAGATGGTGGATGG + Intronic
1062571975 9:137189932-137189954 GCTGAGGGGCACACGGAGGCAGG - Exonic
1062610999 9:137373372-137373394 GCTGAGGGGCAGGGGCAGGAAGG + Intronic
1203530845 Un_GL000213v1:140426-140448 ACTGATGGGGAGATGCAGGAAGG + Intergenic
1185603856 X:1355785-1355807 GCAGGTGGGCAGAGGGGGCATGG + Intronic
1185612143 X:1399075-1399097 GCTGATGTGGGAAGGGAGGAAGG + Intergenic
1185632220 X:1523511-1523533 TGTGATTGCCAGAGGGAGGAGGG + Intronic
1186011494 X:5139050-5139072 GAAGATGGGCAGAGGGGAGAAGG + Intergenic
1186024145 X:5290333-5290355 GCTTATTGGAAGATGGAGGATGG + Intergenic
1186797114 X:13057772-13057794 GCTGTTGGCCATGGGGAGGATGG - Intergenic
1186863595 X:13696796-13696818 AGTGATGGGCAGAGTGAGGTTGG + Intronic
1187074067 X:15916501-15916523 GGAGATGGGGAGAGGGAGGAGGG - Intergenic
1187572096 X:20515139-20515161 GCCACTGGGCAGAGGTAGGATGG - Intergenic
1188422202 X:30003862-30003884 GGTGGTGGGGACAGGGAGGAGGG - Intergenic
1188598275 X:31928245-31928267 GCGGATGGGAAGAGAGAGAAAGG + Intronic
1188637455 X:32452088-32452110 GCTCATAGGGAGAGGGAAGAGGG + Intronic
1188938666 X:36209897-36209919 GCTGATGGGATGGTGGAGGATGG - Intergenic
1189008411 X:37019088-37019110 GGTGGTGGACAGTGGGAGGAGGG + Intergenic
1189889637 X:45586902-45586924 GATGATGGGAAAAGGGAGGATGG - Intergenic
1190244680 X:48683536-48683558 GCTGCCAGCCAGAGGGAGGAGGG + Intronic
1190290776 X:48990801-48990823 GCTGATGGGGTGAGGGAGGCAGG - Intronic
1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG + Intergenic
1192160728 X:68784785-68784807 GCTGATGGGCAGTGGAAGAAGGG + Intergenic
1192165165 X:68823499-68823521 GCTGAGGGGCAGCTGGAGGGTGG + Intergenic
1192181737 X:68920505-68920527 GTTGAAGGAGAGAGGGAGGAAGG - Intergenic
1192326014 X:70133174-70133196 GCTGAAGGGCACAGGGTGGAAGG + Intergenic
1192539548 X:71956629-71956651 GCTGATGGTCAGAGTGATGTCGG + Intergenic
1192935117 X:75850823-75850845 GCTGGTGGGAAAAGGGAGGTAGG + Intergenic
1193629601 X:83866519-83866541 GCAAATGGACAGAGAGAGGAAGG - Intronic
1193743780 X:85249861-85249883 GCTGGTGGGGAGAGGCAGAATGG - Intronic
1195672661 X:107482890-107482912 GTTGATGGGCAGAAGGAACAGGG + Intergenic
1195705564 X:107735698-107735720 GCTGAGGGGAAGAAGGAGAAGGG - Intronic
1196016379 X:110944546-110944568 GCTGCTGGGCAGGAGGAGCAGGG - Intronic
1196628285 X:117904390-117904412 TCTGATGGGAAGAGGGAGTAAGG + Intronic
1197147496 X:123185489-123185511 GCGGATGGGCGGGGGGCGGAGGG + Intronic
1197771979 X:130094962-130094984 GCTGGTGGGCCGAGGGTGGTGGG + Intronic
1197841311 X:130750046-130750068 GCAGACAGGCAGAGGGAGGAAGG - Intronic
1198276117 X:135097654-135097676 GTCGGTGGGCATAGGGAGGACGG - Intergenic
1198310396 X:135423086-135423108 GTCGGTGGGCATAGGGAGGACGG + Intergenic
1198479368 X:137027007-137027029 GCTGATGGCAAGAGGTAGGCAGG + Intergenic
1198521309 X:137455511-137455533 GCTGATGGGAAGCAGAAGGATGG + Intergenic
1198784912 X:140276741-140276763 GTTGGTGGGGAGAGGGAGGTGGG - Intergenic
1199422501 X:147659960-147659982 GCTGAGGGGAAGAGACAGGATGG + Intergenic
1199544978 X:148998888-148998910 GGTGATGGACAGAGGGAAGGAGG - Exonic
1200244818 X:154517309-154517331 TCTCATGGGCAGAGGGAGCCCGG - Intergenic
1201177905 Y:11321287-11321309 GCTGGTGGGGTGGGGGAGGAGGG - Intergenic
1201304822 Y:12541548-12541570 GCAGAGGGGAAGCGGGAGGAAGG - Intergenic
1201741493 Y:17328598-17328620 GGTGATAGGCAGAGGTAGGATGG + Intergenic
1201857715 Y:18563909-18563931 GCAGAGGTGCAGAGGAAGGAGGG + Intronic
1201875606 Y:18756472-18756494 GCAGAGGTGCAGAGGAAGGAGGG - Intronic
1202167230 Y:22002798-22002820 GTTGCTGGGCAGATGGAGGATGG + Intergenic
1202224130 Y:22583571-22583593 GTTGCTGGGCAGATGGAGTATGG - Intergenic
1202318985 Y:23612089-23612111 GTTGCTGGGCAGATGGAGGATGG + Intergenic
1202551784 Y:26057968-26057990 GTTGCTGGGCAGATGGAGGATGG - Intergenic