ID: 1119206646

View in Genome Browser
Species Human (GRCh38)
Location 14:72799335-72799357
Sequence GACAGGCTTGTGACTAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 139}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119206637_1119206646 28 Left 1119206637 14:72799284-72799306 CCTCACTATCAGTTGTGTAAAAT 0: 1
1: 0
2: 0
3: 20
4: 149
Right 1119206646 14:72799335-72799357 GACAGGCTTGTGACTAGGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 139
1119206636_1119206646 29 Left 1119206636 14:72799283-72799305 CCCTCACTATCAGTTGTGTAAAA 0: 1
1: 0
2: 1
3: 13
4: 179
Right 1119206646 14:72799335-72799357 GACAGGCTTGTGACTAGGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 139
1119206639_1119206646 1 Left 1119206639 14:72799311-72799333 CCCACTCTACCCTCCAACTTCAG 0: 1
1: 0
2: 4
3: 23
4: 345
Right 1119206646 14:72799335-72799357 GACAGGCTTGTGACTAGGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 139
1119206642_1119206646 -8 Left 1119206642 14:72799320-72799342 CCCTCCAACTTCAGAGACAGGCT 0: 1
1: 0
2: 0
3: 17
4: 210
Right 1119206646 14:72799335-72799357 GACAGGCTTGTGACTAGGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 139
1119206640_1119206646 0 Left 1119206640 14:72799312-72799334 CCACTCTACCCTCCAACTTCAGA 0: 1
1: 0
2: 2
3: 28
4: 307
Right 1119206646 14:72799335-72799357 GACAGGCTTGTGACTAGGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 139
1119206643_1119206646 -9 Left 1119206643 14:72799321-72799343 CCTCCAACTTCAGAGACAGGCTT 0: 1
1: 0
2: 1
3: 19
4: 218
Right 1119206646 14:72799335-72799357 GACAGGCTTGTGACTAGGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 139
1119206638_1119206646 2 Left 1119206638 14:72799310-72799332 CCCCACTCTACCCTCCAACTTCA 0: 1
1: 0
2: 0
3: 48
4: 519
Right 1119206646 14:72799335-72799357 GACAGGCTTGTGACTAGGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119206646 Original CRISPR GACAGGCTTGTGACTAGGCC TGG Intronic
901844222 1:11971781-11971803 CACAGGCTTGTGGCTAGGGAGGG - Intronic
903284559 1:22268605-22268627 GGCAGGCTTGTGTCAAGGCAGGG + Intergenic
906740680 1:48180816-48180838 AAAAGGATTGTGACCAGGCCTGG - Intergenic
906747898 1:48234444-48234466 GGCAGGCTTGTGGGTAGGCAGGG + Intronic
912243449 1:107936636-107936658 GTCAGGCTTGTGGCTACTCCAGG - Intronic
913573054 1:120140815-120140837 GACAGGCTCTTGAGTAGGCAGGG - Intergenic
914294315 1:146305612-146305634 GACAGGCTCTTGAGTAGGCAGGG - Intergenic
914555359 1:148756395-148756417 GACAGGCTCTTGAGTAGGCAGGG - Intergenic
917050382 1:170915891-170915913 GAAAGGCCTGTGTCTATGCCTGG + Intergenic
917957762 1:180117793-180117815 GAGAGGGTTGTGGCTAAGCCTGG - Intergenic
918226385 1:182486968-182486990 AAAAGGTTTATGACTAGGCCGGG - Intronic
921195271 1:212750475-212750497 GACTGGCTGCTGTCTAGGCCTGG - Intronic
922449624 1:225726362-225726384 GAAAGTCTTGAGACTGGGCCGGG + Intergenic
922974466 1:229772200-229772222 CACAGCCTTGTGAGTAGCCCTGG - Intergenic
1063299337 10:4837531-4837553 GAGAGGCTTTTGAATAAGCCTGG + Exonic
1065347428 10:24762063-24762085 TATAGGCTTTTGACTAGGCGCGG - Intergenic
1066105410 10:32152026-32152048 GATAGGCATGTGACCAAGCCAGG + Intergenic
1073467946 10:103705119-103705141 GACAGGCTGGTGAGCAGGCAGGG - Intronic
1075264726 10:120990577-120990599 GAAAGGCATTTTACTAGGCCAGG + Intergenic
1077284745 11:1760667-1760689 CACAGGCATGTGACTGGGCCAGG - Intronic
1077392281 11:2305576-2305598 GAAAGGCTGGTGACTGGGACAGG - Intronic
1079179076 11:18172855-18172877 GACACACTCGTGACTAGGACTGG - Exonic
1079268342 11:18957393-18957415 GACACACTCGTGACTAGGACTGG + Intergenic
1080519928 11:33059906-33059928 GCCAGGCTTGTGCCAAGGGCTGG + Intronic
1081451501 11:43174941-43174963 GACAGGCTGGAGTCTAGGCCTGG + Intergenic
1081934466 11:46895393-46895415 GACAGCCTTCCCACTAGGCCTGG - Intronic
1081998117 11:47377631-47377653 GACAGGGCTGGGACAAGGCCAGG - Intronic
1083403994 11:62444136-62444158 GCCAGGGTTGTTACGAGGCCGGG - Intronic
1084419461 11:69053102-69053124 GAGGGGCTTGTGAGCAGGCCAGG + Intronic
1088213990 11:107487347-107487369 GACAGGGATGTGACTAGGCTTGG + Intergenic
1088226824 11:107629802-107629824 GAAGGGCTTCTGACAAGGCCAGG + Intronic
1088418808 11:109619773-109619795 GATAGGCATGTGTCTATGCCCGG - Intergenic
1092882645 12:12899959-12899981 GAGTTGCTTGTGACTAGGCCTGG - Intronic
1093958904 12:25251264-25251286 GACAGCCTTGCGGCTAGGCAGGG - Intergenic
1104625390 12:130349234-130349256 GACAGGTTGGTGATTTGGCCTGG + Exonic
1104745636 12:131208551-131208573 CAGAGTCTTGTGACTAGTCCTGG + Intergenic
1104788709 12:131468557-131468579 CAGAGTCTTGTGACTAGTCCTGG - Intergenic
1104932245 12:132345892-132345914 GACATGCATGTGAATGGGCCGGG - Intergenic
1106332637 13:28753695-28753717 TACAGGCATGTGAGTACGCCAGG - Intergenic
1109918425 13:69022901-69022923 TACAGGCGTGTGACCAGGCCTGG - Intergenic
1110468512 13:75830462-75830484 CACAGGCATGTCACTGGGCCTGG - Intronic
1111365885 13:87244390-87244412 GTAAGGCTTATGTCTAGGCCAGG - Intergenic
1112326881 13:98447491-98447513 GAAAGGCCTGGGACAAGGCCAGG + Intronic
1113030967 13:105993157-105993179 GACCTGCTTGTGACTGGGCATGG - Intergenic
1115995978 14:39196165-39196187 AATAGGCTTGAGAGTAGGCCAGG - Intergenic
1116906500 14:50408721-50408743 TACAGGCGTGAGACTATGCCTGG - Intronic
1119206646 14:72799335-72799357 GACAGGCTTGTGACTAGGCCTGG + Intronic
1121058375 14:90879990-90880012 GTCAGGCTTGTCTCTTGGCCAGG + Intronic
1121544794 14:94755384-94755406 GCCAGGTCTCTGACTAGGCCAGG + Intergenic
1125484431 15:40102541-40102563 TATAGGCTTGGGAATAGGCCGGG - Intronic
1127907624 15:63387951-63387973 GCCAGGCTTCTGACTCTGCCAGG + Intergenic
1128317713 15:66671462-66671484 GAGAGGGTTGTGACTAAACCAGG + Intronic
1129177405 15:73849780-73849802 CTCAGGCTTGTGACTGGGCAGGG - Intergenic
1132196052 15:99915589-99915611 GAAAGGCATTTGGCTAGGCCAGG + Intergenic
1132383450 15:101382717-101382739 GACAGGCTTGCGAACTGGCCCGG + Intronic
1132995523 16:2820527-2820549 AACAAGCTTGTGTCCAGGCCTGG + Intronic
1133241584 16:4417107-4417129 CAGAGGCTTTTGAGTAGGCCCGG - Intronic
1133789196 16:8996155-8996177 GACAGGCATGTGACTCAGGCTGG + Intergenic
1134233714 16:12449350-12449372 AACAGGCTTGAGAATAGGCACGG + Intronic
1136116322 16:28097169-28097191 GACTGGCTTGTTGCCAGGCCTGG - Intergenic
1139965331 16:70742128-70742150 CACAGCCTTGTGACAGGGCCAGG - Intronic
1143571335 17:7760479-7760501 GACAAGCTTGGGACTGGGACTGG + Intronic
1143667389 17:8371960-8371982 GACAGGATGGTGATGAGGCCAGG + Exonic
1144574898 17:16423238-16423260 CACTGGCATGTGACTTGGCCAGG + Intronic
1145840184 17:27988226-27988248 GCCAGGCTTGTGCCTAAGACTGG + Intergenic
1145997744 17:29114147-29114169 AACAGCCTTGTGAGTAGGCTGGG + Intronic
1146946650 17:36878010-36878032 GACAGGCTTGGACCCAGGCCCGG - Intergenic
1148341410 17:46875622-46875644 GCCAGGCTTAGGACTAGGTCTGG + Intronic
1148386552 17:47238515-47238537 TGCAGGCTGGTGACTGGGCCTGG + Intergenic
1150017633 17:61574167-61574189 GACAGGCTAGTAAGTAGGGCAGG - Intergenic
1151575189 17:74949627-74949649 GGCAGGCATGTGCCCAGGCCTGG - Exonic
1157542907 18:48524845-48524867 GACAGGCCTGTGAGGAGGCAAGG - Intergenic
1162576030 19:11499320-11499342 GGCAGGCCTGTGAGTAGGACTGG + Intronic
1162931371 19:13959490-13959512 GGCAGGCATGTGACAGGGCCTGG + Intronic
1162991503 19:14305616-14305638 GACAGGCTTGTGTCTGGGTCAGG + Intergenic
1164037693 19:21468628-21468650 GACATCCATGTGCCTAGGCCTGG + Intronic
1165102568 19:33447523-33447545 GACAGGCCTCAGACTTGGCCTGG - Intronic
1165108723 19:33489018-33489040 GACTGGCTGGTGACTGGCCCTGG - Intronic
925328898 2:3043151-3043173 GACAGGGGCGTGACAAGGCCAGG + Intergenic
927388075 2:22559509-22559531 AACAGGCTTGTGACATGGCCAGG + Intergenic
929337124 2:40762536-40762558 TATAGGATTGTGGCTAGGCCAGG + Intergenic
933597087 2:84292850-84292872 GACAGACTTGTGAGTAGGCAAGG - Intergenic
933933603 2:87180738-87180760 GACAGTGTTTGGACTAGGCCTGG + Intergenic
936075035 2:109396416-109396438 GACAGCCATGTGCCTGGGCCGGG + Intronic
936359508 2:111784706-111784728 GACAGTGTTTGGACTAGGCCTGG - Intronic
939888894 2:147712063-147712085 GATAGGCCTGTGTGTAGGCCAGG - Intergenic
940893074 2:159054230-159054252 GACAAGCTAGTGACTTGCCCAGG - Intronic
941199506 2:162491377-162491399 GAGAGGCATTTTACTAGGCCAGG + Intronic
941369405 2:164645799-164645821 GGGAGGCTTGTGACCAGTCCTGG - Intergenic
947598268 2:231427797-231427819 GAAAATATTGTGACTAGGCCGGG - Intergenic
947907386 2:233775360-233775382 GACAGGCTTCTGACGACGCGAGG + Intergenic
949017999 2:241724391-241724413 GGCAGGCTTGGGCCTGGGCCAGG + Intronic
1169892326 20:10466558-10466580 GACTGGCCTGTCACTAAGCCAGG - Intronic
1169950297 20:11036006-11036028 GGCAGGCTGCTGACTAGCCCAGG - Intergenic
1174457094 20:50656791-50656813 GAAATGCTTGTGAGTTGGCCGGG - Intronic
1175899597 20:62354797-62354819 TCCAGGCTTGTGACAGGGCCTGG - Intronic
1177589912 21:23149661-23149683 GACTGGCTTGTGACTGACCCAGG - Intergenic
1182538365 22:31023267-31023289 GACAGGGTTTTGACTTGTCCAGG + Intergenic
1183060858 22:35335614-35335636 GCCAGGCTGGTGACCAGGGCAGG - Intronic
1183135727 22:35885494-35885516 GGCAGGCTAATGACTAGGCCAGG + Intronic
1183476981 22:38041149-38041171 GCCAGGCTGGTGACTAGTGCTGG + Intronic
952496753 3:33922731-33922753 GATTGGCTTGTGACCAGTCCAGG + Intergenic
954408576 3:50359157-50359179 CATAGGCCAGTGACTAGGCCGGG - Exonic
955315518 3:57935599-57935621 GTCAAGCTATTGACTAGGCCTGG + Intergenic
958873260 3:99586621-99586643 GAGATGCTTTTGACTTGGCCTGG + Intergenic
960315311 3:116168923-116168945 TACAGGCATGTGCCTAGCCCTGG - Intronic
961670573 3:128525832-128525854 GAAAGGCTGGTGACTAGGAAGGG + Intergenic
962411589 3:135145809-135145831 GCCAGGGTTGTGACTCGGCAGGG - Intronic
964987759 3:162765878-162765900 GTGAGGCTTGTGGCTAGACCAGG + Intergenic
967000556 3:185330194-185330216 GAAAGGCTACTGGCTAGGCCGGG - Intronic
968284868 3:197502576-197502598 GACAGACCTGGGGCTAGGCCTGG - Intergenic
968451458 4:677892-677914 GACAGGCTTGGGGCTACCCCAGG - Intronic
969323592 4:6427639-6427661 GCCATGCTTGTCCCTAGGCCAGG + Intronic
974203498 4:58670194-58670216 GAAAGGCATATTACTAGGCCAGG + Intergenic
977346220 4:95820190-95820212 GCCAGGCTGGTGTCTTGGCCAGG - Intergenic
979475386 4:121150831-121150853 AACAGGACTGTGGCTAGGCCAGG - Intronic
985407996 4:189655241-189655263 GACAGGCTTGTCCTGAGGCCAGG - Intergenic
986723438 5:10577034-10577056 GAAAGGCTTGTGACCATCCCCGG - Intronic
988846110 5:35129946-35129968 GACAGGCTTGCGACATGCCCAGG - Intronic
993372955 5:87115142-87115164 GTCAGGCGTGTGAGTGGGCCAGG + Intergenic
998363352 5:141610641-141610663 GACAGGCTGGTCTCTTGGCCAGG + Intronic
1004177418 6:13351732-13351754 GTCAGGCTGGTGACTGGACCAGG + Intergenic
1007745530 6:44040887-44040909 GCCAGGCTGCTGACTAGGGCCGG + Intergenic
1017947770 6:159109645-159109667 GGCAGGCTTGGGAATGGGCCAGG + Intergenic
1018892940 6:167995632-167995654 GACAGGCTGGTGGCTGGGGCCGG + Intergenic
1019196738 6:170287518-170287540 GGCAGGCAGGTGACTAGGGCAGG - Intronic
1026552094 7:71377441-71377463 CACAGGCCAGTGACTAGCCCAGG - Intronic
1030631527 7:111900828-111900850 AACAGGCTTTTGACTATGGCAGG - Intronic
1031258032 7:119481881-119481903 TACAGGCTTGGGAGTAGGGCAGG - Intergenic
1034673761 7:152876792-152876814 CACAGGCATGTGCCTGGGCCGGG + Intergenic
1034943685 7:155248473-155248495 GACATGATTGAAACTAGGCCAGG + Intergenic
1038261163 8:25996157-25996179 GACAGGCGTGGGACCATGCCTGG - Intronic
1040021077 8:42741867-42741889 GCCAGGCCTGAAACTAGGCCTGG - Intergenic
1042382946 8:68139647-68139669 GAGAGGATGGTGACTTGGCCTGG + Intronic
1044594067 8:93941394-93941416 GAAAGGCATCTTACTAGGCCAGG - Intergenic
1048951073 8:139497379-139497401 GACAGGCTTGTGACTAATAGAGG - Intergenic
1049336830 8:142091073-142091095 GACAGGCCTGTTCCTTGGCCTGG + Intergenic
1051340720 9:16107288-16107310 CACAGGCATGTGACCATGCCTGG + Intergenic
1053314863 9:37042559-37042581 GACAGCCTTGTGCTTAGTCCTGG + Intergenic
1056463156 9:86827542-86827564 GACAGGCATGTGAATTGTCCAGG - Intergenic
1056531930 9:87496054-87496076 TACAGGCATGTGACTATGCCCGG - Intergenic
1056674000 9:88657613-88657635 GACAGACATGGGACTAGGCAAGG - Intergenic
1062482305 9:136758184-136758206 GGCAGGCTGCTGTCTAGGCCAGG - Exonic
1062552878 9:137098164-137098186 GAGAGGTTTGTGTCTGGGCCAGG + Intronic
1187008033 X:15250994-15251016 TACAGGCGTGAGACCAGGCCCGG + Intronic
1190373184 X:49762925-49762947 GACAGGACTGTGACAAGGACTGG - Intergenic
1196974449 X:121142756-121142778 GACAGGCTTACCACTAGTCCTGG - Intergenic
1198048617 X:132927252-132927274 GACAGGGTTGTGGCTTGGCTTGG - Intronic
1200134691 X:153869216-153869238 GGAAGGCTGGGGACTAGGCCAGG - Intronic
1200149880 X:153946169-153946191 GACAGGCCTGTGAGCAGGGCAGG - Intergenic