ID: 1119206703

View in Genome Browser
Species Human (GRCh38)
Location 14:72799740-72799762
Sequence GTCAATCCTGGAACTTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119206703 Original CRISPR GTCAATCCTGGAACTTCTGG GGG Intronic
900686786 1:3953870-3953892 GACAAGCCTGGAACCACTGGGGG + Intergenic
901109355 1:6783282-6783304 GTCAATCCTAGCACTTTGGGAGG - Intergenic
902153898 1:14467821-14467843 GCTAAGCCTGGAGCTTCTGGGGG - Intergenic
902440300 1:16425165-16425187 GTTAATCCCAGCACTTCTGGAGG - Intronic
906417127 1:45629062-45629084 AAAAATCCTTGAACTTCTGGTGG - Intronic
907519844 1:55015953-55015975 GTCAATCCTGGAACGTGGTGGGG - Intergenic
909645751 1:77915055-77915077 TGCAATCCTAGCACTTCTGGAGG + Intronic
912633582 1:111270742-111270764 GGGAATCCTGAAACTTGTGGTGG - Intergenic
915256603 1:154635956-154635978 GTCAAGCTGGGAACTTCTGAGGG - Intergenic
920978050 1:210804315-210804337 CTCACACCTGGAGCTTCTGGGGG + Intronic
922568269 1:226616199-226616221 TTTAATCCTCGAACTTCTGAAGG - Intergenic
923949300 1:238929319-238929341 GTCATTACTGGAACTTTGGGGGG + Intergenic
1065330143 10:24587238-24587260 GTAAATCCTGGCACTTTGGGAGG - Intronic
1065955749 10:30692198-30692220 ATCAAACCTGGAACTTCTGCTGG - Intergenic
1068650767 10:59519997-59520019 GTCACTGCTGGAATTTCTGCAGG - Intergenic
1068716617 10:60195905-60195927 GGCAATCCAGGACCTCCTGGAGG - Intronic
1069686025 10:70319301-70319323 TTCAATCCTGGAACATGTGAGGG - Intronic
1069739442 10:70678334-70678356 GTGAATGCTGAAACTACTGGTGG - Intronic
1071325281 10:84509696-84509718 TTTAATCCTGAAACTTGTGGAGG - Intronic
1071780818 10:88842459-88842481 GGCACTCCTGGAACTTTTGTGGG - Intronic
1073799513 10:107026039-107026061 CTCAATCCTGCAACCTATGGTGG - Intronic
1076416082 10:130290232-130290254 GTAAAACCTGGAACATCTAGGGG - Intergenic
1076659898 10:132048634-132048656 GTCAAGCCTGGAATTTCTGATGG - Intergenic
1081773611 11:45664187-45664209 TTCAGTCCAGCAACTTCTGGAGG - Intronic
1082094848 11:48121404-48121426 TTCAAGCCTGGGATTTCTGGTGG + Intronic
1083026553 11:59556073-59556095 GTCAGTCCTAGAGCTTCTTGTGG - Intergenic
1086042408 11:82495278-82495300 GTCAATGGGGGAACTTCAGGTGG - Intergenic
1087400603 11:97661300-97661322 GTCAATCCTAGCACTTTGGGAGG + Intergenic
1088820312 11:113450985-113451007 GTCAAAGGTGGGACTTCTGGAGG + Intronic
1090430456 11:126641918-126641940 GTCAATTCTGCAACTTCAAGTGG + Intronic
1092289011 12:7147769-7147791 GTAAATCCTGGCACTTTGGGAGG - Intronic
1096629215 12:52914904-52914926 GTCAGCCCTGGAACTTCAGCAGG - Intronic
1099690128 12:85941499-85941521 GTCTTTCCTGTAGCTTCTGGTGG + Intergenic
1100548421 12:95624529-95624551 GACATTACTGGGACTTCTGGGGG - Intergenic
1103991773 12:124804219-124804241 GCAAACCCTGGAACTTCTGCTGG + Intronic
1104248815 12:127069751-127069773 TTTAATCCTGGAACTTTGGGAGG - Intergenic
1107166317 13:37284885-37284907 GTCAAAACTGGAACATCTGTAGG + Intergenic
1107861432 13:44664766-44664788 GTCAAGCCTGGAACTTCTGCTGG - Intergenic
1110139834 13:72114890-72114912 GTCTCTCCTGGAGGTTCTGGGGG - Intergenic
1112175772 13:97022252-97022274 GTAAATCCTAGCACTTCGGGAGG - Intergenic
1113420427 13:110167160-110167182 TGAAATCCTGGAACTCCTGGAGG + Exonic
1116872801 14:50083971-50083993 GTCACTCCTGGATGTTCTGGTGG - Exonic
1117355084 14:54915913-54915935 GTCAATCCTGGATCTTCAGAAGG - Intergenic
1119206703 14:72799740-72799762 GTCAATCCTGGAACTTCTGGGGG + Intronic
1121549255 14:94786206-94786228 TTTAATCCTAGCACTTCTGGAGG - Intergenic
1123216714 14:106814812-106814834 GCCCATCCAGGAACATCTGGAGG + Intergenic
1125282473 15:38057405-38057427 TGCAATCCTGGAACTTTGGGAGG - Intergenic
1127430481 15:58902646-58902668 GTAAATCCTAGAACTTTGGGAGG - Intronic
1130653775 15:85777605-85777627 GTCAATCCTGGAAGTTAAAGTGG - Intronic
1131558626 15:93420369-93420391 CTCAACCCAGGAACTTCTTGTGG - Intergenic
1133118097 16:3589634-3589656 GTCTCTCCAGGAACTTCTGACGG - Exonic
1134067744 16:11240097-11240119 GTCTTTCCTGCAGCTTCTGGGGG + Intergenic
1135030222 16:19032233-19032255 GTGAATCCTGGTCCTTATGGAGG - Intronic
1135755046 16:25090239-25090261 TTTAATCCTGAAACTTCGGGAGG + Intergenic
1135949735 16:26902948-26902970 CTCAATCCAGGATATTCTGGTGG + Intergenic
1139097734 16:63725874-63725896 GTCACTTGTTGAACTTCTGGAGG + Intergenic
1139897311 16:70298016-70298038 GCCAATCCTGGCACTTTGGGAGG + Intronic
1141810874 16:86374559-86374581 GTCAATCCTGAAAGTCCCGGTGG + Intergenic
1142426793 16:90005908-90005930 GCCACTCCAGGAACTCCTGGGGG - Exonic
1148616672 17:49005803-49005825 TGCAATCCTAGCACTTCTGGAGG + Intronic
1151635442 17:75344646-75344668 GTAAATCCTGGCACTTTGGGAGG - Intronic
1153653712 18:7263648-7263670 GATAATTCTGGAGCTTCTGGAGG + Intergenic
1153933222 18:9897256-9897278 GTCTTTCCTGGAACTTTTGTTGG - Intergenic
1155324975 18:24656158-24656180 CTTAATCCTGGGACATCTGGTGG + Intergenic
1157170689 18:45402172-45402194 CTCATTCCTGGACTTTCTGGGGG - Intronic
1157645934 18:49271103-49271125 GTCTTTCCTGGAGCATCTGGTGG - Intronic
1162244258 19:9386293-9386315 CTCCAGCCTGGAACTTCTTGGGG - Intergenic
1162311846 19:9912721-9912743 CGCCATCCTGGAGCTTCTGGAGG + Intronic
1164813600 19:31177309-31177331 GTCTCTCCTGCAGCTTCTGGGGG - Intergenic
1165002530 19:32776730-32776752 GTCATTTCTGACACTTCTGGTGG - Intronic
1165652933 19:37507048-37507070 GTCAAACCTGGGACTAGTGGAGG + Intronic
1167821386 19:51931608-51931630 TTCATTCCTAGAACTTCTGTAGG + Intronic
1168060452 19:53889274-53889296 TTCAATCCCCCAACTTCTGGTGG + Intronic
924982020 2:232045-232067 GGCAATGATGGAACTTCTGCAGG + Intronic
925490225 2:4383220-4383242 GTCAATCCGGGAACTGTTGAGGG + Intergenic
925900947 2:8509007-8509029 GTGCATCTTGGAACTTCTGGCGG + Intergenic
926079413 2:9972315-9972337 GTCCTTCCTGGAAATTCTGTCGG + Intronic
927107743 2:19842340-19842362 ATCAATCATGGAACTTCTATTGG - Intergenic
927110403 2:19860389-19860411 GCCAGTCCTGGGACTTCTGCAGG + Intergenic
928050146 2:27984582-27984604 GTCACTCCTGGAGCTTCTGTAGG - Intronic
929442707 2:41977835-41977857 GTAAATCCTGGCACTTTGGGAGG - Intergenic
929804004 2:45128690-45128712 GTCATTCCTAGAACTTGAGGTGG - Intergenic
932543246 2:72679322-72679344 GTAAATCCTGGCACTTTGGGAGG - Intronic
933613923 2:84464380-84464402 CACAAAGCTGGAACTTCTGGGGG - Intergenic
936855436 2:116952495-116952517 GTCAGTCATGGACCTTGTGGTGG - Intergenic
945332496 2:208556252-208556274 TTCAAACCTGGAGCTCCTGGTGG + Intronic
946302964 2:218835667-218835689 GTGAATCCTGGGACTTTTGCTGG + Intergenic
1176719916 21:10384533-10384555 GACCATGCTGGAGCTTCTGGTGG - Intergenic
1176719936 21:10384638-10384660 GACCATGCTGGAGCTTCTGGTGG - Intergenic
1176720068 21:10385393-10385415 GACCATGCTGGAGCTTCTGGTGG - Intergenic
1178552527 21:33552757-33552779 GGCAATGCTGGACCCTCTGGTGG - Exonic
1180301128 22:11037390-11037412 GACCATGCTGGAGCTTCTGGTGG - Intergenic
1180301145 22:11037495-11037517 GACCATGCTGGAGCTTCTGGTGG - Intergenic
1180301160 22:11037573-11037595 GACCATGCTGGAGCTTCTGGTGG - Intergenic
1180301265 22:11038145-11038167 GGCGATGCTGGAGCTTCTGGTGG - Intergenic
1184082651 22:42234882-42234904 GTAAATCCCAGAACTTTTGGAGG + Intronic
1184878933 22:47292811-47292833 GTGAGGCCTGGAACTTCAGGCGG + Intergenic
950397212 3:12742684-12742706 GTCACCTCTGGAAGTTCTGGGGG - Intronic
953809829 3:46102703-46102725 TTCATTCTTGCAACTTCTGGTGG - Intergenic
956008378 3:64804756-64804778 GTCACTCCTGGCAGTTATGGTGG + Intergenic
961671651 3:128536485-128536507 GTAAATTCTGGAACTTTTGCTGG + Intergenic
961833078 3:129634448-129634470 GTCGATCCTGGGACTCCTGATGG - Intergenic
961920692 3:130422729-130422751 GGTAATCCTGGAATTCCTGGGGG + Exonic
965555324 3:170012517-170012539 GGTAATCCTGGCACTTCGGGGGG - Intergenic
967282277 3:187833918-187833940 GTCAAACCTGGCACTGCTGGTGG + Intergenic
972422818 4:38905578-38905600 GTAAATTCTGGATCTTCTGAAGG + Exonic
972916300 4:43883928-43883950 GTCAAGCCAGGAACTGCTTGGGG - Intergenic
974953812 4:68614798-68614820 GGCAATCCTTGCACTGCTGGTGG - Intronic
975987415 4:80214241-80214263 GTAATTCCCAGAACTTCTGGAGG - Intergenic
978429480 4:108618827-108618849 GTTAATCCTAGCACTTCGGGAGG - Intergenic
981646454 4:147004132-147004154 GTCACTCCTGTAAATTCAGGTGG + Intergenic
986708271 5:10469216-10469238 CTTAATCCTAGCACTTCTGGAGG + Intronic
991378112 5:65987594-65987616 GTTAATCCCAGAACTTCGGGAGG + Intronic
992007251 5:72490110-72490132 TTGAAGCCTGGAACTTGTGGAGG - Intronic
994371265 5:98970374-98970396 GTCAATCCTAGCACTTTGGGAGG + Intergenic
998651498 5:144126085-144126107 GTCACTCCTGCACCTTCTGCAGG + Intergenic
999179478 5:149659000-149659022 GTCAACACTGGGACTTCTGCTGG - Intergenic
1003486802 6:6587132-6587154 TTCCATCCTGGACCTTCTAGGGG + Intergenic
1003985876 6:11434692-11434714 GTAAATCCTAGCACTTTTGGAGG - Intergenic
1005285385 6:24320908-24320930 GACAAGCCTGGAACATCTTGTGG + Intronic
1014209206 6:118690510-118690532 ACCAATCCTGGAACTGATGGTGG - Intronic
1019639721 7:2096948-2096970 GTCATTCCTGGCAGTCCTGGAGG - Intronic
1020102698 7:5403534-5403556 GTCAATCCTAGGACTTTGGGAGG + Intronic
1025252705 7:57362528-57362550 GTCATTCCTGGAACACCTGATGG + Intergenic
1026070052 7:67110746-67110768 GTCATTGCTTGAACTTCGGGAGG + Intronic
1026168080 7:67928703-67928725 GTCCATCCAGGTATTTCTGGTGG - Intergenic
1026374295 7:69735047-69735069 CAGAATCCTGGAGCTTCTGGAGG - Intronic
1030723327 7:112895451-112895473 GTCTATCATGTAACTACTGGAGG + Intronic
1032328355 7:130953285-130953307 GGGAATGTTGGAACTTCTGGAGG + Intergenic
1034455862 7:151169405-151169427 GGCAATCCTGGAACTTGTGTAGG - Intronic
1035133538 7:156677463-156677485 GTGAATCCTGTCACTGCTGGTGG + Intronic
1035308112 7:157946334-157946356 CTCAATCCTGGAAATTCAGCAGG + Intronic
1036222775 8:6934540-6934562 GTCACTCTTGGAAGTTGTGGGGG + Intergenic
1037745860 8:21643544-21643566 TTCAATCCTGGAATTCCAGGTGG - Intergenic
1038406386 8:27325719-27325741 GTCAAGCCTCCAACTTCTGCCGG - Intronic
1038793050 8:30685717-30685739 GTAAATCCTAGCACTTCGGGAGG + Intronic
1039717244 8:40123057-40123079 TGTAATCCTAGAACTTCTGGAGG - Intergenic
1041072662 8:54140517-54140539 CTCAATCCTAGCACTTCGGGAGG - Intronic
1041960657 8:63611861-63611883 TAACATCCTGGAACTTCTGGAGG - Intergenic
1045046567 8:98284714-98284736 GTGAATCCTGTGAATTCTGGGGG - Intronic
1045090462 8:98737964-98737986 TGTAATCCTGGCACTTCTGGAGG - Intronic
1051336558 9:16070990-16071012 GCCAAAGCTGGAACTTCTGTTGG + Intergenic
1051697650 9:19786861-19786883 ATCCATCCTGGGTCTTCTGGTGG + Exonic
1055307643 9:74946425-74946447 TTCTATCCTGAAACTTCTAGAGG + Intergenic
1055519649 9:77067945-77067967 TGCAATCCTGGAACTTTGGGAGG - Intergenic
1057291362 9:93809522-93809544 CTCAAGCCTGGAGCTGCTGGAGG - Intergenic
1058508960 9:105695058-105695080 GTCAGTCCTGGGACTTCTGCGGG - Intronic
1203491171 Un_GL000224v1:106646-106668 CTAAATCCTAGAACATCTGGAGG + Intergenic
1203503795 Un_KI270741v1:48517-48539 CTAAATCCTAGAACATCTGGAGG + Intergenic
1185540832 X:902113-902135 GACCATGCTGGAGCTTCTGGTGG + Intergenic
1185540986 X:902868-902890 GACCATGCTGGAGCTTCTGGTGG + Intergenic
1187783700 X:22860033-22860055 GTAAATCCCCGAACTTTTGGAGG + Intergenic
1199894461 X:152117521-152117543 GTCATTCCTGGGGCTTCTGTGGG + Intergenic
1200017609 X:153178838-153178860 GCCAGTCCTGGACCATCTGGTGG + Intergenic
1201947563 Y:19527799-19527821 GCCTGTCCTGGAACCTCTGGGGG - Intergenic