ID: 1119213315

View in Genome Browser
Species Human (GRCh38)
Location 14:72849324-72849346
Sequence CCAGGAGACATGACGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 27, 3: 33, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119213315 Original CRISPR CCAGGAGACATGACGGCAGA GGG Intronic
900422439 1:2561416-2561438 AAAGGAGACAGGACGGCAGAGGG - Intronic
900423425 1:2565400-2565422 AAAGAAGACAGGACGGCAGAGGG + Intergenic
900530362 1:3150022-3150044 GCAGGAGCCATGACAGGAGATGG - Intronic
902716379 1:18275742-18275764 GCAGGAGACAGGAAGCCAGATGG + Intronic
904976430 1:34460480-34460502 CCAGGAGGCAAGTTGGCAGAAGG - Intergenic
905006582 1:34714747-34714769 CCAGGAGACAAGGAGGTAGAAGG - Intronic
906279152 1:44541845-44541867 CCAGGAGACATATGGGAAGAAGG - Intronic
906668182 1:47636413-47636435 CCAGGGGAAATGAAGGCAGAGGG - Intergenic
907257622 1:53191717-53191739 CTAGGGGACATGAGGACAGATGG + Intergenic
908622427 1:65999096-65999118 CCAGGACACATGCCGGAAGGTGG + Intronic
909502612 1:76352888-76352910 CCAGCTGGCATGATGGCAGATGG - Intronic
911236020 1:95413233-95413255 GCAGGAGACAGAAGGGCAGAAGG - Intergenic
912658658 1:111509341-111509363 CCAAGAGACATGAGGGCATTTGG - Intronic
918077996 1:181184960-181184982 TCAGGAGAGGTGACCGCAGAGGG - Intergenic
923620743 1:235577247-235577269 CCAGGTGAGAGCACGGCAGATGG - Intronic
1064288271 10:14011524-14011546 CCAGGAGATTGGAAGGCAGATGG - Intronic
1065432183 10:25670805-25670827 CCTAGAGACATGACAACAGATGG + Intergenic
1067696917 10:48542474-48542496 GCAGGAGGCAGGACTGCAGAAGG - Intronic
1068839010 10:61589385-61589407 CCAGGAGACAGGAAGAGAGATGG + Intergenic
1069641266 10:69956978-69957000 CAAGGAGAAAGGAAGGCAGAGGG - Intronic
1069755926 10:70774468-70774490 CGAGGGGACCTGAGGGCAGAAGG - Intronic
1070662380 10:78316573-78316595 CCAGCAGCCAAGAGGGCAGATGG - Intergenic
1071123691 10:82310030-82310052 CCAGGAGACATAATGGAGGATGG - Intronic
1072307478 10:94121413-94121435 CTAGGAGGGATGAAGGCAGATGG + Intronic
1074109823 10:110414905-110414927 CCAGGAGAGAATGCGGCAGAGGG + Intergenic
1074138489 10:110649519-110649541 CCAGGACAGATGAAGGGAGAGGG - Intronic
1075518913 10:123132402-123132424 CAAGGAGCCAAGAGGGCAGAAGG - Intergenic
1076386225 10:130057920-130057942 CCTGGAGTCATGACGTCTGAGGG - Intergenic
1076740028 10:132478420-132478442 CCAGGAGACTGGACAGCAGGAGG - Intergenic
1076791181 10:132777647-132777669 TGGGGAGACATGAAGGCAGAGGG - Intronic
1078369392 11:10732480-10732502 CATGGAGACATGAGGACAGAGGG - Intergenic
1078426314 11:11253857-11253879 CCAGGACACCTGCAGGCAGAAGG - Intergenic
1080225758 11:29958085-29958107 CCAGGAGTCAACATGGCAGAAGG - Intergenic
1082175058 11:49049357-49049379 CCAGGAGAGATGTCGTCAGACGG - Intergenic
1082238760 11:49851373-49851395 CCAGGAGAGATGTCGTCAGACGG + Intergenic
1082243384 11:49892954-49892976 CCAGGAGAGATGTCGTCAGAGGG - Intergenic
1082657881 11:55873780-55873802 CCAGGAGAGTTGTCGTCAGACGG - Intergenic
1084276818 11:68056317-68056339 GCAGGTGAAAGGACGGCAGAAGG - Intronic
1084609289 11:70191907-70191929 CATGGAGACAGGAGGGCAGAGGG - Intergenic
1085296555 11:75434820-75434842 CCAGCAGACCTCAAGGCAGAAGG - Exonic
1085508494 11:77073561-77073583 CCAGGGGACATCACGGCTGCAGG + Intronic
1086595458 11:88565646-88565668 ACAGGAGTCAGGAAGGCAGATGG + Intronic
1086690711 11:89786728-89786750 CCAGGAGAGATGTCGTCAGACGG + Intergenic
1086697811 11:89864778-89864800 CCAGGAGAGATGTCGTCAGACGG - Intergenic
1086708351 11:89979710-89979732 CCAGGAGAGATGTCGTCAGACGG + Intergenic
1086715090 11:90052932-90052954 CCAGGAGAGATGTCGTCAGACGG - Intergenic
1087323722 11:96695973-96695995 TCATGATACATGAGGGCAGAAGG + Intergenic
1090436309 11:126689525-126689547 CCAGGTGACAAGAAGGCAGCTGG - Intronic
1091037064 11:132243970-132243992 CCATGAGACGGGATGGCAGACGG - Intronic
1099077017 12:78122326-78122348 CAAGGAGCCATGATGGCTGAGGG - Exonic
1100396068 12:94187362-94187384 CCAAGAGAAATGAAGGGAGAGGG + Intronic
1100594100 12:96056546-96056568 ACAGAAGACATCACAGCAGAGGG - Intergenic
1102453474 12:113057423-113057445 CCAGGAGACAAGAGGGGAGAGGG - Intronic
1103402140 12:120650311-120650333 CCTGGAGAGCTGATGGCAGAGGG - Intronic
1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG + Intergenic
1105284633 13:18994145-18994167 CCAGAAGGCAAGAAGGCAGAAGG + Intergenic
1107800749 13:44106067-44106089 TTAGGTGACATGACAGCAGAAGG - Intergenic
1110863304 13:80367478-80367500 GCAAGAGACAGGAGGGCAGAAGG + Intergenic
1112203135 13:97297579-97297601 GCAGGAGACATGAAGGGACAGGG - Intronic
1112719571 13:102227857-102227879 TCAGCAGACAAGACGCCAGATGG - Intronic
1114731755 14:25000495-25000517 CCAGAAGACAGGAGGGCAGGAGG - Intronic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1116759955 14:48999739-48999761 CCAGGAAACAGGAAGGAAGAGGG - Intergenic
1117545065 14:56786761-56786783 CCAGGACACATGACACCATATGG + Intergenic
1118859678 14:69652900-69652922 CCAGAAGCCAAGACAGCAGAGGG - Intronic
1119213315 14:72849324-72849346 CCAGGAGACATGACGGCAGAGGG + Intronic
1119574121 14:75702870-75702892 CCAGGAGGCATGAGGGGAGCTGG + Intronic
1121179536 14:91918375-91918397 CCAAGAAACAAGAGGGCAGAAGG + Intronic
1121211555 14:92211212-92211234 ACATGAGACATGAAGGGAGAAGG + Intergenic
1121314048 14:92950641-92950663 CCAGCAGCCGTGATGGCAGAAGG - Intronic
1122295524 14:100703640-100703662 CCAGGAGACAAGGCTGCAGATGG - Intergenic
1122802723 14:104239630-104239652 CTATGAGAAAGGACGGCAGAAGG + Intergenic
1125766737 15:42141403-42141425 CGAGGAGACCAGAAGGCAGAAGG + Exonic
1127885908 15:63200841-63200863 GCAAGAGAAATGAAGGCAGATGG - Intronic
1129348518 15:74939727-74939749 GCAAGAGACAAGAGGGCAGAAGG - Intergenic
1131849878 15:96527431-96527453 CCAGTAGACATGCAGGCAAAGGG - Intergenic
1133728123 16:8556020-8556042 CCAGGAGGCATGCCGACAGGTGG - Intergenic
1135026412 16:19002642-19002664 CCAGGAGACATGAGGGAGCAGGG - Intronic
1135252845 16:20915624-20915646 GCAGGCGACATCAGGGCAGATGG + Exonic
1136022282 16:27447870-27447892 CAAGGAGACATGGGGGCAGGAGG - Intronic
1140206677 16:72939107-72939129 ACAAGAGACATGGCGGTAGAGGG + Intronic
1142261272 16:89043523-89043545 TCAGGAGACATGACAGCGGGTGG + Intergenic
1142515251 17:423599-423621 CTAGGTGACATGAGGACAGAAGG - Intronic
1144052353 17:11507932-11507954 ACAGGAGACATGAGGTCAAAGGG + Intronic
1144067876 17:11640689-11640711 CAAGGAGACATGATGTCAAAGGG - Intronic
1145218431 17:21069446-21069468 GCAGGAGACGTGACAACAGAGGG + Intergenic
1145930463 17:28681745-28681767 CCAGGAGACTTGACAGCCCATGG + Intronic
1147505967 17:41017909-41017931 CCCAGAGACCTGACTGCAGACGG - Intronic
1147965369 17:44191833-44191855 CCAGCAGCCATGGGGGCAGAGGG + Exonic
1148229118 17:45920229-45920251 CCAGGTGACAGGAGGACAGAGGG - Intronic
1149622681 17:58057905-58057927 CAAGGAGAAATGGAGGCAGATGG - Intergenic
1150833431 17:68543025-68543047 CCAGGAGGCTTGACGGAATAAGG - Intronic
1152419379 17:80183899-80183921 CCATGAGACCTGTGGGCAGATGG - Exonic
1152503116 17:80726268-80726290 CCAGGAGGCAGCACGGCACAGGG - Intronic
1153530336 18:6039638-6039660 CCAGGAAACAGGATGGAAGAGGG - Intronic
1154040182 18:10847212-10847234 CCAGATGACATGACGGCAGCCGG + Intronic
1154300070 18:13184835-13184857 CCAGGAGGGGTGAAGGCAGAAGG + Intergenic
1154414578 18:14170307-14170329 CCAAGGGCCATGACGGGAGAGGG + Intergenic
1155289515 18:24326541-24326563 CCAGGATACATAATGGAAGATGG - Intronic
1159072007 18:63635034-63635056 ACAGGAGACATGAGTTCAGAAGG + Intergenic
1159073474 18:63652961-63652983 ACAGGAGACATGAGTTCAGAAGG + Intronic
1159115400 18:64107597-64107619 CCAGGAGACATGGTGGTGGAGGG + Intergenic
1159997849 18:74983828-74983850 CCAGGAGCCATGACGGGTGTGGG - Intronic
1160390404 18:78527210-78527232 CCAGGAGGAATGAAGGCTGATGG - Intergenic
1160720589 19:595445-595467 CCAGGGGACATGACTGGGGAGGG - Intronic
1163696634 19:18767606-18767628 ACAGGAGACATGGGGGCCGAGGG - Intronic
1163710633 19:18844732-18844754 CCAGGGGACATGATGGGTGAAGG - Intronic
1163720831 19:18897419-18897441 CCAGGATACCAGACGGAAGAGGG - Intergenic
1165004217 19:32791318-32791340 CCTGGAAACCTGACTGCAGAAGG - Intronic
1165162235 19:33823582-33823604 TCAGGAGACTGGAGGGCAGAAGG + Intergenic
1165245116 19:34494175-34494197 ACAGGAAACATGGGGGCAGATGG + Intronic
1165796453 19:38522915-38522937 CCAGGAGACATCCAGTCAGAGGG - Intronic
1166386047 19:42381932-42381954 CAGGGAGAAGTGACGGCAGAGGG - Intergenic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1167729406 19:51242518-51242540 CCAGGTGCCGTGACTGCAGATGG - Intronic
1168193660 19:54757561-54757583 CCAGGAGCCATGAATGCAGGTGG + Intronic
1168195720 19:54772300-54772322 CCAGGAGCCATGAATGCAGGTGG + Intronic
925204487 2:1994483-1994505 CCAGGAGACAGCACGGCCCAGGG - Intronic
925817609 2:7768843-7768865 CCAGGGGACCTGAGGGCACAGGG - Intergenic
926923520 2:17963132-17963154 CCAGCAGAGATGACTGCAGAGGG + Intronic
926923525 2:17963182-17963204 CCAGGAGAGATGATTGCAGAGGG + Intronic
926923533 2:17963268-17963290 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923539 2:17963320-17963342 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923545 2:17963364-17963386 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923549 2:17963418-17963440 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923553 2:17963476-17963498 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923557 2:17963534-17963556 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923563 2:17963582-17963604 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923567 2:17963632-17963654 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923571 2:17963684-17963706 CCAGGAGAGATGATTGCAGAGGG + Intronic
926923575 2:17963732-17963754 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923579 2:17963788-17963810 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923583 2:17963838-17963860 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923587 2:17963888-17963910 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923591 2:17963936-17963958 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923595 2:17963986-17964008 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923599 2:17964024-17964046 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923603 2:17964072-17964094 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923607 2:17964120-17964142 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923611 2:17964168-17964190 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923615 2:17964218-17964240 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923619 2:17964268-17964290 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923625 2:17964318-17964340 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923629 2:17964368-17964390 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923633 2:17964418-17964440 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923636 2:17964464-17964486 CCAAGAGAGATGACTGCAGAGGG + Intronic
926923640 2:17964514-17964536 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923644 2:17964554-17964576 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923648 2:17964604-17964626 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923718 2:17965400-17965422 CCAGGAGAGATGACTACAAAGGG + Intronic
926923722 2:17965454-17965476 CCAGGAGAGCTGACTGCAGAGGG + Intronic
927673898 2:25090763-25090785 CCAGGAGATAGGACGATAGAGGG + Intronic
934039368 2:88115332-88115354 AGAGGAGACATGATGACAGAAGG - Intergenic
934076954 2:88436711-88436733 CCAGGAGACAGGAAGGGAAAGGG - Intergenic
936017899 2:108973445-108973467 GCAGGAGAAATGAAGGCAGGAGG - Intronic
936728193 2:115348062-115348084 GTAGGAGACAGGAAGGCAGAAGG + Intronic
938152443 2:128899252-128899274 GCAGGAGACATGAGGGCTGGTGG - Intergenic
947590989 2:231385686-231385708 CGAGGAGACATGGCTCCAGAGGG + Intergenic
948169130 2:235887185-235887207 CCAGGATGTATTACGGCAGAAGG + Intronic
948378029 2:237534916-237534938 CCAGGGGACATAACTGGAGATGG + Intronic
1168736316 20:141105-141127 CCAAGAGAAATGACAGCATATGG + Intergenic
1168977821 20:1981176-1981198 CCAGGACACATGGCTGCAGGTGG + Intronic
1170454295 20:16518068-16518090 CCAGGAGACATGACTGCAAACGG + Intronic
1170842807 20:19937985-19938007 ACAGGAGACAGGACGGGAGGTGG - Intronic
1171959278 20:31482301-31482323 CCAGGAGTCATGCCTGCAGGGGG + Exonic
1173006467 20:39143163-39143185 CCAGGAGGCATGATGGGAGAAGG - Intergenic
1173148094 20:40542833-40542855 CCAGGATACATGACTGCGGCTGG + Intergenic
1174296404 20:49548387-49548409 CCAGGAGAGAAGGCGGCAGATGG + Intronic
1174668018 20:52278415-52278437 CCATGAGACTTGAGGGCACAAGG + Intergenic
1174852381 20:54007554-54007576 GCAGGAGACATTACTGCAGTTGG - Intronic
1179430614 21:41318608-41318630 CCAGGAGAGATGAGGGTGGATGG - Intronic
1179490275 21:41736724-41736746 CCAGGACGCCTGACAGCAGAGGG - Intergenic
1180198219 21:46209810-46209832 CCATGAGATATGACTGAAGATGG + Intronic
1181035443 22:20167862-20167884 CCTGGAGACATGAAGGCCAAGGG + Intergenic
1181087229 22:20446690-20446712 CCAGGAGAAATGGCGTGAGAGGG + Intronic
1181889591 22:26050441-26050463 CCAGCAGAAGTGACTGCAGAAGG - Intergenic
1182787642 22:32920827-32920849 GCAGGAGACTGGAAGGCAGAGGG + Intronic
1183132275 22:35850088-35850110 CCAGGACACAGAAAGGCAGATGG + Intronic
1183817161 22:40312216-40312238 CCAGGAGACTTCAGGGCTGAAGG - Intronic
1184504914 22:44894780-44894802 CCAGGGGACATAAAGGGAGAGGG + Intronic
1184538875 22:45106719-45106741 CCCTGAGACATGAAGGCAGCTGG + Intergenic
952108396 3:30094537-30094559 GCAGGAGACAGGATGGCAAAAGG - Intergenic
954128051 3:48543721-48543743 GGAGGAGACATGACAGGAGAAGG + Intronic
955522451 3:59788162-59788184 CCAGGAGAAATGATGGGAGAGGG - Intronic
956499734 3:69869377-69869399 ACAGGAGACATGGTGGCAGAAGG + Intronic
958928741 3:100186989-100187011 CCAGCAGCCATGTCGGGAGAGGG - Intronic
971931128 4:33084672-33084694 CCAGAAGACATGACAGGAAAAGG + Intergenic
974747720 4:66098079-66098101 CCAGGAGACATGATGTCACCAGG - Intergenic
974747793 4:66098795-66098817 CCAGGAGACATGATGTCACCAGG - Intergenic
976911275 4:90309227-90309249 CCAGGAGACATAATTGCACAGGG - Exonic
977550132 4:98433116-98433138 CCATGAGAAATGAGGGCAGATGG + Intronic
977709986 4:100113901-100113923 GCAGGAGACAGGAGGGCAGGAGG - Intergenic
979671310 4:123362993-123363015 CCAGAAGACATGAAAGGAGAGGG + Intergenic
979981176 4:127257120-127257142 CCTAGAGAAATGACTGCAGATGG + Intergenic
981016208 4:139977098-139977120 CCAGGAGACATGCAGCAAGAAGG + Intronic
981172339 4:141638902-141638924 CCAGGAGAGATGAGGGGAAAAGG - Intronic
981948245 4:150375237-150375259 ACAGGAGACAGGACTGCAGGAGG - Intronic
986127812 5:4899525-4899547 GCAGGACACATGCTGGCAGAAGG - Intergenic
986475948 5:8132690-8132712 CCAGGAGAAAAGACTGCATAGGG + Intergenic
986592958 5:9390282-9390304 CCTGGAAACATGAAAGCAGACGG + Intronic
986623583 5:9702727-9702749 CCAGAAGACATAAGGGCAGAAGG + Intronic
987337127 5:16906750-16906772 TCAGGAGACATTACTGCAGAAGG - Intronic
993109057 5:83632973-83632995 ACAGGAGACAGGAGGGCAGGAGG - Intergenic
994276876 5:97849367-97849389 ACAGGAGACCTGAAGGCAGGTGG + Intergenic
995839532 5:116430493-116430515 CCAGGAGACATGACGTCCAAAGG + Intergenic
996287816 5:121815538-121815560 CCAGCAGACAGTAGGGCAGAGGG - Intergenic
1000388803 5:160701636-160701658 CCAGGAGACATTAGGGTAGGAGG - Intronic
1001732850 5:173973062-173973084 CCAGGATCCATGACGTGAGATGG - Intergenic
1002111886 5:176921308-176921330 TCAGGAGAGATGATGGCAGGAGG - Intronic
1002468685 5:179421831-179421853 CCAGGAGAGCTGACAGCAGCAGG - Intergenic
1007234874 6:40383503-40383525 CCAGGACATATAACTGCAGATGG - Intergenic
1009229640 6:61046585-61046607 CCTGGAGCCAGGATGGCAGAGGG - Intergenic
1010077902 6:71822297-71822319 CCAGGAGAAAACAGGGCAGAGGG + Intergenic
1011124015 6:83986995-83987017 CCAGGTGAGATGAGGGCAGATGG - Intergenic
1012040186 6:94194247-94194269 CCAGGGGTCATGAGGGCAAATGG + Intergenic
1015421543 6:133015971-133015993 CCATGAGACATGAAGAAAGATGG + Intergenic
1016010615 6:139134996-139135018 CCAGGTGACCTCACGGCTGACGG - Intergenic
1016277835 6:142375414-142375436 TCAGGAGAAATGATGGGAGAGGG + Intronic
1018567691 6:165172910-165172932 CAGGGAGACGTGAAGGCAGAAGG + Intergenic
1018743547 6:166747833-166747855 GCAGGAGACAGGATGGCACAGGG + Intronic
1018929422 6:168230792-168230814 CCAGGAGTCAGGACTGCAGGAGG + Intergenic
1020952622 7:14699662-14699684 CCAAGACACATGATGTCAGAAGG + Intronic
1021444690 7:20719701-20719723 GCAGGAGACATGAGAGCAGATGG + Intronic
1027890858 7:83972561-83972583 CCAAGAGATATGATGGGAGATGG + Intronic
1033000527 7:137499595-137499617 CCAGGAGCCATGATGTCAAAGGG - Intronic
1034251102 7:149691386-149691408 CTAGGGGAAATGAGGGCAGAAGG - Intergenic
1035358397 7:158293915-158293937 TCAGGAGATATGCCGGCAGAAGG - Intronic
1035369664 7:158371999-158372021 CCAGGAGGGCTGATGGCAGAGGG - Intronic
1036462179 8:8963281-8963303 CCAAGAGCCAGGACGACAGAGGG - Intergenic
1036761021 8:11508617-11508639 CCAGGAGACCCGAAGGCAGAGGG - Intronic
1037864201 8:22430056-22430078 GCAGCAGACATGAGGGAAGAAGG + Intronic
1039360319 8:36869818-36869840 ACCAGAGACATGACGGCAGAGGG - Intronic
1040635814 8:49271306-49271328 CCAGGAGTCATCCTGGCAGATGG - Intergenic
1045023476 8:98064376-98064398 CCAGGAGACAGGAGGGGAGACGG - Exonic
1046708050 8:117477773-117477795 CCAGGAGGCAGGAAGGCAGTGGG + Intergenic
1048498118 8:134952203-134952225 CCAGGGGACAGGATGGCAGAAGG - Intergenic
1048656019 8:136536719-136536741 CCAGGAGCATTGACGGCCGAGGG - Intergenic
1049181546 8:141225695-141225717 CCGGGAGACAAGAAGGCACAGGG + Intronic
1050125650 9:2354037-2354059 CCAGGAGAGATGGAGGCAGGTGG - Intergenic
1050892298 9:10838776-10838798 TCAGGAGACATTCCAGCAGAAGG + Intergenic
1051121981 9:13761458-13761480 CCAGGAGTCATGGCTGCTGAAGG + Intergenic
1056377955 9:86032755-86032777 CCAGGAGGCATAACAGCAGGTGG - Intronic
1057412547 9:94829848-94829870 CCTGTAGTCATGACGTCAGATGG - Intronic
1059156934 9:111998351-111998373 ACAGGAAACATGACGGCAAGAGG + Intergenic
1060496688 9:124124697-124124719 CCAGGAGAAAGGAGGCCAGAGGG - Intergenic
1061118668 9:128629924-128629946 ACAGGAGACCTCAGGGCAGAGGG - Intronic
1061274997 9:129564879-129564901 CCATGTGTCATGATGGCAGATGG + Intergenic
1186455664 X:9708123-9708145 CCAGGAGAAATGAGGGGACATGG - Intronic
1187003083 X:15201912-15201934 GCAGGAGACATGACAGTAGAAGG - Intergenic
1190487711 X:50944868-50944890 CCAGGAGACATGATGACTAAAGG - Intergenic
1195122536 X:101770063-101770085 TCAGGAAACATTACTGCAGAAGG - Intergenic
1195709449 X:107762295-107762317 CCAGGAGACAAGAGAGCTGAAGG + Intronic
1195755439 X:108194741-108194763 CCAGAAGACAATACGGCAGTAGG + Intronic
1198776627 X:140186460-140186482 CCAGGCTATATGATGGCAGATGG + Intergenic