ID: 1119214221

View in Genome Browser
Species Human (GRCh38)
Location 14:72856284-72856306
Sequence CTCCTGTTTTAGAGGAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 1, 2: 1, 3: 37, 4: 332}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119214221_1119214225 22 Left 1119214221 14:72856284-72856306 CCTTTTCTCCTCTAAAACAGGAG 0: 1
1: 1
2: 1
3: 37
4: 332
Right 1119214225 14:72856329-72856351 TCATCCATCTTGCAGCCAGCAGG 0: 1
1: 0
2: 2
3: 17
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119214221 Original CRISPR CTCCTGTTTTAGAGGAGAAA AGG (reversed) Intronic
900762574 1:4482865-4482887 CTCCTGTTTTAAAGGTGTAGAGG - Intergenic
901897291 1:12325030-12325052 CTTCTCTTTTTGAAGAGAAAGGG - Intronic
902845341 1:19106001-19106023 CTACTGTTTTAGATGGGGAAAGG + Intronic
904850519 1:33455737-33455759 ATCCTGTTTTAGATGAGACTGGG + Intergenic
907757145 1:57321683-57321705 CTCCCATTTTATAGAAGAAATGG - Intronic
907853597 1:58280165-58280187 CTCCTGTCTTAGAGGAGGTCAGG - Intronic
908530145 1:65026518-65026540 TTCCTGTTCTAGAGGAGGAAGGG - Intergenic
910720880 1:90285052-90285074 CTCATTTTTTAGAGGACCAATGG + Intergenic
910973749 1:92883977-92883999 CTTCTGCCTTAGAGGAGAACTGG + Intronic
911518919 1:98904899-98904921 CTCATGATTTACAGTAGAAAAGG - Intronic
912541435 1:110419176-110419198 CTCCTGTTGATGAGGGGAAATGG - Intergenic
913566369 1:120076702-120076724 CACTTGGTTTTGAGGAGAAAAGG + Intergenic
913631762 1:120716847-120716869 CACTTGGTTTTGAGGAGAAAAGG - Intergenic
914287130 1:146237418-146237440 CACTTGGTTTTGAGGAGAAAAGG + Intergenic
914548162 1:148688160-148688182 CACTTGGTTTTGAGGAGAAAAGG + Intergenic
914618521 1:149383544-149383566 CACTTGGTTTTGAGGAGAAAAGG - Intergenic
915168410 1:153961674-153961696 CCTCAGTTTTAGAGGAAAAAAGG + Intronic
915963408 1:160285300-160285322 ATTCTGTTTCACAGGAGAAAAGG - Intronic
916009168 1:160689071-160689093 CATTTGTTTTAAAGGAGAAAGGG + Intronic
916581697 1:166114981-166115003 CTCAAATTTTAGAGGGGAAAGGG + Intronic
916817911 1:168371406-168371428 ACCTTGTTTTGGAGGAGAAAAGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
919465178 1:197917047-197917069 GTCATGTTTTAAAGGGGAAAAGG - Intronic
919493779 1:198238330-198238352 CTCCTTTTTCAGAGGGGCAAGGG + Intronic
920251277 1:204624078-204624100 CACCTGTTTTACAGGAGCAGAGG + Intronic
920342079 1:205281623-205281645 CTCCTGCTTTTCAGGAGAAAGGG + Intergenic
921997022 1:221431509-221431531 CTGCTGTTTTAGAGGACCCATGG - Intergenic
923523668 1:234756324-234756346 TTCCTGGTTTAGACCAGAAATGG - Intergenic
924504464 1:244668531-244668553 TTCTAGTTTTTGAGGAGAAATGG + Intronic
924615812 1:245610982-245611004 CTCCTCTTTTTGGGGAGAAAAGG - Intronic
1062956894 10:1546470-1546492 CTCCTGACTTTGAGGAGAAATGG + Intronic
1063948391 10:11199763-11199785 CTGCTGCTTTAGAGAAGCAATGG - Intronic
1064108061 10:12517929-12517951 CTTCTGTTTTCTAGAAGAAATGG + Intronic
1064847231 10:19668762-19668784 CTCTTTTTTTGGAGGAGAAGGGG - Intronic
1064865608 10:19875681-19875703 TTTCTGTTTTATAGCAGAAATGG + Intronic
1066259877 10:33719256-33719278 CTACTGTTTTAGATTTGAAAAGG + Intergenic
1066485314 10:35837633-35837655 GTCCTGTCTAAGAGGACAAAGGG + Intergenic
1066789753 10:39049366-39049388 CTCCTGGTTGAAAGGTGAAACGG - Intergenic
1068420935 10:56792175-56792197 CTGTTGTTTTAGAGGGGAGATGG - Intergenic
1069074329 10:64022071-64022093 CTCCTTTATCTGAGGAGAAATGG - Intergenic
1069162525 10:65108947-65108969 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1069832483 10:71289739-71289761 CTCCTGGTTCAGCAGAGAAATGG - Intronic
1070953249 10:80447534-80447556 CTCCTGTTTTAAAGAAAGAAGGG - Intergenic
1072164773 10:92802583-92802605 CTCCTTTTGTATGGGAGAAAAGG + Intergenic
1072338635 10:94423817-94423839 CTACTGTTTCAGAGAAGGAATGG + Intronic
1073140189 10:101242177-101242199 CACCTGTATTAGAGAATAAAAGG - Intergenic
1073520507 10:104124270-104124292 CTCCAGATTTAGAGTAGAAAAGG + Intronic
1075327513 10:121546210-121546232 CTGTTGTTTAAGAAGAGAAATGG + Intronic
1075810176 10:125219281-125219303 CCCCTGGTTTAGAGCAGACACGG - Intergenic
1078839531 11:15065486-15065508 CATTTGTTTTAAAGGAGAAAGGG + Intronic
1080139452 11:28898488-28898510 CTCCTATATAAGAAGAGAAAGGG - Intergenic
1080328360 11:31106392-31106414 GTCCCTTTTTAAAGGAGAAATGG - Intronic
1080962353 11:37175342-37175364 AACTTGTTTCAGAGGAGAAATGG - Intergenic
1081888331 11:46518661-46518683 CAAATGTTTTAGAGCAGAAATGG - Intronic
1082299617 11:50490343-50490365 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1085714586 11:78861320-78861342 CTCCTTTTGAAGAGGAGAAAAGG + Intronic
1087500593 11:98948137-98948159 CTGTTTTTTTGGAGGAGAAATGG - Intergenic
1087726811 11:101727995-101728017 CTGCTGTTTCAGAGAAGAACTGG + Intronic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1088746387 11:112808193-112808215 CTCCTGTTTTAGTGGAAGAAGGG + Intergenic
1089625147 11:119746323-119746345 CTCCTGTTCTTTAGAAGAAAGGG + Intergenic
1090628217 11:128624339-128624361 TTCCTGTTTTTGAAGAGAAGAGG + Intergenic
1091776877 12:3190428-3190450 CTCCTGTTTTCCAGGAGCAGTGG + Intronic
1092314784 12:7399000-7399022 CTCATGTTTTATAAGATAAAGGG + Intronic
1093232145 12:16559270-16559292 CACCTGTTTTATATGATAAATGG - Intronic
1094820840 12:34222998-34223020 CTTCTGTTTGAGAAAAGAAATGG + Intergenic
1094865745 12:34528417-34528439 CGTTTGTTTTAAAGGAGAAAGGG - Intergenic
1095573280 12:43706179-43706201 CTCCTGTTTGAGAAGAGGAGAGG - Intergenic
1095590290 12:43895655-43895677 CTCATGTTATACATGAGAAATGG + Intronic
1096269034 12:50149025-50149047 CTACTGTTTTAGAAAAAAAATGG - Intronic
1096833251 12:54330972-54330994 CTCCTGTTTTTGGGCAGAATAGG + Intronic
1097214504 12:57399825-57399847 CTCCTATTTTAGAGAAGAGTAGG - Intronic
1097625067 12:61989925-61989947 GTGCTGTTTTGGAGGTGAAATGG - Intronic
1098492075 12:71093409-71093431 CTTCTGTTTGAGGGGAGAAGAGG - Intronic
1099259444 12:80359245-80359267 CCTCTGTTGTAGAGGAGAAGGGG + Intronic
1099446999 12:82764730-82764752 CTCCAATTTTAAAGGGGAAAGGG + Intronic
1099555334 12:84102786-84102808 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1101208460 12:102512758-102512780 CTTCTGTTTAGAAGGAGAAAGGG - Intergenic
1104213453 12:126712841-126712863 TTCCTTTTTTGGTGGAGAAAAGG - Intergenic
1104213503 12:126713347-126713369 TTCCTTTTTTGGTGGAGAAAAGG - Intergenic
1105460363 13:20579695-20579717 CTTCTGTTTGAGATGAGAAGAGG - Intronic
1107902071 13:45026903-45026925 CTCCTTTGTTAAATGAGAAAGGG + Intronic
1108993091 13:56688972-56688994 CTGCTCTATTAGAGTAGAAAGGG + Intergenic
1109078983 13:57874013-57874035 ATCCTGGTTTAGAGAAGCAAGGG - Intergenic
1109085609 13:57967241-57967263 CTCCAAATTTAAAGGAGAAAGGG - Intergenic
1110740038 13:78984226-78984248 CTACTGTATTATAGGTGAAATGG + Intergenic
1111850777 13:93571781-93571803 TTCATGTTTTAGATGGGAAAGGG + Intronic
1111968189 13:94882216-94882238 GTCATGTTCTAAAGGAGAAAAGG - Intergenic
1112194810 13:97214758-97214780 ATCCTTTATTATAGGAGAAAGGG + Intergenic
1112585310 13:100713780-100713802 CCCCTGTTTAAGAGGAAGAAAGG - Intergenic
1112618107 13:101026372-101026394 CTCCTTTTACAGAAGAGAAAAGG + Intergenic
1112956439 13:105064644-105064666 CTCTTGTTTTGGGGAAGAAACGG + Intergenic
1112956568 13:105066326-105066348 CCCTTGTTTTGGAGAAGAAAAGG - Intergenic
1113437961 13:110307613-110307635 CTCCTGCTTGGGAGTAGAAAGGG + Intronic
1114383773 14:22235732-22235754 CTCCAGATTTAAAGGGGAAAGGG - Intergenic
1115518485 14:34209085-34209107 CTCCTGTTTAAGAGGAAAGGAGG + Intronic
1117566681 14:57000724-57000746 CTCCAGCTTTAGAGGAGCAGTGG - Intergenic
1117937423 14:60922288-60922310 CTCATGATGTAAAGGAGAAATGG + Intronic
1119214221 14:72856284-72856306 CTCCTGTTTTAGAGGAGAAAAGG - Intronic
1119697334 14:76723722-76723744 CTCCTGTTTTTAGGAAGAAAAGG - Intergenic
1120568091 14:86083894-86083916 TTTCTGGTTTAAAGGAGAAAGGG + Intergenic
1122879130 14:104682166-104682188 CTGCTATTCTACAGGAGAAAGGG + Intergenic
1125342148 15:38685738-38685760 CCACCATTTTAGAGGAGAAATGG + Intergenic
1125567670 15:40689490-40689512 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1126861242 15:52885013-52885035 CTCCTGATTTCCAGAAGAAAGGG + Intergenic
1128595479 15:68943533-68943555 CATCTGTTTTTGAGGTGAAATGG + Intronic
1128932814 15:71720719-71720741 CTCATATTTTAGACCAGAAATGG + Intronic
1130757761 15:86783957-86783979 CTGCTGGTTTAGAGGAGGAATGG + Intronic
1132416723 15:101625615-101625637 GTCCTGGTGTAGAGGAGGAAGGG - Intronic
1134256433 16:12615690-12615712 CTTCTGCTTTATGGGAGAAAAGG - Intergenic
1135015769 16:18923988-18924010 CTCCTGTTGTAGAGGGAACAGGG - Intronic
1135206525 16:20489431-20489453 CTTCTGTTTTGGAGGTGAAGTGG + Intergenic
1135321385 16:21499803-21499825 CTCCTGTTGTAGAGGGAACAGGG - Intergenic
1135374218 16:21931298-21931320 CTCCTGTTGTAGAGGGAACAGGG - Intergenic
1135437568 16:22439416-22439438 CTCCTGTTGTAGAGGGAACAGGG + Intergenic
1135467961 16:22703462-22703484 CTCCTGGTTTAATGGAGCAAGGG + Intergenic
1136447560 16:30333008-30333030 CTCCTGTTGTAGAGGGAACAGGG - Intergenic
1136525632 16:30828145-30828167 ATCCTGTGCTAGAGGAGAAATGG + Intergenic
1137295131 16:47085033-47085055 CTGCTGTCTTAGAGGATAAAAGG + Intronic
1137377558 16:47966083-47966105 ATCCTATTTTACAGAAGAAATGG + Intergenic
1138239272 16:55413375-55413397 CTTCTGTTTTACATGGGAAATGG - Intronic
1138296917 16:55894604-55894626 TTACTGTTTTTGTGGAGAAATGG - Intronic
1138767763 16:59624461-59624483 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1144166085 17:12612095-12612117 CTACAGTTCTAGATGAGAAAGGG - Intergenic
1145801486 17:27688758-27688780 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1147017171 17:37501501-37501523 CTCCTGTTTTAGACTTGGAATGG - Intronic
1148656988 17:49292233-49292255 CTCCAGTTTTGGAGGAGAACTGG + Intronic
1148943721 17:51239544-51239566 CTTCTGATTTAGAGGTAAAAGGG - Intronic
1149537673 17:57444915-57444937 CTCCTGTTTGAGTGCTGAAAGGG - Intronic
1150222586 17:63505481-63505503 CCCCTGTGTTAGAGGAGAGGTGG + Intronic
1150650036 17:67004250-67004272 CCCCTGTGTTAGGAGAGAAAAGG + Intronic
1152056814 17:78035065-78035087 CTCTCATTTTAGATGAGAAATGG - Intronic
1153355595 18:4131606-4131628 CTCCTGCTTTAGAGGACTAGAGG + Intronic
1153389377 18:4536765-4536787 TTCCTGCCTTACAGGAGAAAAGG + Intergenic
1153471006 18:5445385-5445407 CTCCTGTTTAAGTGCAAAAATGG + Intronic
1153564648 18:6407374-6407396 CTATAGTTTTAGAAGAGAAAGGG + Intronic
1154932649 18:21016408-21016430 ATCCTGTATTAAAGGATAAATGG - Intronic
1156956043 18:42964660-42964682 CTCCAAATTTAAAGGAGAAAGGG - Intronic
1157404362 18:47410681-47410703 CCCCTGCATTAGAGGAGAGATGG + Intergenic
1157463466 18:47923823-47923845 CTACTGGTTTCGAGCAGAAATGG + Intronic
1157598218 18:48876593-48876615 CTCCTGTTTCAGAGGCCAGAGGG - Intergenic
1158621717 18:59038399-59038421 GCCCTATTTTAGATGAGAAATGG + Intergenic
1159422720 18:68244255-68244277 CTCCTGTTTCAGCTTAGAAAGGG + Intergenic
925725526 2:6867096-6867118 GTACTGTCTTAGAGAAGAAAAGG - Intronic
926287695 2:11502996-11503018 CTCATGTTGGAAAGGAGAAAGGG + Intergenic
926315847 2:11708953-11708975 CCCCTTTTATAGAGGGGAAATGG + Intronic
926435438 2:12833100-12833122 CTCACTTTGTAGAGGAGAAAAGG - Intergenic
926535709 2:14108813-14108835 CTCATTTTTCAGAGGACAAATGG + Intergenic
927364151 2:22274709-22274731 CTCCAGTTTCAGAGGAAATAAGG + Intergenic
927374037 2:22392607-22392629 CTCAGGTTATAGAGGACAAAAGG - Intergenic
927424189 2:22962977-22962999 CTCATGTTTAAGGTGAGAAATGG - Intergenic
928601153 2:32904752-32904774 TTTCTGTTATAGAGGATAAAGGG + Intergenic
930305733 2:49672342-49672364 CTCATGTTATAGGGGAGATAGGG - Intergenic
930809820 2:55528790-55528812 CTACTGTTTTGCAGTAGAAATGG + Intronic
930867076 2:56132647-56132669 CTCATGTTACAGATGAGAAACGG + Intergenic
931143356 2:59488216-59488238 CAGCTGTTTTAGAAGAGAAATGG - Intergenic
931397325 2:61899197-61899219 CTCCTGCTTTAAAGAAGAAAAGG - Intronic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
931566013 2:63616325-63616347 CTCCTGTTTTAGGAAAGAAAAGG + Intronic
931743936 2:65275101-65275123 CTCCTGTTTTAGGGGCTAAGAGG + Intergenic
931918506 2:66986204-66986226 TTTCTGTTCAAGAGGAGAAATGG - Intergenic
932144130 2:69304302-69304324 CTCCAGTGTGACAGGAGAAAAGG + Intergenic
933104643 2:78308905-78308927 ATTCTTTTATAGAGGAGAAATGG - Intergenic
934095551 2:88599754-88599776 CTACTGCTTTAGAGGAAAAGAGG - Intronic
934899497 2:98146728-98146750 CTCCTAGTTTAGAGGAAAAAAGG + Intronic
935142337 2:100364396-100364418 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
937359980 2:121222822-121222844 TTCCTTCTTTAGAGGAGAAGCGG - Exonic
939276244 2:140000677-140000699 CTCTTCTTTTAGAAGAGAAGTGG + Intergenic
939601363 2:144195073-144195095 CACCTGTTTTACAGGAAAAAAGG - Intronic
939678743 2:145104625-145104647 CTGCTGTTTTAGAGGGGACAAGG + Intergenic
940007165 2:149018519-149018541 ATCCTTTTTAAGAGGAGAAAAGG - Intronic
942042341 2:172079086-172079108 CTCTTCTTTTAGAGAAGGAAGGG - Intronic
942408885 2:175685734-175685756 CTCCTTTCTTAGAGCAGAGATGG + Intergenic
942817785 2:180072320-180072342 GTCATGTTTGAAAGGAGAAAAGG - Intergenic
944656878 2:201884275-201884297 AACCTGTTTTAAAGGAGAAGGGG - Intronic
944717036 2:202384929-202384951 CTACTGTCTTGAAGGAGAAAGGG - Intronic
944856885 2:203776595-203776617 ATGCTATTTTAGAGAAGAAATGG + Intergenic
946348131 2:219127778-219127800 CTGCAGTTTAAGAGGAGATAAGG - Intronic
946831955 2:223736485-223736507 CCTCTGTTTTAAGGGAGAAAGGG - Intergenic
947084338 2:226434352-226434374 CTCCAGTATTAGTGGAGAGATGG - Intergenic
947983502 2:234429269-234429291 CTGCTGACTTGGAGGAGAAAGGG - Intergenic
948337513 2:237221945-237221967 CTCCTTTTTGAGATGAGAACCGG - Intergenic
1169720449 20:8670645-8670667 CTCCAGATTTAGGGGAAAAATGG + Intronic
1169759220 20:9073308-9073330 CTCCTGTTCTAGAGAAGAAAGGG - Intronic
1170795914 20:19546605-19546627 CTCCTTTTTTTGAGGGGAAAGGG + Intronic
1170812828 20:19687903-19687925 CTCCTGTGTATGAGGAGACATGG + Intronic
1171084380 20:22223959-22223981 TGCCAGTTTTAGAAGAGAAAGGG + Intergenic
1171433340 20:25100992-25101014 ACCCTGATTTAGAGTAGAAAAGG + Intergenic
1174740190 20:53005424-53005446 TTCCTGTTCCAGAGGAGAAATGG + Intronic
1174925893 20:54759497-54759519 CTCCTCTTTAACAGGAGGAAAGG - Intergenic
1175226388 20:57446621-57446643 CTCCAAATTTAAAGGAGAAAGGG + Intergenic
1175337869 20:58207704-58207726 CTCCTGGCTTTGAGGAGAAATGG - Intergenic
1175884680 20:62282934-62282956 CACATGTTTTATGGGAGAAATGG - Intronic
1176915410 21:14620054-14620076 GGCCTGTTTCAGGGGAGAAAGGG + Intronic
1177254708 21:18645937-18645959 CTACTGTTTTAGAGTAACAAAGG - Intergenic
1177749494 21:25262755-25262777 CTCCAAATTTAAAGGAGAAAGGG - Intergenic
1178050765 21:28744556-28744578 CTCCTGTTTCATAGTAGCAAAGG + Intergenic
1178805200 21:35833647-35833669 CTCCTGTGATCAAGGAGAAAAGG - Intronic
1180645388 22:17334382-17334404 CTCCTGTTGTTGATGACAAACGG - Intergenic
1181730399 22:24842151-24842173 GTCCTGCCTTAGAGGAGCAAAGG + Intronic
1181894979 22:26099238-26099260 CTCCTGGTTAAGAGGAGGACTGG + Intergenic
951018470 3:17756116-17756138 CTGCGGTTTTAGAGGGGAAGTGG + Intronic
952389413 3:32866822-32866844 CTGCTGTTGGAGAGGAGTAATGG + Intronic
952411630 3:33054778-33054800 TTTTTGTTTTAGAGGAGGAAGGG - Intronic
952741574 3:36739250-36739272 CTCCTGGTGTAGAGGAGACTGGG - Intronic
953146551 3:40281371-40281393 CTGCTGTTTTGGAGGAACAAAGG - Intergenic
953185925 3:40638428-40638450 CTTCACTTTTAGAGAAGAAATGG + Intergenic
954728509 3:52637320-52637342 CTCCATTTTTAATGGAGAAAAGG - Intronic
956090255 3:65659049-65659071 TTCCTATTTTATAGAAGAAAAGG + Intronic
956125610 3:66008408-66008430 CTCATGTTTTAGAGACTAAATGG - Intronic
956411468 3:68984325-68984347 ATTCTGTTTTACAGGAGAGATGG + Intronic
957958474 3:87219736-87219758 CTGCTGTTGAAGATGAGAAAGGG + Intergenic
961437917 3:126932125-126932147 GTCTTCTTTTAGAGGAGAGAGGG + Intronic
961682666 3:128609202-128609224 CTCATGTTTCAGAGGGGAAATGG - Intergenic
961922838 3:130446006-130446028 CATTTGTTTTAAAGGAGAAATGG + Intronic
962503510 3:136020802-136020824 GCTCTGTTTCAGAGGAGAAATGG + Intronic
962960897 3:140310098-140310120 CTGCAGTCTTAGAGGAGAAAGGG - Intronic
963449166 3:145455649-145455671 AACCTCTTTTAGAAGAGAAATGG - Intergenic
963704202 3:148665509-148665531 CTGCTGTTTTCCAAGAGAAATGG - Intergenic
964533523 3:157694425-157694447 CTTCTGTTTTAGTAGAGACATGG + Intergenic
965976493 3:174630330-174630352 CTCCTGTTTTAGAGAAAACCTGG + Intronic
966403440 3:179570215-179570237 CCCATTTTTTAGAGGTGAAATGG - Exonic
967174340 3:186849208-186849230 CTCCTGTTTCCCAGCAGAAAAGG + Intronic
967442547 3:189525932-189525954 CTACTGTGTCAGGGGAGAAAGGG + Intergenic
967725923 3:192862326-192862348 CTTATGTTTCAGAGGAGAGAGGG - Intronic
969008895 4:4044635-4044657 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
969150055 4:5161682-5161704 GTCCTGCTATAAAGGAGAAAAGG + Intronic
969667322 4:8567560-8567582 CTCCAAATTTAAAGGAGAAAGGG + Intronic
969856520 4:10004116-10004138 CCTCTGTTTTAGGGGAGAAGAGG + Intronic
970686139 4:18569789-18569811 GTCCTGTTTCAGAAGAGTAAAGG - Intergenic
971670849 4:29555273-29555295 CTACTGTTCAAGAGGAAAAATGG + Intergenic
973158857 4:46992306-46992328 ATCCTGCTGTAGAAGAGAAAAGG + Intronic
973716947 4:53686189-53686211 CTCCTGTCTTAGAAGAGGAATGG - Intronic
974630390 4:64480540-64480562 CTCCTGCTTTAGGAGAGAAGAGG - Intergenic
975401993 4:73949404-73949426 CCCTTATTTTAAAGGAGAAAGGG + Intergenic
975955049 4:79826904-79826926 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
976526532 4:86098585-86098607 CTCCTGTTCTAGTGGATATATGG - Exonic
977273600 4:94948588-94948610 CTCCTGTTTTTGAGGAGGTCAGG + Intronic
978672763 4:111271012-111271034 CTCATGTTTTAGGGAGGAAAGGG - Intergenic
980084086 4:128373658-128373680 CTCCTTATTTGGAGGAGACAGGG - Intergenic
980978751 4:139635909-139635931 CATTTGTTTTAAAGGAGAAAGGG - Intergenic
981999933 4:151013245-151013267 CACCTGTGTTAGAGGATAACAGG - Intronic
982088957 4:151864037-151864059 CTCGTGGCATAGAGGAGAAAGGG - Intergenic
982122092 4:152152525-152152547 CTCTTCTTTTAGGAGAGAAAGGG + Intergenic
982266872 4:153545885-153545907 CTCCTGTTATAGAAGCAAAATGG + Intronic
983087846 4:163469182-163469204 CTCCTGGGTTAGAGCAGAACAGG - Intergenic
983770337 4:171541233-171541255 CCCCTGTTTTAAAGGACAAAAGG + Intergenic
985096326 4:186416334-186416356 CTCCTGTTTTTGAGGAGAAAAGG + Intergenic
985292371 4:188399801-188399823 CTCCTGATTTAAAGGGAAAAGGG + Intergenic
985421557 4:189789686-189789708 CTCGTTATTAAGAGGAGAAAAGG + Intergenic
985654730 5:1124272-1124294 TCACTGTTTTCGAGGAGAAAAGG + Intergenic
986800278 5:11252909-11252931 CTCTTGATTTAGAGGGGAGAAGG - Intronic
987213861 5:15712829-15712851 GTCAAGTTTTAGAGGAGAAGAGG - Intronic
988215715 5:28269613-28269635 CTTCTTTTGGAGAGGAGAAATGG + Intergenic
988809404 5:34769587-34769609 CTAGACTTTTAGAGGAGAAAAGG + Intronic
989318674 5:40110238-40110260 CATTTGTTTTAAAGGAGAAAGGG - Intergenic
990509306 5:56475922-56475944 CTCCTGTTTTCAGGAAGAAAAGG + Intronic
990517980 5:56548280-56548302 GTACTGTTTTAGGGGAGTAAGGG + Intronic
990685600 5:58297271-58297293 CCCCTGTGTTAGAAGTGAAATGG - Intergenic
990861119 5:60328840-60328862 CTCCTGTTTTCAGGGAAAAAAGG - Intronic
992559460 5:77936014-77936036 CTCCTCTTTTACAGGCGAGAGGG + Intergenic
994106775 5:95958681-95958703 CACCAGTTTTGCAGGAGAAAAGG + Intronic
994332714 5:98526204-98526226 CTCCTGGTTTATAAAAGAAATGG - Intergenic
994853589 5:105088274-105088296 AGCCTGTCTTAAAGGAGAAACGG - Intergenic
995492675 5:112708854-112708876 CTCCTTTATTAGTGGAGCAAGGG + Intronic
997181485 5:131833118-131833140 ATTCTGTTTTAAAAGAGAAACGG - Intronic
998658001 5:144204348-144204370 CTGGTGTTTTAAAGGGGAAATGG + Intronic
998911387 5:146964142-146964164 CTCATGTTTAAGAGGATAATAGG - Intronic
999334371 5:150702966-150702988 CTCCAGACTTAAAGGAGAAAAGG - Intergenic
999958065 5:156723990-156724012 CTCATGTTCCAGAGGAGAGATGG + Intronic
1002297703 5:178240536-178240558 CTCCTGTTTCAAAGGAGACAAGG + Intronic
1003339983 6:5211011-5211033 CTCTTGTTTTAGTGGAATAAAGG - Intronic
1004390974 6:15209511-15209533 TTCCTCTTTTGGAGGAGAAATGG - Intergenic
1007814583 6:44512141-44512163 CTACTGGTTTTGAGGATAAATGG + Intergenic
1008449313 6:51631881-51631903 CTCCCCTTTTAAAGGAGAAGAGG + Intronic
1008729379 6:54461675-54461697 CTCCTCTTTTAGAGGTGTTAGGG + Intergenic
1011026994 6:82880275-82880297 CTCCTGGTTCAGAGAAGAAAGGG + Intergenic
1011994735 6:93571206-93571228 CGCATGTTATAGAGGAGAAGAGG - Intergenic
1012049083 6:94316728-94316750 TTCCTAATTTGGAGGAGAAATGG - Intergenic
1012141433 6:95631223-95631245 ATTCTGTTTTAAAGGAGAAATGG + Intergenic
1012640585 6:101606811-101606833 TTCCTGCATTAGAGGAAAAATGG + Intronic
1014535054 6:122605041-122605063 CTCCTTTTGTATAGCAGAAAGGG - Intronic
1015620234 6:135124244-135124266 CTCCTGGTTTACAGAAGAGAGGG - Intergenic
1015656701 6:135526543-135526565 CTTCTGTTTTAGTGGAATAAAGG + Intergenic
1016549440 6:145260728-145260750 CTGCTATTTGAGAGGAGGAATGG - Intergenic
1017028718 6:150202509-150202531 CTCCTGGTTGAGAGGAGCCAGGG - Intronic
1017890638 6:158635892-158635914 CTCCTCTTCTAGAGGTGAAGGGG - Intergenic
1019069262 6:169328620-169328642 CTCTTGTTTTCCAGGAGAAGGGG - Intergenic
1020968829 7:14907227-14907249 CTCCTGTAAAAGAGGAGAATTGG - Intronic
1023252698 7:38282409-38282431 CTCCTGTTTTAGAGCAATTAAGG + Intergenic
1023316966 7:38948092-38948114 TTGCTGTTTCAGAGGTGAAAGGG - Intergenic
1024553274 7:50581492-50581514 CATTTGTTTTAAAGGAGAAAGGG - Intergenic
1024555946 7:50603865-50603887 CTCATTTTAAAGAGGAGAAAAGG - Intronic
1024834929 7:53505597-53505619 CTCCTGTGTTGGAGAATAAAAGG + Intergenic
1024880716 7:54082527-54082549 CTCCAGCTTAAGAGGAGAATGGG - Intergenic
1025278723 7:57609297-57609319 CTGCTGATTTAGAGGTGCAATGG + Intergenic
1026529709 7:71186260-71186282 CTCCTCTTGGAGAGGATAAAGGG - Intronic
1028307358 7:89282547-89282569 CTCCTGTTTAAGAGGAGAGGGGG - Intronic
1028612200 7:92724294-92724316 CCATTGCTTTAGAGGAGAAATGG - Intronic
1030114640 7:106054001-106054023 CTCCTGTTTCAGGGGAGTAAGGG + Intergenic
1030577427 7:111306654-111306676 GTCCAGTTTTAAAGCAGAAAAGG + Intronic
1031062714 7:117070308-117070330 CTCCTTTTACAGATGAGAAATGG - Intronic
1032592603 7:133206026-133206048 CTTCTGTTTTAGAGGAAAAGTGG + Intergenic
1032689097 7:134265005-134265027 CTCCTGTTTGAGAGCAGGACTGG - Intergenic
1032756313 7:134893863-134893885 CTCCAGATTTAAAGGGGAAAGGG + Intronic
1033110753 7:138572920-138572942 CTGTTGTTTTGTAGGAGAAAAGG - Intronic
1033741646 7:144280598-144280620 CTCATGTTTGTGAGAAGAAAGGG - Intergenic
1033752255 7:144369016-144369038 CTCATGTTTGTGAGAAGAAAGGG + Intronic
1034288882 7:149911626-149911648 CTCCTATTTAAGAGGAGCAGTGG + Intergenic
1036649334 8:10632326-10632348 CTCCATTTCCAGAGGAGAAAAGG - Intronic
1037068244 8:14610272-14610294 CTCCTGTTTTCAGGGAGAAAAGG - Intronic
1037157937 8:15728586-15728608 CTCCTGAGTTAGGGGAGAATGGG + Intronic
1038149626 8:24930745-24930767 CCCATGTTTCAGATGAGAAAAGG - Intergenic
1038436473 8:27540109-27540131 TTCCTGCCTTAGAGGAAAAACGG + Intronic
1039880677 8:41623658-41623680 CTGATGTTTTAGAGAAGCAATGG - Exonic
1041968441 8:63708599-63708621 GTGCTGTTGTACAGGAGAAAGGG + Intergenic
1043189957 8:77206455-77206477 CTCTTGTCTCACAGGAGAAATGG + Intergenic
1043261495 8:78205237-78205259 ATCCTCTGTCAGAGGAGAAAAGG + Intergenic
1044264634 8:90167134-90167156 CTCATGTTCTAAAGGAGAGAAGG - Intergenic
1045706072 8:104924674-104924696 CTCCTTATTGATAGGAGAAAGGG + Intronic
1045733430 8:105267536-105267558 CTTCTGTTTGAGAAGAGCAAAGG - Intronic
1047958860 8:129996357-129996379 TTCCTGGTTTAGATGTGAAAGGG + Intronic
1048009835 8:130446650-130446672 CTCCTGGTAGAGAGGAGAAAGGG - Intergenic
1048579572 8:135719894-135719916 CTCCTGTGTCAGAGGAGTCAGGG + Intergenic
1048763457 8:137822080-137822102 CTCCAATTTTAAAGGGGAAAGGG + Intergenic
1048887227 8:138918228-138918250 CTCCTGTTTTAGACAAGGTAGGG + Intergenic
1048935905 8:139356884-139356906 CTCATGGTTTAAAGAAGAAATGG - Intergenic
1051506383 9:17831734-17831756 CTCCTTTCTTATAGGAGAAAGGG - Intergenic
1053794765 9:41716204-41716226 GGCCTGTTATAGAGAAGAAAAGG + Intergenic
1054150409 9:61598615-61598637 GGCCTGTTATAGAGAAGAAAAGG - Intergenic
1054183176 9:61928263-61928285 GGCCTGTTATAGAGAAGAAAAGG + Intergenic
1054470185 9:65529721-65529743 GGCCTGTTATAGAGAAGAAAAGG - Intergenic
1054655331 9:67660211-67660233 GGCCTGTTATAGAGAAGAAAAGG - Intergenic
1055134370 9:72810165-72810187 AGGCTGTTTTAGAGCAGAAAAGG + Intronic
1055407228 9:75987639-75987661 CTCATGTTTAAGGGGAAAAAGGG + Intronic
1056119250 9:83471067-83471089 CTCCAGTTTTAGGGGGGAGAAGG + Intronic
1056207319 9:84333074-84333096 CTCCAAATTTAAAGGAGAAAGGG + Intronic
1056497897 9:87178123-87178145 CACCTGTCTTTGAGGAGACAAGG + Intergenic
1056808571 9:89746724-89746746 CTGGTGTTTTGGTGGAGAAACGG - Intergenic
1057791939 9:98130437-98130459 CTTCTGTCTTAGAGGAAAAAGGG - Intronic
1058985606 9:110206763-110206785 TTCCTCTGTTAGAGGAGGAAGGG + Intronic
1059397582 9:114047938-114047960 CTGCTGTTGTAGAAGAGAAGTGG + Exonic
1059609086 9:115872399-115872421 GTCCTATTTTAGAGGATAAGTGG + Intergenic
1060993212 9:127860771-127860793 CTCCCGTGATAGCGGAGAAAAGG - Intergenic
1061859949 9:133462862-133462884 CTCATGTGCAAGAGGAGAAACGG + Intronic
1062325965 9:136012617-136012639 ATTCTGTTTTAGAGCAAAAAGGG - Intronic
1186627985 X:11315507-11315529 CCCCTGTTTTAGATGATAAGTGG + Intronic
1187714340 X:22087468-22087490 CTCTTGTTTCAGGGGAAAAAAGG - Intronic
1188546714 X:31315312-31315334 ATCCAGTTTCAGAGGAGAAAAGG + Intronic
1189017894 X:37303215-37303237 CTCCTGTTTTAGAGAGGATTGGG + Intergenic
1189134475 X:38534313-38534335 CTCCTCTTTGAGAGGGGAGAGGG - Intronic
1189452623 X:41152355-41152377 CTACTATTTTAGGGGAGACAAGG - Intronic
1189509322 X:41646159-41646181 CATTTGTTTTAAAGGAGAAAGGG - Intronic
1189557836 X:42163853-42163875 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1189587926 X:42479756-42479778 CTCTTATTTTATAGGTGAAAAGG - Intergenic
1191125293 X:56947686-56947708 CATTTGTTTTAAAGGAGAAAGGG - Intergenic
1191183214 X:57583605-57583627 CTCCTGGGGTAGAGGAGAATAGG + Intergenic
1191214161 X:57918798-57918820 CTCCTGGGGTAGAGGAGAATAGG - Intergenic
1194307153 X:92261013-92261035 CTCCTGTTTTAATAGAGATATGG - Intronic
1194512750 X:94815736-94815758 ATTCTGTTTCATAGGAGAAATGG + Intergenic
1195054837 X:101134251-101134273 CCCCAGTCTTAGAGGATAAATGG - Intronic
1195106121 X:101603040-101603062 CTCCTCTTTGAGAGTAGCAATGG - Intergenic
1195254114 X:103076911-103076933 CTCCAGATTTAAAGGGGAAAGGG - Intronic
1197700012 X:129592342-129592364 CTGCTGTCTTAGGGAAGAAATGG + Exonic
1199276478 X:145949332-145949354 AGGCTGTTTTAGAGGAGAAGGGG - Intergenic
1199391197 X:147281278-147281300 CTTTGGTTTTAGAGGTGAAAAGG - Intergenic
1199391416 X:147283976-147283998 CTTTGGTTTTAGAGGTGAAAAGG - Intergenic
1199391634 X:147286675-147286697 CTTTGGTTTTAGAGGTGAAAAGG - Intergenic
1199485096 X:148338497-148338519 CTTCTGTTTGAGAAGAGCAAAGG + Intergenic
1202246984 Y:22830084-22830106 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1202399973 Y:24463832-24463854 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1202470808 Y:25206254-25206276 CATTTGTTTTAAAGGAGAAAGGG - Intergenic