ID: 1119216297

View in Genome Browser
Species Human (GRCh38)
Location 14:72871713-72871735
Sequence GGCTGTACCCTGCAAAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119216297_1119216302 4 Left 1119216297 14:72871713-72871735 CCTCCACTTTGCAGGGTACAGCC 0: 1
1: 0
2: 4
3: 59
4: 241
Right 1119216302 14:72871740-72871762 TCCTGCGTACTTTCACAGTCTGG 0: 1
1: 0
2: 0
3: 46
4: 432
1119216297_1119216304 30 Left 1119216297 14:72871713-72871735 CCTCCACTTTGCAGGGTACAGCC 0: 1
1: 0
2: 4
3: 59
4: 241
Right 1119216304 14:72871766-72871788 TGAGTCTCTGCAGCTTTTCCAGG 0: 5
1: 596
2: 918
3: 1733
4: 1860

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119216297 Original CRISPR GGCTGTACCCTGCAAAGTGG AGG (reversed) Intronic
900165974 1:1244529-1244551 GGCTGCACCCTGCAGAGAGCTGG + Intronic
900889332 1:5438215-5438237 GGCTGTACCCTGCAAAGCCATGG - Intergenic
902966997 1:20012552-20012574 GGCTGCACCGTGCAAAGTCATGG - Intergenic
904755420 1:32766103-32766125 GGCTGTACCCAGTAAAGTGTGGG - Intronic
905531566 1:38683393-38683415 GGCTTTAACCTGGAAGGTGGAGG + Intergenic
908388629 1:63665495-63665517 GGCTGTACCCAGCAAAGCCACGG - Intergenic
909364032 1:74798911-74798933 GGCTGAACCCTGCAAAGACATGG - Intergenic
909468494 1:76000969-76000991 GGCTGAGCCCAGCAAAGTTGTGG - Intergenic
909755573 1:79221194-79221216 GGCTATACCCTGCAAAGCTACGG + Intergenic
910423860 1:87099992-87100014 GGCTGTACCCTGCAAAGCCATGG - Intronic
911669476 1:100592061-100592083 GGCTGTACCCAGCAAAGCTATGG - Intergenic
911817234 1:102368668-102368690 GGCTGTACCCTGCAGAGCCATGG + Intergenic
911855281 1:102868818-102868840 AGCTGTACCCTGCAAAGTCAGGG - Intergenic
914453776 1:147816607-147816629 GGCTGAGCCCAGCAAAGTTGTGG - Intergenic
916665842 1:166966760-166966782 GTCTTTACCCTGCAATGTGGAGG + Intronic
917485687 1:175452590-175452612 GGCTGTAGCCTGGGAAGTTGGGG + Intronic
918666789 1:187161405-187161427 AACTGTACACTGCAAGGTGGTGG - Intergenic
919626026 1:199910828-199910850 GGCTGAACCCTGGAAGGCGGAGG + Intergenic
919974147 1:202599962-202599984 GGCTCTGCCCTGGAAAGGGGAGG - Intronic
920851711 1:209632574-209632596 GGCTGTTACCTGCACAGCGGTGG + Exonic
922153371 1:223023122-223023144 GACTAATCCCTGCAAAGTGGTGG - Intergenic
922212618 1:223497421-223497443 GCCTCAACCCTGCAGAGTGGAGG - Intergenic
924050874 1:240078541-240078563 GGCTGTACCCTGCAAAGCCACGG + Intronic
924183042 1:241458426-241458448 GACTGTACCCTGCAATGGGATGG - Intergenic
1063481443 10:6380190-6380212 GGCTGTACTCTGCAAAGCTATGG - Intergenic
1063626178 10:7692066-7692088 GGCTGTACCCTGCAAAGCCACGG - Intergenic
1063746206 10:8885095-8885117 GCCTCTGCCCTGCAAAGTGCTGG - Intergenic
1064154103 10:12889331-12889353 AGCTCTACCCTGCAATGTGATGG + Intergenic
1064909476 10:20384537-20384559 GGCTGTGCCCAGCAAAGTCATGG + Intergenic
1065360446 10:24884694-24884716 AACTCTACCCTGCAAAGAGGAGG - Intronic
1067053513 10:43038507-43038529 GGCTGTACCGTGCAATGCTGAGG - Intergenic
1070747465 10:78943017-78943039 TGCTTTAGCCTGCAAAGTTGTGG + Intergenic
1071198917 10:83194899-83194921 GGCTGGACATTTCAAAGTGGGGG - Intergenic
1073181154 10:101584226-101584248 GGCTCAGCCCTGCAAAGTGCTGG - Intronic
1073919556 10:108443277-108443299 TGCTGTACCCAGCAATGTGGAGG + Intergenic
1074373050 10:112915791-112915813 CGCTGTACCCTGCAAAGGCAAGG + Intergenic
1074712956 10:116192738-116192760 GGCTGAACCCTCCACAGTGCTGG + Intronic
1075564864 10:123495808-123495830 GGCTGTAGCCTCCACAGAGGTGG - Intergenic
1076926757 10:133494576-133494598 GGCTGTATCCTGCAAAGCCAAGG - Intergenic
1077350444 11:2090787-2090809 GGTGGGACCCTGCAAGGTGGCGG - Intergenic
1077490657 11:2859445-2859467 GGGTGTACCCTGCACTGCGGAGG - Intergenic
1077659697 11:4056612-4056634 GGCTGGAGACTGCAAAGTGTGGG - Intronic
1079084962 11:17438727-17438749 GGCTGTACCTTGCAAGATGGTGG - Intronic
1079656053 11:22987896-22987918 GGCTGTACCCTGCAAACCATGGG - Intergenic
1079799002 11:24845157-24845179 GGCTGTACCCTGTGAAGCAGAGG + Intronic
1080136155 11:28857383-28857405 GCCTGTACCCTGCAGAGTCATGG - Intergenic
1081021040 11:37947957-37947979 TGCTGCTCCCTGCTAAGTGGGGG - Intergenic
1081669047 11:44933228-44933250 GCCTGTACCCAGCAGAGTGGTGG - Exonic
1083821019 11:65171418-65171440 GGCTGCAGCCGGCAAGGTGGGGG + Exonic
1083893661 11:65609618-65609640 GGCTGTAACCTGAAAAGTAGAGG - Intronic
1084787543 11:71452101-71452123 GGTCGTAGCCTGCAAGGTGGCGG - Intronic
1085476430 11:76792063-76792085 GGCTGCACCCTGCAAAGCCACGG + Exonic
1086503716 11:87479849-87479871 AGCTGTACCCTGCAAAGCCATGG + Intergenic
1087831756 11:102826373-102826395 GGCTGTGCACAGCAAAGGGGGGG + Intergenic
1088021925 11:105130348-105130370 GGCTGTACCCTGCAAAGCCATGG - Intergenic
1088188895 11:107205335-107205357 GGCTGAGCCCTGCAAAGTCATGG - Intergenic
1089559815 11:119338148-119338170 GGCTATGCCCAGCACAGTGGGGG + Intergenic
1089820471 11:121221225-121221247 GCTTGTCCCCTGCCAAGTGGAGG + Intergenic
1090423908 11:126593945-126593967 GTCTGTACTCTGCTCAGTGGTGG + Intronic
1091081435 11:132672628-132672650 GGCTGCAGACAGCAAAGTGGTGG - Intronic
1091086296 11:132724939-132724961 GGCTGTACCCTGCAAAACCACGG - Intronic
1094420311 12:30264026-30264048 GGCTGTACCCTGCAGAGCCACGG + Intergenic
1095345824 12:41147921-41147943 GGCTGTACTCTGCAAAGCCAAGG - Intergenic
1096969213 12:55651977-55651999 GGCTGTACCCTGCAAAGCCATGG + Intergenic
1097406347 12:59194993-59195015 GGCAGTACCCTGCAAAGCCATGG - Intergenic
1097570477 12:61325809-61325831 GGCTGTACCCTGCAAAGCCACGG - Intergenic
1097617205 12:61898164-61898186 GGCTGTACCCTGCAAAGCCATGG - Intronic
1098241455 12:68471376-68471398 GGTTGTCCTCTTCAAAGTGGAGG - Intergenic
1099607605 12:84825443-84825465 TGCTGTACCCTGGAAAATGTAGG + Intergenic
1100603669 12:96133487-96133509 GCCTCCACCCTGCAAAGTGCTGG + Intergenic
1106886907 13:34196693-34196715 GGCTGTCTTCTCCAAAGTGGAGG + Intergenic
1108679158 13:52764570-52764592 AGCTGCAGCCTGCAAGGTGGTGG - Intergenic
1108724274 13:53163447-53163469 GGCTGTACCCTGCAAACCACTGG - Intergenic
1109390225 13:61682916-61682938 GGCTGTACCTTGCAAAGCTATGG + Intergenic
1109810777 13:67509720-67509742 GGCTGTACCCTGCAAAGCCACGG + Intergenic
1109876041 13:68405574-68405596 GGCTGTACCCTGCAAAATGTAGG - Intergenic
1109884019 13:68519202-68519224 GGCTGTCTCCTGCAAGGTGAAGG - Intergenic
1110938820 13:81323405-81323427 GGCCTTACCCTCCAAATTGGGGG + Intergenic
1111539796 13:89655635-89655657 TGCTGTACCCTGCAAAGCCACGG + Intergenic
1111583980 13:90261132-90261154 GGATAAACCCTGCAAAGTGACGG - Intergenic
1113994908 14:16057237-16057259 GCCTGTACCCCGCACTGTGGGGG + Intergenic
1114011829 14:18377075-18377097 GGCTGTACCCTGCAAAGGCACGG + Intergenic
1114680432 14:24479649-24479671 GGCTGTACCCTGCAAATCCAAGG - Intergenic
1114812577 14:25917672-25917694 AGCTGTACCCTGCAAAGCCATGG + Intergenic
1115337316 14:32254837-32254859 GGCTGAAACCTGCAAAGAGGAGG - Intergenic
1116195114 14:41715666-41715688 GACTGTACCCTGCAAAGCAACGG - Intronic
1116303470 14:43217276-43217298 GGCTGTATCCTGCAAAGGTATGG - Intergenic
1117062082 14:51973493-51973515 AGCTCTCCCCTGCAAAGGGGTGG + Intronic
1117749222 14:58903038-58903060 AGCTGTACCCTCTGAAGTGGTGG - Intergenic
1118963966 14:70562114-70562136 GGCTGTACCCTGCAGAGCCATGG + Intergenic
1119216297 14:72871713-72871735 GGCTGTACCCTGCAAAGTGGAGG - Intronic
1119642646 14:76326795-76326817 GGCTGTGCCCTGCACAGAGAAGG + Intronic
1120166698 14:81208681-81208703 GACTGTACCCTGCAAAGCCACGG + Intronic
1121773965 14:96578083-96578105 GGCTGTGGGCTGCAAGGTGGTGG - Intergenic
1122436258 14:101702361-101702383 GGCTGCACCCTGCAAAGGGGCGG + Intergenic
1126942395 15:53780919-53780941 GGCTGTACTCTGCAAACTTCAGG - Intergenic
1130056489 15:80530718-80530740 AGCTTTGCCTTGCAAAGTGGGGG + Intronic
1130632213 15:85580739-85580761 GACTCTTCCCTGCAAAGTGTGGG + Exonic
1130868833 15:87954127-87954149 GCCTGAACCCTGCACAGTGGAGG - Intronic
1131556558 15:93404628-93404650 GGCTGTACCCTGCAAAGCCACGG + Intergenic
1137489954 16:48924008-48924030 CGCTTGAACCTGCAAAGTGGCGG + Intergenic
1142168315 16:88605538-88605560 GGCTGTGCTCTGCAAAGGGTGGG - Intronic
1142290011 16:89189592-89189614 GGCTGGACAGAGCAAAGTGGTGG - Intronic
1143935665 17:10481746-10481768 GGCTGTATCCTGCAAAGCCATGG - Intergenic
1144029862 17:11309959-11309981 GGCTGAAGCCTGAAAAGTGCTGG - Intronic
1145356997 17:22168064-22168086 GGCTGTACCCTGCAAAGCCATGG - Intergenic
1146265673 17:31451043-31451065 GGGTGTAACCTCCAAGGTGGAGG - Intronic
1146678396 17:34789704-34789726 AGCTGTGCCCTGCATGGTGGTGG - Intergenic
1146801508 17:35827454-35827476 CGCTGTGCCCTCCAAAGTGCTGG - Intronic
1146943471 17:36859467-36859489 GGCTCTTCCCTGCAAGGTGAGGG + Intergenic
1147249625 17:39145256-39145278 GGCTGTACCCTGCATGCTGGGGG - Intronic
1151289216 17:73136914-73136936 GGCTTGAACCTGGAAAGTGGAGG - Intergenic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1153779295 18:8479894-8479916 CGCGGTACCCGGCAGAGTGGTGG + Intergenic
1155665821 18:28307279-28307301 GGCTGTACCCTCCAAAGCTACGG + Intergenic
1156154714 18:34287929-34287951 GCCTGTGCCCTCCAGAGTGGTGG + Intergenic
1158868733 18:61663391-61663413 GGCTGTGTCCTGCTAAGGGGAGG - Intergenic
1159357825 18:67359164-67359186 GGCTCTACCCTGCAAAGTCACGG + Intergenic
1160835381 19:1122407-1122429 GACCGTGCCCTGCAAAGTGGGGG - Intronic
1160835390 19:1122440-1122462 GGCTGTGCTCGGCAAAGTAGGGG - Intronic
1160866997 19:1260491-1260513 GTCTGTAGCCTGCAGGGTGGGGG + Intronic
1160869289 19:1269652-1269674 GGCTGTGCCCAGCGAAATGGCGG + Intronic
1160909229 19:1467237-1467259 GCCGGTGCCCTGCAAAGTGGAGG - Exonic
1160957829 19:1701762-1701784 GGCTCTCGTCTGCAAAGTGGGGG + Intergenic
1162941385 19:14011616-14011638 GGCTGGAACCTGGAAGGTGGAGG + Intergenic
1163335024 19:16665404-16665426 ACCTGAACCCTGCAAGGTGGAGG + Intronic
1163636370 19:18438749-18438771 GGCTGTTCGCTGGAAAGGGGAGG + Intergenic
1166517967 19:43461441-43461463 GGCAGTATCCTGCAAAAGGGGGG - Exonic
1168172873 19:54600849-54600871 GAATGTACCCTTCAGAGTGGTGG + Exonic
925816981 2:7763380-7763402 GGCTGTACCCTGCAAAGCCACGG - Intergenic
926103549 2:10136361-10136383 GACAGCACCCTGCACAGTGGAGG - Intergenic
926170837 2:10551683-10551705 GGCTGTCGCATGCACAGTGGCGG - Intergenic
926452885 2:13027280-13027302 TGCTGCACCCTCCAGAGTGGAGG + Intergenic
927340915 2:21982426-21982448 GGCTATACCCTGCAAAGCCACGG - Intergenic
929391302 2:41471835-41471857 GGCTGTACCCTGCAGAGCCATGG + Intergenic
930560050 2:52949760-52949782 AGCTGTACCCTGCAAAGCCACGG - Intergenic
931983802 2:67722223-67722245 GGATGTACCCTGCAAAGCCACGG + Intergenic
932138310 2:69251576-69251598 CTCTGTATCCTGCAAAGTTGGGG - Intergenic
933031462 2:77333897-77333919 GGCTGTACCCTGCAAAGCCACGG + Intronic
934571142 2:95374138-95374160 GGCTGTGCACTGCACAGAGGGGG - Intronic
935121396 2:100186326-100186348 GCCTGTTACCTGCACAGTGGGGG + Intergenic
935215974 2:100975596-100975618 GGGTGTACGCTACAATGTGGTGG + Intronic
935578383 2:104734490-104734512 GGCTGTACCCTGCACAAGGTTGG - Intergenic
936257591 2:110930159-110930181 GGCTGTACCCTGCAAAGCCAGGG + Intronic
936794961 2:116194043-116194065 GGCTATACCCTGCAAAGCCATGG - Intergenic
937827969 2:126388536-126388558 GGCTGTACCCTGCAGAGCCATGG + Intergenic
937935644 2:127241899-127241921 GGCTGTACCCTGCAAAATCATGG - Intergenic
939053309 2:137332189-137332211 GGCTGTACCCTGCAAAGCCACGG + Intronic
939137573 2:138315329-138315351 GGCTGTACCCTGCAAAGCCATGG - Intergenic
940148999 2:150578501-150578523 GGCTGAACCCTGCAAAGCCATGG - Intergenic
941025313 2:160450047-160450069 GGGTGTATGCTGCAGAGTGGAGG - Intronic
942367034 2:175238927-175238949 GGCTATACCCTGCAAAGCCATGG - Intergenic
944272152 2:197796087-197796109 GGCTGTACCCTGCAAAGCCATGG - Intergenic
944615326 2:201453043-201453065 AGCTGCACCCAGCAAAGGGGTGG - Intronic
945618747 2:212107210-212107232 GGCTGGACCCTGCAAAGCCACGG + Intronic
945734923 2:213587248-213587270 CACTGTACCCAGCAAAGTTGTGG - Intronic
947687102 2:232097624-232097646 GGACTTACCCTTCAAAGTGGTGG + Intronic
947699930 2:232224587-232224609 GCCTGCACCTTCCAAAGTGGTGG - Intronic
948040714 2:234899489-234899511 AGCTCTTCCCTGCACAGTGGGGG - Intergenic
948865547 2:240773003-240773025 GGGTGCAGCCAGCAAAGTGGTGG + Intronic
1169041450 20:2498921-2498943 GGCTTGAGCCTGGAAAGTGGAGG - Intronic
1170152124 20:13236871-13236893 GGCTGTACCCTGCAAAGCCCCGG - Intronic
1172549761 20:35789793-35789815 GCCTGTGCCCCACAAAGTGGTGG + Intronic
1173480357 20:43393757-43393779 AGCCCTACCCTGCAAAGTGATGG + Intergenic
1174236463 20:49097280-49097302 TGCTGTTCCCTGGAGAGTGGAGG + Intergenic
1176106715 20:63393084-63393106 GGCTGTGCCCTGACATGTGGGGG - Intergenic
1177393145 21:20502005-20502027 GGCTGTACCCTGCAAAGCCACGG - Intergenic
1179984376 21:44912816-44912838 GGCTGGACCCTGCACCCTGGGGG - Intronic
1179984388 21:44912851-44912873 GGCTGGACCCTGCACCCTGGGGG - Intronic
1179984400 21:44912886-44912908 GGCTGGACCCTGCACCCTGGGGG - Intronic
1179984412 21:44912921-44912943 GGCTGGACCCTGCACCCTGGGGG - Intronic
1179984424 21:44912956-44912978 GGCTGGACCCTGCACCCTGGGGG - Intronic
1179984436 21:44912991-44913013 GGCTGGACCCTGCACCCTGGGGG - Intronic
1179984448 21:44913026-44913048 GGCTGGACCCTGCACCCTGGGGG - Intronic
1179984460 21:44913061-44913083 GGCTGGACCCTGCACCCTGGGGG - Intronic
1179984472 21:44913096-44913118 GGCTGGACCCTGCACCCTGGGGG - Intronic
1179984484 21:44913131-44913153 GGCTGGACCCTGCACCCTGGGGG - Intronic
1180312184 22:11250172-11250194 GCCTGTACCCCGCACTGTGGGGG - Intergenic
1180436322 22:15307883-15307905 GGCTGTACCCTGCAAAGGCACGG + Intergenic
1183044382 22:35208047-35208069 AGCTGTACCCAGCAAAGTCATGG - Intergenic
1184729938 22:46366497-46366519 GGCTGGTCACTGCCAAGTGGTGG + Intronic
1185380574 22:50505878-50505900 GGATGCACCCTGCAGGGTGGAGG - Intronic
949813058 3:8028553-8028575 GTCCGTTCTCTGCAAAGTGGTGG - Intergenic
951192565 3:19787026-19787048 GGCTGTACCCTGCAAACCACAGG + Intergenic
952366446 3:32678925-32678947 GGCTTGAACCTGGAAAGTGGAGG + Intergenic
953151822 3:40332081-40332103 GGCTGGACCCAGCCAAGTTGGGG - Intergenic
953770630 3:45776500-45776522 GGCTCCACCCTGCAAAGTCCAGG + Intronic
955329072 3:58032010-58032032 GGCTTGACCCTGGGAAGTGGAGG - Intronic
957407450 3:79790244-79790266 GGCTGTACCCTGCAAAGCCAAGG - Intergenic
957896273 3:86424623-86424645 GGCTATACCCTGCAAAGCCATGG - Intergenic
958650024 3:96926770-96926792 GGCTGTACCCTGCAAAGCCAAGG - Intronic
959146676 3:102555141-102555163 GCCTCTGCCCTGCAAAGTGCTGG - Intergenic
960538397 3:118838853-118838875 GGCTGTACCCTGCAGAGCCATGG - Intergenic
960599323 3:119440015-119440037 GCCTGGGCCTTGCAAAGTGGTGG + Intronic
961257838 3:125572027-125572049 GGCTGTGCCCTGCAAAGCCACGG + Intronic
963418396 3:145027946-145027968 AGCTGTACCCTGCAAAGCCATGG + Intergenic
964589246 3:158341823-158341845 GGCTGTACCAGGCAAAGTCACGG + Intronic
965012084 3:163107183-163107205 GGCTGTACTCTGCAAAGCCATGG - Intergenic
965112786 3:164448849-164448871 AGCTGTACCCTGCAAGCTGCAGG + Intergenic
965708032 3:171529428-171529450 TGCTTTAGCCTCCAAAGTGGTGG + Intergenic
965899286 3:173618746-173618768 GGCTGAATCCTGGAGAGTGGTGG + Intronic
966024432 3:175258736-175258758 GTATGTCCCCTGCAATGTGGGGG + Intronic
966833668 3:184032621-184032643 GGCAGGACACTGTAAAGTGGCGG + Intronic
967505204 3:190245822-190245844 GGCTGTACTCTGCAAAGTCATGG - Intergenic
968940183 4:3633625-3633647 GGCTGTCCCCTGCAGAGAGATGG + Intergenic
971248778 4:24954237-24954259 GGCTGTACCCAGCAAAGCCATGG - Intronic
972859386 4:43148719-43148741 AGCTGTACCCATCAGAGTGGTGG - Intergenic
974797153 4:66767184-66767206 GGCTATACCCTGCCAAGTCACGG + Intergenic
976127975 4:81854093-81854115 AGCTATACCCTGCAAAGCCGTGG - Intronic
977070241 4:92376413-92376435 GGCTATACCCTGCAAAGCCATGG - Intronic
977395709 4:96468476-96468498 GGCTGTTCCCTGCAAAGCACAGG - Intergenic
977545111 4:98367592-98367614 GGCTATACCCTGCAAACAAGAGG + Intronic
977831468 4:101599054-101599076 GGCTGTCCCCTGCAAACTGGGGG + Intronic
978327851 4:107579371-107579393 GGCAGTTTCCAGCAAAGTGGCGG - Intergenic
981540817 4:145844594-145844616 GGCTTGAGCCTGCAAAGTGGAGG + Intronic
982100102 4:151959201-151959223 GGCTTTCCCTTCCAAAGTGGTGG - Intergenic
984135830 4:175937049-175937071 GTCTGTACCCTTGAAAGTGCTGG - Intronic
985386215 4:189450970-189450992 GGCTATGCCCTGCCCAGTGGTGG + Intergenic
986129021 5:4910123-4910145 GGCTATACCCTGTAAAGTTATGG - Intergenic
987464399 5:18254400-18254422 GGTTGTACATAGCAAAGTGGTGG + Intergenic
989132736 5:38123990-38124012 GGCTGTACCCTGCAAAGCCAAGG - Intergenic
990984326 5:61626885-61626907 GACTGCACCCAGGAAAGTGGAGG - Intergenic
991535969 5:67669612-67669634 GGCTGAACCCTGCAAAGCCATGG + Intergenic
992854812 5:80849215-80849237 GGCTGTACCCTGCAAAGCACAGG - Intronic
992914221 5:81432495-81432517 GGCTGTGCCTTCCAAAGTGCTGG - Intronic
993514047 5:88807305-88807327 GGTTTGACCCTGGAAAGTGGAGG - Intronic
993690768 5:90996746-90996768 GGCTGTACCCTGCAGAGCACAGG + Intronic
994443142 5:99836128-99836150 GGCTGTACCCTGCAGAGCCATGG + Intergenic
995132799 5:108647983-108648005 GGCTGAACCCTGCAAAGCCATGG + Intergenic
995283238 5:110358267-110358289 GGCCGTACCCTGCAAAGCCACGG + Intronic
995459564 5:112388653-112388675 AGCTGTCCACTGCAAAGTTGGGG - Intronic
995686323 5:114776425-114776447 GCTTGTGCCCTCCAAAGTGGTGG + Intergenic
996098167 5:119420896-119420918 GGCTGTACCCTGCAAAGCTGGGG + Intergenic
996196396 5:120611944-120611966 GGCTGTACCCTGCACAGCCATGG + Intronic
997849253 5:137316133-137316155 GGATGTACCGTCCAAAGGGGAGG + Intronic
998919263 5:147049775-147049797 GACTGGACTCTGCAATGTGGTGG + Intronic
998948538 5:147367313-147367335 GCCTTGGCCCTGCAAAGTGGTGG + Intronic
1002068156 5:176662803-176662825 GTCAGTACCCTGCAAAGAGAGGG + Intergenic
1003259732 6:4506429-4506451 GGCTGTACCCTGCATAGCCTCGG - Intergenic
1005968098 6:30741859-30741881 GGCAGAACCCTGCAAGGTGTGGG + Exonic
1007889352 6:45271825-45271847 GGCTGTACCCTGCAAACAGAGGG + Intronic
1010845573 6:80702763-80702785 GCCTGTACCCTGCAAAGCCACGG + Intergenic
1011544549 6:88469212-88469234 AGCTGAACCCTGCAAAGTCACGG + Intergenic
1011835992 6:91432373-91432395 GGCTGAAGCCTGGAAAGTCGAGG - Intergenic
1014977921 6:127912048-127912070 GGAAGTACCCTGCAAAGTCATGG + Intronic
1020124736 7:5527064-5527086 GGGTGAACCCTGCAAAAGGGTGG - Intergenic
1020470170 7:8526083-8526105 GGCTGTATCCTGCAAAGCCATGG + Intronic
1020755003 7:12190898-12190920 GGCTATACCCTGCAAAGCCACGG - Intergenic
1022107381 7:27206106-27206128 GGCTGTTCCTTGAAAAGTGCTGG - Intergenic
1022213778 7:28237648-28237670 CGCTGGCCACTGCAAAGTGGTGG + Intergenic
1022439785 7:30424126-30424148 GGCTGTTCACTGCTGAGTGGCGG - Intergenic
1023623742 7:42096646-42096668 GGCTGCTCCAGGCAAAGTGGAGG - Intronic
1026207482 7:68270809-68270831 GGTTGCACCCTGCAAGGGGGTGG + Intergenic
1029292005 7:99509236-99509258 GGCTCTGCCTTCCAAAGTGGTGG + Intronic
1029425478 7:100491511-100491533 GGCTTTACCCTGGGAGGTGGAGG + Intronic
1031607315 7:123785146-123785168 GGCTGCAGCCTGGAAAGTGGAGG - Intergenic
1031669770 7:124528563-124528585 GGCTGTACCCTGCAAAGCCATGG - Intergenic
1031919724 7:127591710-127591732 GTCTGTAGCCTGCAAAGGAGAGG + Intronic
1034552993 7:151832938-151832960 CACTGTCCCCTGAAAAGTGGGGG + Intronic
1035014302 7:155751469-155751491 GGCTGGACCCTGAAAGGTGGGGG - Intronic
1036089697 8:5652172-5652194 AGCTGTACCCTACTAAGTGAAGG - Intergenic
1036204081 8:6792727-6792749 GGCTGCACCCTCCAGAGGGGAGG - Intergenic
1036561533 8:9903745-9903767 GGCTTTTTCCTGCAAAGCGGAGG + Intergenic
1039309281 8:36298026-36298048 GGCTGTACCCTGCAAAGCAATGG + Intergenic
1039511420 8:38095050-38095072 GGCTGTACCCTGTAAAGCCATGG + Intergenic
1041097086 8:54361005-54361027 TGCTATACACTGTAAAGTGGGGG + Intergenic
1044303981 8:90616900-90616922 GGCTGTACCCTGCAAAGCCATGG + Intergenic
1045351842 8:101348507-101348529 GGCTGTCCCTGGCAAAGTAGAGG - Intergenic
1046004071 8:108458181-108458203 GGATGTACCCTGCAAAGCCATGG - Intronic
1048758686 8:137767412-137767434 GGCTGTACCCTGCAGAGCCATGG + Intergenic
1048806595 8:138246835-138246857 GACTGTACCCTGCAAAGTCAAGG + Intronic
1049039945 8:140105020-140105042 GGCTGGAGCCGGCCAAGTGGTGG - Intronic
1049109499 8:140634803-140634825 GGCTGTCGCCTGGAAAGGGGAGG - Intronic
1049161871 8:141103092-141103114 AGCTGTGCCCAGCAAGGTGGTGG - Intergenic
1049601177 8:143508350-143508372 GCCTGTGCCCTGCACAGGGGAGG + Intronic
1054450573 9:65401672-65401694 GGCTGTCCCCTGCAGAGAGATGG - Intergenic
1055470687 9:76607607-76607629 GGCTCCACCATGCAAAGTGAGGG + Intergenic
1056646617 9:88417719-88417741 GGCTTTGGCCTGCAAAGTGCTGG + Intronic
1057339408 9:94186022-94186044 GGCTTGAACCTGGAAAGTGGAGG - Intergenic
1058082176 9:100712162-100712184 GGCTGTACCCTGCAAAGCACAGG - Intergenic
1059195768 9:112369345-112369367 GTCTGTACCCTGCAAAGCCATGG + Intergenic
1060210530 9:121707435-121707457 GGCTGCCCACTGAAAAGTGGAGG - Intronic
1061129099 9:128697943-128697965 GGCTTGAACCTGCTAAGTGGAGG - Intergenic
1061592882 9:131609447-131609469 GGCTGTACCCTGCAGAGCTGTGG - Intronic
1186053370 X:5623975-5623997 GCCTGTACCCTGCAAAGCCATGG + Intergenic
1186194591 X:7098336-7098358 TGCTGTACCCTCCAGAGGGGAGG + Intronic
1186679262 X:11854742-11854764 AGCTGTACCCTGCAAAGCCACGG - Intergenic
1188325473 X:28796654-28796676 GGCTGTACCCTGCAAAGCCACGG - Intronic
1189384638 X:40527341-40527363 GGCTATCCCCTGCAAAGTAAAGG - Intergenic
1189880571 X:45487242-45487264 GGCTGTGCCCAGCAAAGTGATGG + Intergenic
1190385749 X:49880769-49880791 GCCTGTACCCTGCTAAATGGCGG - Exonic
1190531758 X:51385921-51385943 GGCTGTACCCTGCAGAGCCACGG - Intergenic
1192270497 X:69575022-69575044 GGCTGTATCCTGCAAAGCCATGG - Intergenic
1193328298 X:80207514-80207536 GGCTGCCCCCTGCCAAATGGGGG - Intergenic
1194467112 X:94246512-94246534 GGCTGTACCCTGCAAAGCCACGG + Intergenic
1195035151 X:100965534-100965556 GGCTGTCCCCTGCAAAGCCATGG + Intergenic
1196196965 X:112846750-112846772 GTCTGTACCCTGAAAGGTGGTGG + Intergenic
1197223206 X:123932742-123932764 GGCTATACCCTGCAAAGCCATGG + Intergenic
1197442799 X:126511702-126511724 GGCCGTACCCTGCAAAGCCATGG - Intergenic
1197689695 X:129485181-129485203 GGCTGTACCCAGCAAAGCCCTGG + Intronic
1198121120 X:133593446-133593468 GGCTGTTCTCACCAAAGTGGAGG + Intronic
1200295315 X:154913767-154913789 GGCTGTACCCTGCAAAGCTATGG - Intronic
1200423193 Y:2994518-2994540 GCCTCTGCCTTGCAAAGTGGTGG + Intergenic
1200437190 Y:3165728-3165750 GGCTGAGCCCTGCAAAGTGACGG - Intergenic
1200758040 Y:7009945-7009967 GGCTGGAACCTGGAAAGTGGAGG + Intronic