ID: 1119219147

View in Genome Browser
Species Human (GRCh38)
Location 14:72892750-72892772
Sequence CCCCGCCCGGACGAAGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 324}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119219147_1119219153 -5 Left 1119219147 14:72892750-72892772 CCTGCGGCTTCGTCCGGGCGGGG 0: 1
1: 0
2: 1
3: 17
4: 324
Right 1119219153 14:72892768-72892790 CGGGGAAGTCCCGGTCGAAGGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1119219147_1119219164 28 Left 1119219147 14:72892750-72892772 CCTGCGGCTTCGTCCGGGCGGGG 0: 1
1: 0
2: 1
3: 17
4: 324
Right 1119219164 14:72892801-72892823 CCAGCCCACCTCGGATACGGAGG 0: 1
1: 0
2: 0
3: 6
4: 72
1119219147_1119219165 29 Left 1119219147 14:72892750-72892772 CCTGCGGCTTCGTCCGGGCGGGG 0: 1
1: 0
2: 1
3: 17
4: 324
Right 1119219165 14:72892802-72892824 CAGCCCACCTCGGATACGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 58
1119219147_1119219152 -6 Left 1119219147 14:72892750-72892772 CCTGCGGCTTCGTCCGGGCGGGG 0: 1
1: 0
2: 1
3: 17
4: 324
Right 1119219152 14:72892767-72892789 GCGGGGAAGTCCCGGTCGAAGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1119219147_1119219157 19 Left 1119219147 14:72892750-72892772 CCTGCGGCTTCGTCCGGGCGGGG 0: 1
1: 0
2: 1
3: 17
4: 324
Right 1119219157 14:72892792-72892814 GAGGACCCCCCAGCCCACCTCGG 0: 1
1: 0
2: 5
3: 22
4: 268
1119219147_1119219151 -7 Left 1119219147 14:72892750-72892772 CCTGCGGCTTCGTCCGGGCGGGG 0: 1
1: 0
2: 1
3: 17
4: 324
Right 1119219151 14:72892766-72892788 GGCGGGGAAGTCCCGGTCGAAGG 0: 1
1: 0
2: 0
3: 3
4: 72
1119219147_1119219160 25 Left 1119219147 14:72892750-72892772 CCTGCGGCTTCGTCCGGGCGGGG 0: 1
1: 0
2: 1
3: 17
4: 324
Right 1119219160 14:72892798-72892820 CCCCCAGCCCACCTCGGATACGG 0: 1
1: 0
2: 2
3: 17
4: 115
1119219147_1119219154 0 Left 1119219147 14:72892750-72892772 CCTGCGGCTTCGTCCGGGCGGGG 0: 1
1: 0
2: 1
3: 17
4: 324
Right 1119219154 14:72892773-72892795 AAGTCCCGGTCGAAGGGGTGAGG 0: 1
1: 0
2: 2
3: 2
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119219147 Original CRISPR CCCCGCCCGGACGAAGCCGC AGG (reversed) Intronic
900117034 1:1033321-1033343 CCCCGCCAGGGCGGGGCCGCGGG + Intronic
901100471 1:6715378-6715400 TCCCTCCCGGACGGAGCGGCTGG + Intergenic
901341318 1:8501139-8501161 CCCCTCCCGGACGGGGCAGCTGG - Intronic
902018877 1:13328950-13328972 CCCCTCCCGGACGGGGCGGCTGG - Intergenic
903077840 1:20786374-20786396 CCCCGCCCGCAGAAGGCCGCGGG + Intronic
903081471 1:20815850-20815872 CCCCTCCCGGACGGGGCGGCTGG - Intronic
903251119 1:22053369-22053391 CCCCGCCCAGAGGACGCGGCCGG - Intronic
903497395 1:23778722-23778744 CCCCGCCCGCCCCAAGCCCCAGG - Intronic
903637731 1:24833449-24833471 CCCCTCCCGGACGGGGCGGCTGG + Intronic
903921405 1:26803578-26803600 TCCCTCCCGGACGGAGCGGCTGG + Intergenic
904077688 1:27853719-27853741 TCCCTCCCGGACGAGGCGGCTGG - Intergenic
904077709 1:27853768-27853790 TCCCTCCCGGACGAGGCGGCTGG - Intergenic
904077755 1:27853867-27853889 TCCCTCCCGGACGAGGCGGCTGG - Intergenic
904077779 1:27853917-27853939 TCCCTCCCGGACGAGGCGGCTGG - Intergenic
904077800 1:27853966-27853988 TCCCTCCCGGACGAGGCGGCTGG - Intergenic
904077942 1:27854290-27854312 TCCCTCCCGGACGAGGCGGCTGG - Intergenic
904782985 1:32964526-32964548 CCGCGCCCGGGCCAAGCCGCAGG - Exonic
904784674 1:32974809-32974831 CCCCTCCCGGACGGGGCGGCTGG + Intergenic
905442780 1:38005561-38005583 CCCCGCCCGGACCCCGCCCCCGG + Intronic
906427331 1:45725088-45725110 CCCCTCCCGGACGGGGCGGCTGG - Intronic
906740138 1:48174423-48174445 CACCTCCCGGACGGAGCGGCTGG - Intergenic
906761624 1:48382872-48382894 CCCCTCCCGGACGGGGCGGCTGG + Intronic
907410916 1:54282667-54282689 CCCAGCCCTGAGGAAGCCACAGG + Intronic
908446306 1:64201621-64201643 CCCCTCCCGGACGGGGCGGCTGG - Intergenic
908544476 1:65149161-65149183 CCCCCCCCTCCCGAAGCCGCCGG + Intronic
909640837 1:77869586-77869608 ACCCTCCCGGACGAGGCGGCTGG + Intronic
912498865 1:110108650-110108672 CCCTGCCTGCACGCAGCCGCTGG + Intergenic
912751981 1:112294011-112294033 CCCCTCCCGGACGGGGCGGCTGG - Intergenic
913994102 1:143638630-143638652 CCCCTCCCGGACGGGGCGGCTGG - Intergenic
917375721 1:174349422-174349444 TCCCTCCCGGACGAGGCGGCTGG + Intronic
917375820 1:174349649-174349671 TCCCTCCCGGACGAGGCGGCTGG + Intronic
919080242 1:192857735-192857757 TCCCTCCCGGACGGAGCGGCTGG - Intergenic
919916949 1:202144671-202144693 CTCCGCCCGCACCGAGCCGCGGG - Exonic
921238069 1:213151745-213151767 TCCCTCCCGGACGAGGCGGCTGG + Intronic
922756942 1:228102102-228102124 CTCGGCCAGGAGGAAGCCGCGGG - Exonic
923278042 1:232415538-232415560 CCCCTCCCGGACACAGCCACAGG - Exonic
1062774647 10:135355-135377 CCCCGCCCGGACCCCGCCGCCGG - Intronic
1064108543 10:12519857-12519879 CCCCTCCCGGACGGGGCGGCTGG + Intronic
1065840521 10:29697116-29697138 TCCCTCCCGGACGGAGCGGCTGG - Intronic
1066085575 10:31970437-31970459 CCCCTCCCGGACGGGGCGGCTGG - Intergenic
1067339831 10:45392013-45392035 CCCCTCCCGGACGGGGCGGCTGG - Intronic
1067732166 10:48820332-48820354 TCCCGCCCGGAGGAAGCTGAGGG + Exonic
1069741105 10:70687251-70687273 TCCCTCCCGGACGAGGCGGCTGG + Intronic
1072648668 10:97276624-97276646 TCCCTCCCGGACGAGGCGGCTGG - Intronic
1072994280 10:100229499-100229521 CCGCGCCCGGCCGCAGCCCCGGG + Exonic
1072999823 10:100277578-100277600 TCCCTCCCGGACGGAGCGGCTGG - Intronic
1073000041 10:100278081-100278103 TCCCTCCCGGACGGAGCGGCTGG - Intronic
1075050783 10:119181900-119181922 CACCTCCCGGACGAGGCGGCTGG + Intergenic
1075050928 10:119182226-119182248 TCCCTCCCGGACGGAGCGGCTGG + Intergenic
1076314772 10:129532506-129532528 CCCCACCCGGAGGAAGGAGCAGG - Intronic
1076774274 10:132685693-132685715 CACCTCCCGGACGGAGCCACCGG - Intronic
1077495355 11:2884469-2884491 CCCCGCCCGCGCGAAGCCGCTGG + Intronic
1078317572 11:10305618-10305640 CCCCGCCCGGGCGGTGCAGCTGG + Exonic
1080098321 11:28431052-28431074 CACCTCCCGGACGGGGCCGCTGG - Intergenic
1082065217 11:47893379-47893401 TCCCTCCCGGACGAGGCGGCTGG - Intergenic
1083091127 11:60201129-60201151 TCCCTCCCGGACGGAGCGGCTGG + Intergenic
1083382608 11:62279452-62279474 TCCCTCCCGGACGAGGCGGCTGG - Intergenic
1083645798 11:64171717-64171739 TCCCTCCCGGACGAGGCGGCTGG + Intergenic
1083813334 11:65117615-65117637 CCCCGCCGGGCAGAAGCCACAGG + Exonic
1084385805 11:68841979-68842001 CCCCGCCCCGCCGAGGCCCCGGG - Intronic
1084721280 11:70907113-70907135 CCCCGGCCAGAGGAAGCAGCTGG + Intronic
1085116471 11:73936279-73936301 TCCCTCCCGGACGGAGCGGCTGG + Intergenic
1085359950 11:75877623-75877645 TCCCTCCCGGACGGAGCGGCTGG + Intronic
1085359998 11:75877750-75877772 TCCCTCCCGGACGGAGCGGCTGG + Intronic
1088604269 11:111513035-111513057 CCCGGCCGGGAAGAAGACGCCGG + Intergenic
1090906888 11:131084337-131084359 CCCCTCCCGGACGGGGCGGCTGG + Intergenic
1092192953 12:6533701-6533723 CCCAGCCCGGAGAGAGCCGCTGG + Intergenic
1095571286 12:43685680-43685702 TCCCTCCCGGACGGAGCGGCTGG - Intergenic
1096396548 12:51270370-51270392 CCCCGAGCGGAGGAAGCCGCGGG + Exonic
1096503524 12:52079689-52079711 TCCCTCCCCGACGCAGCCGCCGG + Intergenic
1097126997 12:56783605-56783627 TCCCTCCCGGACGGAGCGGCTGG + Intronic
1098412895 12:70202588-70202610 CCCCTCCCGGACGGGGCGGCTGG - Intergenic
1099255431 12:80307934-80307956 TCCCTCCCGGACGGAGCGGCTGG + Intronic
1100570514 12:95841009-95841031 CCCCTCCCGGACGGGGCGGCTGG + Intergenic
1100577574 12:95907545-95907567 CACCTCCCGGACGAGGCGGCTGG + Intronic
1100582394 12:95948285-95948307 TCCCTCCCGGACGAGGCGGCTGG - Intronic
1101970730 12:109310104-109310126 CCCCGCCTGGAGCCAGCCGCGGG + Intergenic
1102089470 12:110173363-110173385 CACCTCCCGGACGAGGCGGCTGG - Intronic
1103790332 12:123465771-123465793 CCCTGACCAGCCGAAGCCGCCGG - Exonic
1104049615 12:125186697-125186719 CGGCGCCCGGGCGTAGCCGCCGG + Intergenic
1104712542 12:130996623-130996645 CACCTCCCGGACGAGGCGGCTGG + Intronic
1104712791 12:130997192-130997214 CCCCCCCCGGACGGGGCAGCTGG + Intronic
1105756174 13:23466442-23466464 CCGCGCCCGGAGGAAGCCCACGG - Intergenic
1106104835 13:26724117-26724139 TCCCTCCCGGACGGAGCGGCTGG - Intergenic
1106747054 13:32717041-32717063 TCCCTCCCGGACGAGGCGGCTGG - Intronic
1107165933 13:37280640-37280662 TCCCTCCCGGACGGAGCGGCTGG - Intergenic
1108370400 13:49762174-49762196 TCCCTCCCGGACGAGGCGGCTGG - Intronic
1108610616 13:52080291-52080313 CACCTCCCGGACGAGGCGGCTGG - Intronic
1108618627 13:52159584-52159606 GCCCGCCCCGCGGAAGCCGCCGG - Exonic
1113194109 13:107783087-107783109 CACCTCCCGGACGAGGCGGCTGG - Intronic
1114199446 14:20506914-20506936 CCCCTCCCGGACGGGGCGGCTGG - Intronic
1114427785 14:22637510-22637532 CCCCTCCCGGACGGGGCGGCTGG - Intergenic
1115703536 14:35977378-35977400 CCCCTCCCGGACGGGGCGGCTGG + Intergenic
1117277062 14:54203450-54203472 TCCCTCCCGGACGGAGCAGCTGG - Intergenic
1118209276 14:63751153-63751175 TCCCTCCCGGACGGAGCGGCTGG + Intergenic
1118341009 14:64895315-64895337 CCCCTCCCGGACGGGGCGGCTGG + Intergenic
1118517392 14:66545173-66545195 CACCTCCCGGACGGAGCGGCTGG + Intronic
1119219147 14:72892750-72892772 CCCCGCCCGGACGAAGCCGCAGG - Intronic
1119254515 14:73184659-73184681 TCCCTCCCGGACGGAGCGGCTGG + Intronic
1120632273 14:86905512-86905534 CCCCGCCCCGACGACGCCGTGGG - Intergenic
1120892936 14:89506172-89506194 CACCGCCCGGACGGGGCAGCTGG - Intronic
1123787462 15:23687395-23687417 CCCCGCCCGCCCCCAGCCGCTGG - Intergenic
1126295437 15:47132720-47132742 CCCCTCCCGGACGGGGCGGCTGG - Intergenic
1127154306 15:56110344-56110366 TCCCTCCCGGACGAGGCGGCTGG - Intronic
1127584442 15:60367044-60367066 CCCCTCCCGGACGGGGCGGCTGG - Intronic
1127584492 15:60367142-60367164 CCCCTCCCGGACGGGGCGGCTGG - Intronic
1129054105 15:72807174-72807196 CACCTCCCGGACGAGGCGGCTGG + Intergenic
1129313856 15:74729219-74729241 CACCTCCCGGACGAGGCGGCTGG - Intergenic
1129431275 15:75503568-75503590 TCCCTCCCGGACGGAGCGGCTGG - Intronic
1132879467 16:2155645-2155667 CCCCGCGACGACGAGGCCGCCGG + Intergenic
1134163832 16:11915172-11915194 CCCCGCCCGGCCACCGCCGCGGG + Intronic
1134861088 16:17561258-17561280 CCCCGACCGGATGAACCGGCTGG - Intergenic
1136425892 16:30169250-30169272 TCCCTCCCGGACGGGGCCGCTGG - Intergenic
1136425944 16:30169350-30169372 TCCCTCCCGGACGGGGCCGCTGG - Intergenic
1136572249 16:31104730-31104752 CCCCTCCCGGACGGGGCGGCTGG - Intergenic
1138043657 16:53698789-53698811 CACCTCCCGGACGAGGCGGCTGG - Intronic
1138588055 16:57984591-57984613 GCCCGCGCGGCCGTAGCCGCAGG - Intronic
1141830927 16:86509807-86509829 CCCCGCCCGGGCGGCGCGGCGGG - Intergenic
1142549962 17:732464-732486 CCCCGCCCTATCGCAGCCGCCGG + Exonic
1142818680 17:2447679-2447701 CCCCTCCCGGACGGGGCGGCTGG - Intronic
1142884753 17:2905645-2905667 CCCAGCCAGGAGGAAGCCGGGGG + Intronic
1142939821 17:3371841-3371863 TCCCGCCCGGACGGGGCGGCTGG + Intergenic
1142949304 17:3464992-3465014 TCCCTCCCGGACGGAGCGGCTGG - Intronic
1143719433 17:8799329-8799351 CCCCGCCCGGAGGGAGAGGCGGG + Exonic
1144524578 17:15979583-15979605 CACCTCCCGGACGAGGCGGCTGG + Intronic
1144524811 17:15980127-15980149 CACCTCCCGGACGAGGCGGCTGG + Intronic
1144717160 17:17442953-17442975 TCCCTCCCGGACGGGGCCGCTGG + Intergenic
1144717238 17:17443103-17443125 TCCCTCCCGGACGGGGCCGCTGG + Intergenic
1146216094 17:30979774-30979796 CCCCTCCCGGACGGGGCGGCTGG + Intronic
1146492667 17:33293285-33293307 CCCCGCCCGCCCGGAGCCGCGGG - Intronic
1148016368 17:44524921-44524943 TCCCTCCCGGACGGAGCGGCTGG - Intergenic
1148404360 17:47398037-47398059 TCCCTCCCGGACGGAGCGGCTGG - Intronic
1149891340 17:60392420-60392442 CCCCGCCCGGGCGCCTCCGCTGG + Intronic
1150137670 17:62704388-62704410 CCCAGCCCGGGCGCAACCGCGGG - Intronic
1150265895 17:63832270-63832292 CCCTCCCCGGCCCAAGCCGCTGG + Exonic
1151783794 17:76265456-76265478 CTCCGGCCGGACGCAGACGCGGG - Exonic
1152020269 17:77776818-77776840 CCCCTCCCGGACGGGGCGGCTGG - Intergenic
1152241415 17:79163276-79163298 CCCCGCCTGGGGAAAGCCGCAGG + Intronic
1152352931 17:79793400-79793422 CCGTGCCCGGCCGGAGCCGCGGG + Exonic
1154173813 18:12068541-12068563 CCCCGCGCGGACGATGCCCGCGG - Intergenic
1154265307 18:12874430-12874452 CACCTCCCGGACGAGGCGGCAGG - Intronic
1154990107 18:21592343-21592365 CACCTCCCGGACGAGGCGGCTGG + Intronic
1155956607 18:31960683-31960705 CACCTCCCGGACGAGGCGGCTGG - Intergenic
1157584170 18:48790753-48790775 CCCCGCCCGGCTGGAGCCACGGG + Intronic
1157794109 18:50559633-50559655 CCCCGCGCGGCTGCAGCCGCCGG - Intergenic
1159158124 18:64609248-64609270 TCCCTCCCGGACGAGGCGGCTGG - Intergenic
1160242389 18:77132887-77132909 CCCCACCTGGACGCGGCCGCCGG + Intronic
1160567767 18:79797950-79797972 CTCCGCCCCGAGGAGGCCGCCGG + Intergenic
1160930294 19:1567110-1567132 CCCCGCCCGGCCGGAGCCCCGGG + Intronic
1161310143 19:3589513-3589535 CCCCCCCAGAACGAAGCCGCAGG - Exonic
1161400674 19:4065398-4065420 CCCCGCGCGGGCGAGGCGGCGGG - Intronic
1162255150 19:9483509-9483531 CCCCTCCCGGACGGGGCGGCTGG - Intronic
1162255175 19:9483556-9483578 CCCCTCCCGGACGGGGCGGCTGG - Intronic
1162535762 19:11262254-11262276 CCCCGGCCGGAGGAAGCTGGCGG + Intronic
1163143114 19:15363328-15363350 TCCCTCCCGGACGGAGCGGCTGG - Intronic
1163282399 19:16325603-16325625 CCTCGCATGCACGAAGCCGCCGG - Exonic
1163542347 19:17918666-17918688 TCCCTCCCGGACGGAGCGGCTGG - Intergenic
1164652734 19:29900148-29900170 CACCGCCCGGACGGGGCGGCTGG + Intergenic
1164652919 19:29900552-29900574 CACCGCCCGGACGGGGCGGCTGG + Intergenic
1165192772 19:34079083-34079105 CACCTCCCGGACGAGGCGGCTGG + Intergenic
1165481842 19:36069088-36069110 TCCCTCCCGGACGGAGCGGCTGG + Intronic
1166028265 19:40108053-40108075 TCCCTCCCGGACGAGGCGGCTGG + Intergenic
1166732830 19:45068324-45068346 CCCCCCCCGCACAAAGCCCCAGG + Intronic
1166843348 19:45712180-45712202 CCCGGCCCAGACGATGCCGAGGG - Exonic
1167970787 19:53187165-53187187 CCCCTCCCGGACGGGGCGGCTGG + Intronic
1168637923 19:58010650-58010672 ACCCGCCCAGCCGAAGCCACGGG + Exonic
1168696137 19:58405282-58405304 TCCCTCCCGGACGGAGCGGCTGG + Intronic
925403510 2:3591144-3591166 CCCCTCCCGGACGGGGCGGCTGG + Intergenic
927572840 2:24175122-24175144 CCCTACCGGGACGGAGCCGCGGG + Exonic
927929076 2:27032789-27032811 CCCCGCCCAGGCGAAGAGGCCGG - Intergenic
928005349 2:27557879-27557901 CCCCTCCCGGACGGGGCGGCTGG + Intronic
929218224 2:39437501-39437523 CCGCGCCCGGCCGCTGCCGCCGG + Intergenic
929242375 2:39665948-39665970 TCCCGCCCCGCCGCAGCCGCCGG - Exonic
929739560 2:44588329-44588351 CCCCTCCCGGACGGGGCGGCTGG - Intronic
929739589 2:44588407-44588429 CCCCTCCCGGACGGGGCGGCTGG - Intronic
930727901 2:54699170-54699192 TCCCTCCCGGACGGAGCGGCCGG - Intergenic
931656103 2:64511913-64511935 TCCCTCCCGGACGAGGCGGCTGG + Intergenic
931739283 2:65227773-65227795 CCCCGACCGGAAGCCGCCGCCGG - Intronic
931752103 2:65339071-65339093 TCCCTCCCGGACGGAGCGGCTGG - Intronic
932562762 2:72887479-72887501 CAGCGTCCGGCCGAAGCCGCGGG - Exonic
932901839 2:75710590-75710612 CCCCGCGCGGACGAAGGCTCAGG - Exonic
933907931 2:86913942-86913964 CCCCGCCAGGTCGAGGCCGTCGG - Intronic
935112190 2:100104366-100104388 TCCCGCCCGCCCGAAGCGGCCGG + Intronic
936122787 2:109760785-109760807 TCCCGCCCGCCCGAAGCGGCCGG - Intergenic
936221904 2:110610679-110610701 TCCCGCCCGCCCGAAGCGGCCGG + Intergenic
938534100 2:132221842-132221864 CCCCTCCCGGACGGGGCGGCTGG - Intronic
939578480 2:143922128-143922150 CACCTCCCGGACGAGGCGGCTGG + Intergenic
939584693 2:143991583-143991605 CACCTCCCGGACGAGGCGGCTGG - Intronic
939584786 2:143991806-143991828 CACCTCCCGGACGAGGCGGCTGG - Intronic
940643601 2:156369128-156369150 CCCCTCCCGGACGGGGCGGCTGG - Intergenic
942355672 2:175108343-175108365 TCCCTCCCGGACGAGGCGGCTGG - Intronic
943739932 2:191398259-191398281 CCCCTCCCGGACGGGGCGGCTGG + Intronic
943773418 2:191742068-191742090 TCCCTCCCGGACGGAGCGGCTGG - Intergenic
943773486 2:191742211-191742233 TCCCTCCCGGACGGAGCGGCTGG - Intergenic
943773658 2:191742612-191742634 TCCCTCCCGGACGGAGCGGCTGG - Intergenic
944598536 2:201283059-201283081 CCCCTCCCGGACGGGGCGGCTGG + Intronic
946751155 2:222896440-222896462 CCCCTCCCGGACGGGGCGGCTGG + Intronic
1169085906 20:2824437-2824459 CCCCTCCCGGACGAGGCGGCTGG - Intergenic
1169247091 20:4033122-4033144 CCCCTCCCGGACGGGGCGGCTGG - Intergenic
1170622932 20:18010233-18010255 TCCCTCCCGGACGGAGCGGCTGG + Intronic
1171120932 20:22568429-22568451 CCCCGTCCGGATGAGCCCGCTGG - Intergenic
1171956837 20:31470092-31470114 TCCCTCCCGGACGGAGCGGCTGG + Intronic
1171957292 20:31471150-31471172 TCCCTCCCGGACGAGGCGGCTGG + Intronic
1172222412 20:33283064-33283086 CCCCGCCCGGAGGCAGCCTTGGG - Intronic
1172279442 20:33699582-33699604 CACCTCCCGGACGAGGCAGCTGG - Intergenic
1172279515 20:33699757-33699779 CACCTCCCGGACGAGGCGGCTGG - Intergenic
1172279589 20:33699932-33699954 CACCTCCCGGACGAGGCGGCTGG - Intergenic
1179195305 21:39157626-39157648 TCCCTCCCGGACGGAGCGGCTGG - Intergenic
1179969239 21:44825049-44825071 TCCCTCCCGGACGGAGCGGCTGG - Intergenic
1179969371 21:44825335-44825357 CACCTCCCGGACGAGGCGGCTGG - Intergenic
1180125197 21:45785488-45785510 CCCCTCCCGGACGGGGCGGCTGG - Intronic
1181586327 22:23855106-23855128 CCCCTCCCGGACGGGGCGGCTGG - Intergenic
1182261194 22:29073658-29073680 CCCGGCCCGGGGGAAGTCGCTGG - Intronic
1182538958 22:31027251-31027273 CCCCTCCCGGACGGGGCGGCTGG - Intergenic
1183871535 22:40745149-40745171 CCCCTCCCGGACGGGGCGGCTGG + Intergenic
953350695 3:42213599-42213621 CCCCGCCCGGGCAAAGCTGCAGG - Intronic
955281369 3:57597556-57597578 CACCGCCCGGACGTGGCCCCAGG + Intronic
955362842 3:58289957-58289979 CACCTCCCGGACGAGGCGGCTGG + Intronic
960526636 3:118718444-118718466 TCCCTCCCGGACGGGGCCGCTGG + Intergenic
962245191 3:133785420-133785442 TCCCTCCCGGACGAGGCGGCTGG - Intronic
963911542 3:150820860-150820882 CCCCTCCCGGACGGGGCGGCTGG + Intergenic
966784137 3:183608767-183608789 CCCCTCCCGGACGGGGCGGCTGG - Intergenic
967176160 3:186864508-186864530 CCCCTCCCGGACGGGGCGGCTGG - Intergenic
968411740 4:395973-395995 TCCCTCCCGGACGGAGCGGCTGG - Intergenic
968850451 4:3074468-3074490 CCCCACCCGGGCGAAGGCGCGGG - Intergenic
970216053 4:13761190-13761212 CACCTCCCGGACGAGGCGGCTGG + Intergenic
970472655 4:16393352-16393374 CACCTCCCGGACGAGGCGGCTGG + Intergenic
975685702 4:76917149-76917171 CCCCTCCCGGACGGGGCGGCTGG - Intergenic
976265728 4:83185593-83185615 CCCCTCCCGGACGGGGCGGCTGG + Intergenic
976340767 4:83943600-83943622 CACCTCCCGGACGAGGCGGCTGG + Intergenic
976340818 4:83943727-83943749 CACCTCCCGGACGAGGCGGCTGG + Intergenic
979188170 4:117824618-117824640 CCCCACCCGGATGATGCTGCGGG + Intergenic
979622540 4:122812418-122812440 CACCTCCCGGACGAGGCGGCTGG - Intergenic
981970747 4:150660276-150660298 TCCCTCCCGGACGAGGCGGCTGG - Intronic
982022071 4:151214426-151214448 CACCTCCCGGACGAGGCTGCTGG + Intronic
982709631 4:158746526-158746548 TCCCGCCCGGACGGGGCGGCTGG + Intergenic
982784445 4:159523828-159523850 CACCTCCCGGACGAGGCGGCTGG - Intergenic
982784809 4:159524674-159524696 CACCTCCCGGACGAGGCGGCTGG - Intergenic
984977161 4:185240615-185240637 CACCTCCCGGACGGAGCGGCTGG + Intronic
985783611 5:1883057-1883079 CCCCTCCCGGCCTGAGCCGCCGG - Intronic
989587670 5:43087563-43087585 CCCCTCCCGGACGGGGCGGCTGG + Intronic
989633544 5:43511386-43511408 TCCCTCCCGGACGGAGCGGCTGG - Intronic
990461979 5:56038836-56038858 CACCTCCCGGACGAGGCGGCTGG + Intergenic
991073664 5:62513428-62513450 TCCCTCCCGGACGGAGCGGCTGG + Intronic
992289692 5:75270518-75270540 TCCCTCCCGGACGAGGCGGCTGG - Intergenic
992289715 5:75270567-75270589 TCCCTCCCGGACGAGGCGGCTGG - Intergenic
992289879 5:75270966-75270988 TCCCTCCCGGACGAGGCGGCTGG - Intergenic
992289900 5:75271015-75271037 CACCTCCCGGACGAGGCGGCTGG - Intergenic
992443093 5:76812672-76812694 TCCCTCCCGGACGGAGCGGCTGG - Intergenic
992443134 5:76812763-76812785 CACCTCCCGGACGAGGCGGCTGG - Intergenic
992443262 5:76813068-76813090 CACCTCCCGGACGAGGCAGCTGG - Intergenic
992574736 5:78097405-78097427 CACCTCCCGGACGAGGCGGCTGG - Intronic
996557928 5:124797958-124797980 CCCCACCCGGACGTCACCGCAGG + Intergenic
996765508 5:127030998-127031020 CCCCGCCCGGAGGAAGCTGAGGG + Intergenic
997264993 5:132490319-132490341 GCCCACCCGGACGAGGCTGCCGG - Intronic
997874916 5:137538170-137538192 TCCCTCCCGGACGGAGCGGCTGG + Intronic
1002014102 5:176306058-176306080 CACCTCCCGGACGGAGCGGCTGG - Intronic
1003319365 6:5037829-5037851 CCCCTCCCGGACGGGGCGGCTGG + Intergenic
1003319394 6:5037907-5037929 CACCTCCCGGACGGGGCCGCTGG + Intergenic
1004874760 6:19940501-19940523 CCCCTCCCGGACGGGGCGGCTGG - Intergenic
1005063492 6:21797309-21797331 TCCCGCCCGGAGGGAGCGGCTGG + Intergenic
1005069758 6:21851911-21851933 CCCCTCCCGGACGGGGCGGCTGG + Intergenic
1005158992 6:22837107-22837129 CCCCTCCCGGACGGGGCAGCTGG - Intergenic
1005837370 6:29719084-29719106 CCCCTCCCGGACGGGGCGGCTGG - Intergenic
1005851866 6:29828478-29828500 CCTCGCCCGGACCCACCCGCGGG - Intronic
1005859244 6:29888403-29888425 CCCTGCCCCGACCAACCCGCGGG - Intergenic
1005864405 6:29927113-29927135 CCCCGCCCCGACCAACCCGCGGG - Intergenic
1005905707 6:30260268-30260290 TCCCGCCCCGACCAACCCGCGGG - Intergenic
1006043131 6:31271390-31271412 CCCCGCCCCGACCAACCCGCGGG + Intronic
1006052721 6:31356484-31356506 CCCCGCCCCGACCAACCCGCGGG + Intronic
1006148915 6:31976001-31976023 CACCTCCCGGACGAGGCGGCTGG + Intronic
1006346272 6:33485701-33485723 CCCCCCCCGGACGGGGCGGCTGG + Intergenic
1006419602 6:33924888-33924910 CCCTTCCCGGACGAGGCAGCTGG + Intergenic
1006623706 6:35384188-35384210 TCCCTCCCGGACGGGGCCGCTGG - Intronic
1007783115 6:44265348-44265370 CCCCGGCCGGCCAGAGCCGCGGG - Exonic
1008553638 6:52655852-52655874 CACCTCCCGGACGAGGCGGCTGG + Intergenic
1008926429 6:56894771-56894793 CCCCTCCCGGACGAGGCGGCTGG + Intronic
1010239447 6:73601789-73601811 TCCCTCCCGGACGGAGCGGCTGG - Intronic
1010245853 6:73660584-73660606 TCCCTCCCGGACGAGGCGGCTGG + Intergenic
1011297350 6:85838985-85839007 TCCCTCCCGGACGGAGCAGCTGG - Intergenic
1014246800 6:119078486-119078508 TCCCGCCGGCCCGAAGCCGCGGG + Exonic
1014764022 6:125388809-125388831 CCCCTCCCGGACGGGGCGGCTGG + Intergenic
1016990631 6:149925678-149925700 CCGCTCCCGGACGATGCCCCTGG + Intergenic
1017843213 6:158239022-158239044 CACCTCCCGGACGAGGCGGCTGG + Intronic
1017843265 6:158239149-158239171 CACCTCCCGGACGAGGCGGCTGG + Intronic
1018895801 6:168016169-168016191 ACCCGCCAGGACCAAGCCCCTGG - Intronic
1019428882 7:989418-989440 CCCCGCCCCAAGGAAGCCTCTGG - Exonic
1020204655 7:6105231-6105253 GCCCGCCCGGGCCAGGCCGCTGG + Intronic
1021120215 7:16789793-16789815 TCCCTCCCGGACGGAGCCGCTGG + Intergenic
1021647489 7:22801247-22801269 CACCTCCCGGACGAGGCGGCTGG - Intergenic
1021672379 7:23046344-23046366 TCCCTCCCGGACGGAGCGGCTGG + Intergenic
1022083496 7:27045371-27045393 TCCCTCCCGGACGGAGCGGCTGG - Intergenic
1022393281 7:29961791-29961813 TCCCTCCCGGACGGAGCGGCTGG + Intronic
1024931163 7:54667695-54667717 TCCCTCCCGGACGGGGCCGCTGG + Intergenic
1025103386 7:56151752-56151774 CACCTCCCGGACGAGGCGGCTGG - Intergenic
1025853061 7:65258717-65258739 CCCCTCCCGGACGGGGCGGCTGG - Intergenic
1025853245 7:65259118-65259140 CCCCTCCCGGACGGGGCGGCTGG - Intergenic
1026894803 7:74003771-74003793 CCCTCCCGGGACGAAGGCGCGGG - Intergenic
1027182910 7:75952428-75952450 TCCCTCCCGGACGGAGCGGCTGG + Intronic
1029334504 7:99888255-99888277 CACCTCCCGGACGAGGCGGCTGG + Intronic
1029813936 7:103075045-103075067 CCTCGCCTGGGAGAAGCCGCCGG + Exonic
1030659692 7:112206239-112206261 CGCAGCCCGCGCGAAGCCGCTGG - Exonic
1032291184 7:130591242-130591264 TCCCTCCCGGACGGAGCGGCTGG - Intronic
1032391284 7:131556712-131556734 CCCGGCCCGGCCGCCGCCGCTGG - Intronic
1033186503 7:139231619-139231641 GCCGGCCCGGGCGGAGCCGCCGG + Exonic
1033376071 7:140763202-140763224 CACCTCCCGGACGAGGCGGCTGG + Intronic
1033376167 7:140763428-140763450 CACCTCCCGGACGAGGCAGCTGG + Intronic
1034618090 7:152436065-152436087 CCCCGCCCGCCCGCACCCGCCGG - Intergenic
1034961639 7:155367330-155367352 TCCCTCCCGGACGAGGCGGCTGG + Intronic
1034985384 7:155509948-155509970 CCCCTTCCGGAAGGAGCCGCGGG - Intronic
1035732200 8:1860940-1860962 CCTCGCCGGGAAGATGCCGCAGG + Intronic
1038595280 8:28881451-28881473 CCCCTCCCGGACGGGGCGGCTGG - Intronic
1041070976 8:54125840-54125862 CACCTCCCGGACGAGGCGGCTGG - Intergenic
1042303836 8:67311587-67311609 TCCCTCCCGGACGAGGCGGCTGG - Intronic
1042475852 8:69246211-69246233 TCCCTCCCGGACGAGGCGGCTGG - Intergenic
1043502940 8:80874250-80874272 CGCCGCCCCGCCGTAGCCGCCGG - Intronic
1045120285 8:99028585-99028607 CCCCTCCCGGACGGGGCAGCTGG + Intronic
1051277013 9:15406985-15407007 TCCCTCCCGGACGGGGCCGCTGG - Intergenic
1052858725 9:33423636-33423658 CCCCTCCCGGACGGGGCGGCTGG - Intergenic
1055133823 9:72806188-72806210 CCCCTCCCGGACGGGGCGGCTGG + Intronic
1056169644 9:83971938-83971960 CTCCTCCCGGACGAGGCGGCCGG - Exonic
1057192766 9:93096531-93096553 CCCCGCCGGGTAGAAGCCCCGGG - Intronic
1058659653 9:107257020-107257042 TCCCTCCCGGACGAGGCGGCTGG + Intergenic
1060351868 9:122867382-122867404 TCCCTCCCGGACGGAGCGGCTGG - Intronic
1060352089 9:122868043-122868065 TCCCTCCCGGACGGAGCGGCTGG - Intronic
1060651209 9:125328795-125328817 CACCTCCCGGACGAGGCGGCTGG + Intronic
1060669721 9:125458861-125458883 TCCCTCCCGGACGGGGCCGCTGG + Intronic
1060897275 9:127225646-127225668 CCATGCCCCGCCGAAGCCGCGGG - Intronic
1060970392 9:127734454-127734476 CCCAGCCCCCACCAAGCCGCTGG - Exonic
1061693699 9:132355253-132355275 CCCCACCCGCAGGAAGCCCCGGG - Intergenic
1189837958 X:45041189-45041211 CCCCTCCCGGACGGGGCGGCTGG + Intronic
1189968268 X:46395429-46395451 CCCCTCCCGGACGGGGCGGCTGG + Intergenic
1189968390 X:46395703-46395725 CCCCTCCCGGACGGGGCGGCTGG + Intergenic
1190505142 X:51119389-51119411 TCCCTCCCGGACGGAGCGGCTGG + Intergenic
1190598649 X:52068675-52068697 CCCCGCCCGGACCTAGCCAAAGG - Intronic
1190610175 X:52185398-52185420 CCCCGCCCGGACCTAGCCAAAGG + Intronic
1190779077 X:53578554-53578576 CCCCTCCCGGACGGGGCGGCTGG - Intronic
1191010066 X:55749082-55749104 CACCTCCCGGACGAGGCGGCTGG - Intronic
1192768938 X:74167479-74167501 TCCCTCCCGGACGGAGCGGCTGG - Intergenic
1195269414 X:103215397-103215419 CCCGGCCCGGAGGGAGCCGGCGG + Intronic
1196404221 X:115347145-115347167 TCCCTCCCGGACGGAGCGGCTGG + Intergenic
1198246977 X:134839760-134839782 CACCTCCCGGACGAGGCGGCTGG - Intronic
1200277895 X:154751270-154751292 CCCCCCCCGGGCACAGCCGCTGG - Intronic