ID: 1119223374

View in Genome Browser
Species Human (GRCh38)
Location 14:72926626-72926648
Sequence AGGCGCGGCGAGGAAGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119223361_1119223374 11 Left 1119223361 14:72926592-72926614 CCGCGCTCCCGCTGCAGAGCTCG 0: 1
1: 0
2: 1
3: 11
4: 134
Right 1119223374 14:72926626-72926648 AGGCGCGGCGAGGAAGGCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 153
1119223366_1119223374 4 Left 1119223366 14:72926599-72926621 CCCGCTGCAGAGCTCGGGGTGGG 0: 1
1: 0
2: 3
3: 46
4: 341
Right 1119223374 14:72926626-72926648 AGGCGCGGCGAGGAAGGCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 153
1119223368_1119223374 3 Left 1119223368 14:72926600-72926622 CCGCTGCAGAGCTCGGGGTGGGA 0: 1
1: 0
2: 1
3: 31
4: 230
Right 1119223374 14:72926626-72926648 AGGCGCGGCGAGGAAGGCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119223374 Original CRISPR AGGCGCGGCGAGGAAGGCCA GGG Intronic
900119385 1:1042002-1042024 AGGAGCAGCGGGGACGGCCACGG - Exonic
900126299 1:1070347-1070369 AGGCACGGCCAGGAGGGCCCAGG - Intergenic
900201146 1:1407197-1407219 CTGCGCGGTGAGGAAGACCATGG + Exonic
900564557 1:3325941-3325963 AGGATCGTCGAGGATGGCCAAGG - Intronic
901183166 1:7355725-7355747 AGGGGAGGGGTGGAAGGCCATGG - Intronic
901205424 1:7492189-7492211 ATCCTCTGCGAGGAAGGCCAGGG + Intronic
901490561 1:9594402-9594424 AGGCCCTGCGGGGAAGGCCCAGG - Intronic
901685282 1:10940371-10940393 AGGAGGGAGGAGGAAGGCCAGGG + Intergenic
901744531 1:11363705-11363727 GGGGGCGGTGAGGAGGGCCAGGG + Intergenic
903154780 1:21436194-21436216 AGGCGTGGCGAGGGAGCCCGGGG - Intergenic
903792586 1:25905564-25905586 AGGCGCGGGGAGGAAGGGGGCGG - Intronic
906666034 1:47622757-47622779 AGGCTCTGGGAGGCAGGCCATGG - Intergenic
907136459 1:52142839-52142861 GGGGGAGGAGAGGAAGGCCAGGG + Intronic
914803138 1:150974692-150974714 AGGCGCGGGGAGCCAGGCCTCGG - Exonic
915405414 1:155656425-155656447 AGGGGTGGTGAGGAAGGCCCTGG + Intergenic
916651553 1:166839270-166839292 GGGCGGGGCGGGGAAGGCCGAGG + Intergenic
916719384 1:167472955-167472977 AGGGGCTGCCGGGAAGGCCAAGG - Intronic
918040729 1:180912702-180912724 AGGCGCGGGATGGAAGTCCAGGG - Intergenic
920358080 1:205390918-205390940 AGGGGCAGCGAGGAAGGCAAGGG + Intronic
920944126 1:210512269-210512291 AGGTGGGGCTTGGAAGGCCAAGG + Intronic
922985365 1:229862179-229862201 AGGCCTGCTGAGGAAGGCCACGG + Intergenic
1063367345 10:5499318-5499340 GGGCGCGGCGCTGAAGGCCACGG - Exonic
1065712700 10:28533038-28533060 CGGTGCGGGGAGGAAGGCCGAGG + Intronic
1069844636 10:71362472-71362494 AGGCCCGTAGAGGAGGGCCAGGG - Exonic
1075060154 10:119251473-119251495 AGCTGCGGAGAGGAAGGCCAAGG - Intronic
1076497295 10:130905484-130905506 AGGCTCGGCGGGGATGGCCAGGG - Intergenic
1076911851 10:133394336-133394358 AGGCACGGCGGGGAGGGGCAAGG + Intronic
1080588467 11:33700973-33700995 AGGCGAGGCGAGGCGAGCCAGGG - Intronic
1082093163 11:48105909-48105931 AGCAGCAGCGAGGAAGGGCAAGG - Intronic
1083176225 11:60951804-60951826 AGGCGCGGGGAGGAAGCCTTAGG - Intronic
1083454671 11:62770800-62770822 ATGCAAGGCGAGGTAGGCCAGGG + Intergenic
1084102299 11:66957857-66957879 AGCCGCGGCGTGTAAGGCGAGGG - Intronic
1084911758 11:72395344-72395366 AGGGGCCGGGAGCAAGGCCATGG - Intronic
1088311755 11:108467555-108467577 AGGCGGGGCTAGGAGGGCAATGG - Intergenic
1089563088 11:119355679-119355701 GGGCGGGGGCAGGAAGGCCAGGG + Exonic
1090238262 11:125165070-125165092 AGGGGCGGCGAGGCCGGGCACGG + Intronic
1091778441 12:3199573-3199595 AGGCGGGGTGAGGAAAGGCAAGG + Intronic
1091908474 12:4208989-4209011 AGACACCGCCAGGAAGGCCAGGG + Intergenic
1102782798 12:115579987-115580009 AGGAGCAGTGAGGAAGCCCATGG - Intergenic
1104961565 12:132490561-132490583 ACGCGCGGCCATGGAGGCCAAGG + Exonic
1107779173 13:43879747-43879769 AGGCGGGGCGAGGTGGGCGAGGG + Intronic
1112322982 13:98423943-98423965 AGGCGTGGAGGGGAGGGCCATGG - Intronic
1112467605 13:99657974-99657996 AGGCAGGGCGAGGAAGGCACGGG - Intronic
1117242506 14:53849073-53849095 AGGCGCGGGGAGGGAGGGTATGG - Intergenic
1119223374 14:72926626-72926648 AGGCGCGGCGAGGAAGGCCAGGG + Intronic
1120578662 14:86217792-86217814 AGGGGCGGGCAGGAAGGCGAGGG - Intergenic
1121414873 14:93772508-93772530 AGGCGGGGACAGGCAGGCCATGG + Intronic
1121599867 14:95195398-95195420 AGGCAGGGGGAGGAGGGCCAAGG - Intronic
1122773456 14:104107119-104107141 AGGCGGGGCCAGGTAGGCCATGG - Intronic
1122945612 14:105007320-105007342 AGGCCCAGCGTGGAAGGCAAGGG + Intronic
1124500396 15:30223164-30223186 GGGCACGGCGAGCACGGCCAAGG + Intergenic
1124743177 15:32315502-32315524 GGGCACGGCGAGCACGGCCAAGG - Intergenic
1124966726 15:34437425-34437447 CGGCGCGGCGAGGACGGCGGCGG - Intronic
1127092147 15:55478059-55478081 AGGGGCAGTGAGGAAGGCCCTGG - Intronic
1128374392 15:67065336-67065358 GGGCGCGGGGAGGAAGTCCTGGG - Intronic
1130275284 15:82472985-82473007 AGGCGTGGCCAGGAAGGAAATGG + Intergenic
1130467644 15:84200380-84200402 AGGCGTGGCCAGGAAGGAAATGG + Intergenic
1130496621 15:84473162-84473184 AGGCGTGGCCAGGAAGGAAATGG - Intergenic
1130589936 15:85204978-85205000 AGGCGTGGCCAGGAAGGAAATGG + Intergenic
1131019925 15:89088902-89088924 AGGCTCGGCGAAGAAGGTCCGGG + Intronic
1131536176 15:93239868-93239890 AGGCAGGGGGAGGCAGGCCAGGG - Intergenic
1132978348 16:2721389-2721411 GGGCGCGGCGCGGGCGGCCAGGG + Intergenic
1133021690 16:2969673-2969695 CGGCCCGGCCAGGAACGCCATGG - Exonic
1133095657 16:3443425-3443447 AGACGCGACGAAGAACGCCACGG + Exonic
1133211206 16:4264278-4264300 GGGTGGGGCCAGGAAGGCCACGG - Intronic
1134614860 16:15643202-15643224 AGGCGGGGCGAGGAAGGGGCGGG - Intergenic
1136333064 16:29594721-29594743 CGGCTGGGGGAGGAAGGCCACGG - Intergenic
1137580837 16:49632555-49632577 AGGCAGGGAGAGGAAGGCCTGGG + Intronic
1143621707 17:8084626-8084648 AGGAGAGGCGAGGAAAGCCTGGG - Intronic
1144828969 17:18121330-18121352 AGGGGCGGCGAGGGCGGCCTGGG - Exonic
1146370283 17:32261896-32261918 AAGCGGGGAGAGGAAGGCAAAGG - Intergenic
1150217334 17:63477832-63477854 GGGGGAGGGGAGGAAGGCCAAGG - Intergenic
1150747051 17:67825140-67825162 CGGCTCGGAGAGGAAGGCAAGGG - Intergenic
1151659318 17:75510216-75510238 AGGGGCGGGGAGCAGGGCCAGGG + Intronic
1151969264 17:77449526-77449548 AGGTTCGGAGAGGAGGGCCAAGG + Intronic
1152068606 17:78124508-78124530 AGGCGCGGTGAGGAAGCCCTAGG - Exonic
1152264426 17:79286138-79286160 GGGCTCGGAGAGGCAGGCCAGGG - Intronic
1152287941 17:79423279-79423301 GGGCGTGGCGAGGACGGTCAAGG - Intronic
1152596148 17:81238792-81238814 AGGCCCGGCTTGGAAGGCCCCGG + Intronic
1152853011 17:82648626-82648648 AGGCGAGGCGAGGAAAGGCGGGG + Intergenic
1158954285 18:62524082-62524104 GAGCGCGGCGAGGACGGCGACGG + Exonic
1160340336 18:78084116-78084138 GGGCGGGGTGAGGGAGGCCACGG - Intergenic
1160719252 19:590209-590231 GGGCGCGGCGAGCACGGCCAAGG + Exonic
1160810662 19:1011608-1011630 GGGCGCTGCGGGGAAGGCGATGG + Exonic
1160951410 19:1669338-1669360 AGGCCAGGTGAGGAAGGCCCCGG - Intergenic
1161237491 19:3205119-3205141 AGGCGGGGCGAGGAAGGGCCGGG - Intronic
1161457198 19:4375334-4375356 AGGAGTGGCTAGGAAGGTCAAGG + Intronic
1161471142 19:4457359-4457381 GGGCGCGGCGGGGGAGGCGAGGG - Intronic
1163679475 19:18672379-18672401 AGGCGCCCCGAGGAAGAGCAGGG - Intergenic
1166126317 19:40717215-40717237 AGGCGCCGCGAGGAGGGCGGCGG + Exonic
1166984044 19:46649249-46649271 CGGCGCGGCCAGGGAGGCCTCGG + Exonic
1167748095 19:51364565-51364587 ATGCCAGGCGTGGAAGGCCAGGG + Intronic
926250890 2:11155142-11155164 GGGCGAGGCGAGGTTGGCCACGG + Intergenic
929789799 2:45014086-45014108 GGGCGCGGCGGGCAGGGCCACGG + Intergenic
930730694 2:54725001-54725023 AGCCTCGGCGAGGACGGCCCCGG + Exonic
931253382 2:60551813-60551835 GGGCGCGGCGAGGTCGGGCAAGG + Intronic
934770139 2:96902582-96902604 AGGCCTGGGCAGGAAGGCCATGG - Intronic
935381360 2:102454005-102454027 AGTGGCGGGCAGGAAGGCCAGGG - Intergenic
936351103 2:111713188-111713210 CGGGGAGGTGAGGAAGGCCAGGG + Intergenic
937952742 2:127401132-127401154 AGCCGCTGGGAGGAAGGCCGAGG + Intergenic
937961029 2:127458915-127458937 CGGGGGGGCGAGGGAGGCCAAGG + Intronic
941911715 2:170770872-170770894 GGGCGCGGCGAGGAGGGCCCGGG - Intergenic
946044558 2:216810470-216810492 AGGGGCGGCGAGGAACGCACCGG + Intergenic
1172020677 20:31911581-31911603 AGGCGCAGTGAGGAAGGCCGTGG + Intronic
1174193064 20:48753999-48754021 AGGCGCTGCGTAGACGGCCAAGG - Intronic
1181062450 22:20288159-20288181 AGGAGCGAGGAGGGAGGCCAGGG - Intergenic
1181315794 22:21970281-21970303 AGGCTCGCCTAGGCAGGCCATGG + Exonic
1181876763 22:25945928-25945950 AGGCGAGGCGAGGCAAGGCAAGG - Intronic
1183599566 22:38832155-38832177 TGCAGCGGCCAGGAAGGCCATGG + Intronic
1185087632 22:48749343-48749365 AGGCCCGGCGTGGATGGCCAGGG + Intronic
950940167 3:16884327-16884349 CGGCGCCGAGAGGAAGCCCACGG - Intronic
954616239 3:51970024-51970046 AGGGGCCGTGAGGAAGGGCAGGG + Exonic
961347973 3:126277113-126277135 AGGCATGGCTAGGAAGGCCTTGG + Intergenic
968893678 4:3385943-3385965 AGGGGCGGCGAGTATGGCCCTGG + Intronic
984653073 4:182290053-182290075 AGCCCCGGTGAGGAAGGGCATGG - Intronic
985574110 5:665721-665743 AGGCGTGGTCAGGAAGGGCATGG - Intronic
985995743 5:3596043-3596065 AGGCGCGGGGAGGGAGGCGGAGG - Exonic
986929078 5:12795458-12795480 TGGCGCGGCGTGGAAGAGCAGGG - Intergenic
987595147 5:19988330-19988352 AGCCGCGGAGAGGAGAGCCAGGG - Intronic
993905692 5:93621175-93621197 AGGCGCGGTGAGGGCGGCGAGGG + Intronic
995342340 5:111073412-111073434 AGGGGAGGGGAGGAAGGTCAGGG - Intronic
995402439 5:111757756-111757778 GGGGGCGGGGAGGAAGGCCGGGG - Intronic
996569950 5:124922503-124922525 AGGAACGGGGAGGAAGGCCAAGG + Intergenic
997319276 5:132964002-132964024 AGGCGAGGGGCGGAAGGCCTGGG - Intergenic
1001639805 5:173236250-173236272 AGGCGCGTGGGGGAAGGGCAGGG + Intergenic
1004441862 6:15662316-15662338 AGACGCGGCGCGGAAGGCTGTGG + Intronic
1004924345 6:20403357-20403379 GGGCCCGGCGAGGAAGGCCTGGG - Intronic
1010083093 6:71886696-71886718 AGGCGCGGCGGGAGAGGCGAGGG - Intronic
1013317241 6:108954732-108954754 AGTGGGGGCGAGGGAGGCCAGGG - Intronic
1013372603 6:109483383-109483405 AGGCGGGGCAAGGCAGGGCAAGG + Intergenic
1018612853 6:165661472-165661494 AGCCGGGGTGAGGGAGGCCAGGG - Intronic
1018680744 6:166262997-166263019 AGGAGAGCTGAGGAAGGCCAAGG + Intergenic
1018984775 6:168628091-168628113 AGGCGCGCCCAGGGAGGCCAAGG - Intronic
1019200093 6:170306958-170306980 AGGCACGGCCAGGAAGGCATCGG - Intronic
1021368034 7:19805971-19805993 AGTGGCTGCGAGCAAGGCCATGG - Intergenic
1021653650 7:22854338-22854360 AGGCGCGCCTAGGAAGCGCACGG - Intergenic
1022427613 7:30284375-30284397 AGGCCCCGCGAGGAAGACAAGGG + Exonic
1022989790 7:35695653-35695675 AGGCTCAGCAAGGACGGCCAGGG - Intergenic
1024244856 7:47461519-47461541 AGGGGTGGTGAGGAAGGCCCTGG - Intronic
1026736859 7:72954517-72954539 GGGCCCGGCGAGGAGGGCCGGGG - Intergenic
1026740504 7:72975868-72975890 AGGGGCCGCGAGGAAGGCCCAGG + Intergenic
1026787078 7:73308590-73308612 GGGCCCGGCGAGGAGGGCCGGGG - Intronic
1026797802 7:73377353-73377375 AGGGGCAGTGAGGAAGGCCCAGG + Intergenic
1027103228 7:75389203-75389225 AGGGGCCGCGAGGAAGGCCCAGG - Intergenic
1027106875 7:75410546-75410568 GGGCCCGGCGAGGAGGGCCGGGG + Intronic
1027261517 7:76468081-76468103 AGGAGGGGAGAGGGAGGCCAGGG + Intronic
1027312898 7:76966190-76966212 AGGAGGGGAGAGGGAGGCCAGGG + Intergenic
1029571707 7:101374145-101374167 AGGCCAGGCTGGGAAGGCCAGGG - Intronic
1032402917 7:131636371-131636393 AAGGGCTGCGAGGAAGGCCTGGG + Intergenic
1035031344 7:155863112-155863134 AGGGGCGGCGGGGAGGTCCAAGG - Intergenic
1037262857 8:17027384-17027406 AGGGCCGGCCAGGAAGGCCCAGG - Exonic
1037957151 8:23068802-23068824 AGGCGCGGGGAGCCAGGCCTGGG - Exonic
1038516460 8:28191718-28191740 AGATACGGCAAGGAAGGCCAGGG - Intergenic
1038761218 8:30385067-30385089 CGGCCCGGCGAGGAAGGACCGGG + Exonic
1041742844 8:61175620-61175642 AGGCACAGGGAAGAAGGCCATGG + Intronic
1048553898 8:135457353-135457375 AGGCGCGGCGCGGCAGGGCGGGG + Intergenic
1049156858 8:141072718-141072740 AGCCCCGGCGAGCAAGGCCTGGG + Intergenic
1049814457 8:144591645-144591667 AGCAGAGGCGAGGAAGGGCAAGG + Intronic
1054790059 9:69248223-69248245 AGGTGAGGCGAGGCAGGCCACGG + Exonic
1056831808 9:89923343-89923365 AGGAGCAGCCAGGAAGGCCCTGG + Intergenic
1057739121 9:97696866-97696888 AGGTGCAGCGAAGAAGGCCCGGG + Intronic
1058879990 9:109277742-109277764 TGGGGCTGGGAGGAAGGCCAGGG + Intronic
1061807448 9:133144349-133144371 AGGGGTGGCGAGGAGGACCATGG - Intronic
1062027567 9:134347554-134347576 AGGCTGGGGGAGGACGGCCAGGG + Intronic
1062030282 9:134359054-134359076 AGAGGCCGAGAGGAAGGCCAGGG + Intronic
1062345482 9:136112577-136112599 AAGCCAGGCGGGGAAGGCCAGGG + Intergenic
1062462022 9:136666080-136666102 CGGCGCGGCGGGGAGGGCCGGGG + Intronic
1188498097 X:30799512-30799534 AGGCAAGGCGAGGCAGGGCAAGG - Intergenic
1189335401 X:40168132-40168154 AAGCGCAGCGAGGAAGGACGCGG - Intronic
1190866278 X:54387389-54387411 AGGCGAGGCGAGAGAGGCCAAGG - Intergenic
1191252877 X:58267747-58267769 AGGGGCTGCCAGGAAGGCAATGG + Intergenic
1192231639 X:69269429-69269451 GGGGGCAGCGAGGAAGGGCAAGG - Intergenic