ID: 1119223763

View in Genome Browser
Species Human (GRCh38)
Location 14:72928871-72928893
Sequence CCTTGGGGCTCTCCAGTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 316}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119223763_1119223782 28 Left 1119223763 14:72928871-72928893 CCCCAAACTGGAGAGCCCCAAGG 0: 1
1: 0
2: 0
3: 30
4: 316
Right 1119223782 14:72928922-72928944 TTTTGGCCCCGTGCTAAGGCTGG 0: 1
1: 0
2: 1
3: 2
4: 68
1119223763_1119223775 11 Left 1119223763 14:72928871-72928893 CCCCAAACTGGAGAGCCCCAAGG 0: 1
1: 0
2: 0
3: 30
4: 316
Right 1119223775 14:72928905-72928927 CCCTCCCCCATTCTGAGTTTTGG 0: 1
1: 0
2: 2
3: 22
4: 211
1119223763_1119223781 24 Left 1119223763 14:72928871-72928893 CCCCAAACTGGAGAGCCCCAAGG 0: 1
1: 0
2: 0
3: 30
4: 316
Right 1119223781 14:72928918-72928940 TGAGTTTTGGCCCCGTGCTAAGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119223763 Original CRISPR CCTTGGGGCTCTCCAGTTTG GGG (reversed) Intronic
900413934 1:2526482-2526504 GCTTGGCGTTCTCCAGGTTGCGG + Exonic
900658488 1:3771881-3771903 CCTGGGGGCTCTCCTGGCTGGGG + Intergenic
900712579 1:4123739-4123761 CCCTGGGGCTTGGCAGTTTGGGG - Intergenic
901974884 1:12936541-12936563 TCCTGGGGCTCTGCTGTTTGGGG + Intronic
902010290 1:13265223-13265245 TCCTGGGGCTCTGCTGTTTGGGG - Intergenic
902031069 1:13422639-13422661 TCCTGGGGCTCTGCTGTTTGGGG - Intergenic
902698766 1:18157502-18157524 CCTTGGGAGTCCCCAGCTTGTGG - Intronic
904851513 1:33463112-33463134 CATTTGGCCTCTCAAGTTTGAGG + Intergenic
905490004 1:38336099-38336121 CCTGGAGGCTCACCACTTTGTGG + Intergenic
906196131 1:43931867-43931889 CCTTAGGGCTCACCAGTGGGAGG - Intergenic
906892334 1:49730564-49730586 CCTTGGGGCTCTGCAGTTGCTGG + Intronic
909696333 1:78471978-78472000 CTTTGCTGCTCTCCAGTGTGTGG + Intronic
909907916 1:81221605-81221627 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
911497577 1:98650273-98650295 CTTTGAGGCTCTGCAGTTTCTGG - Intergenic
911935048 1:103959965-103959987 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
912117046 1:106419446-106419468 CCCTGGGGCTCTACAATTAGTGG - Intergenic
915622203 1:157092675-157092697 CTTTGAGGTTCTCCAGATTGGGG + Exonic
916192878 1:162196284-162196306 CATTGGGGCTCACCATTTAGTGG + Intronic
916510485 1:165468749-165468771 ACCTGGGGCTCTTCAGTTTTGGG - Intergenic
918135830 1:181673290-181673312 CTTTGGGGCTGCCCTGTTTGTGG + Intronic
918846870 1:189627198-189627220 CCTTGGGGCTGTACATTTTACGG - Intergenic
919264090 1:195238345-195238367 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
920283247 1:204859864-204859886 CCTTGGCGCCCTCCAGCTTAGGG - Intronic
922141596 1:222893697-222893719 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
922630107 1:227098233-227098255 CCTTGGGGTACTCCAATTTTTGG - Intronic
923328248 1:232899289-232899311 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
923755379 1:236786455-236786477 CTTTGGGGCCCTGCAGTTTCTGG + Intergenic
923786095 1:237070880-237070902 CCTTGGGGCTCTGCAGTTCCTGG - Intronic
924404730 1:243730748-243730770 CCTTGAGGCTCTGCAGTTGCTGG + Intronic
1063724137 10:8618112-8618134 TCTTGGGCCTCTCCAGTCTGTGG + Intergenic
1064010413 10:11730790-11730812 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1064207454 10:13336099-13336121 CCTTCTGGCTCTCCACTTTTTGG - Intronic
1064570278 10:16685428-16685450 CCTTGGGGCTGTTCTGTCTGTGG - Intronic
1065201371 10:23316354-23316376 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
1068083679 10:52348256-52348278 CTTTGGGGCCCTGCAGTTTCTGG + Intergenic
1068134458 10:52938039-52938061 TTTTGGTGCTTTCCAGTTTGGGG - Intergenic
1068226863 10:54117369-54117391 CCTTGGGGTTCTGCAGTTCCTGG - Intronic
1068300377 10:55131343-55131365 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
1068680307 10:59812083-59812105 TCTTGGGTCTCTCCTATTTGTGG - Intronic
1069752166 10:70751765-70751787 CCTTGAAGATCTCCAGTGTGTGG + Intronic
1070096113 10:73339797-73339819 ACCTGGGGCTCTTCAGTTTCTGG - Intronic
1070850823 10:79560323-79560345 CCTAGGTGTTCTCCAGCTTGAGG - Intronic
1070856405 10:79611001-79611023 CCTAGGTGTTCTCCAGCTTGAGG + Intronic
1071450736 10:85789904-85789926 ACTTGGGGCTCTTCAGCCTGGGG - Intronic
1073279394 10:102341522-102341544 CATGTGGGATCTCCAGTTTGGGG - Intronic
1074301714 10:112239722-112239744 CTTTGGGGCTCTGCAGTTCTTGG - Intergenic
1076673336 10:132135109-132135131 CATTGCGGTCCTCCAGTTTGCGG - Exonic
1080660661 11:34293433-34293455 CCTTGGGCCTCTCCACCCTGGGG - Intronic
1082661763 11:55920530-55920552 CTTTGGGGCTCTTCGGTTTCTGG + Intergenic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1083893129 11:65606861-65606883 CCTTGGGCCCCTGCAGGTTGGGG - Intronic
1083916190 11:65745075-65745097 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1084122401 11:67077398-67077420 GCCTGGGGCTCTCCAGTATCTGG + Intergenic
1084233776 11:67772696-67772718 CCAAGTGGCTCTGCAGTTTGAGG - Intergenic
1084448599 11:69218796-69218818 CCTTGGGGGTTTGCATTTTGGGG + Intergenic
1084519698 11:69655761-69655783 CATTGCGGCTCTCCAGTTCCAGG + Intronic
1084970411 11:72768405-72768427 TCTTGGTGGTCTCCATTTTGGGG - Intronic
1085682764 11:78593674-78593696 CCATTTGTCTCTCCAGTTTGGGG + Intergenic
1086002163 11:81996826-81996848 GTTTGGGGCTTTTCAGTTTGAGG + Intergenic
1086084670 11:82942722-82942744 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
1086755199 11:90552485-90552507 CCTTGGTGCACTCCAGCCTGGGG - Intergenic
1086850321 11:91800156-91800178 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1089054990 11:115578141-115578163 CCTGGGGACTGTCCAGTCTGTGG + Intergenic
1089821353 11:121229951-121229973 CCATTTGGCTCACCAGTTTGTGG - Intergenic
1090910052 11:131110897-131110919 CCTTGGGGCTCTGCACTTCCCGG - Intergenic
1092215486 12:6678870-6678892 CCTTGGAGCCCTCCAGCCTGGGG + Intronic
1093317134 12:17666169-17666191 CTTTGGGGCTCTGAAGTTTCTGG - Intergenic
1094472041 12:30811935-30811957 CCGTCAGCCTCTCCAGTTTGAGG - Intergenic
1095310385 12:40691760-40691782 CTTTGGGGCAGTTCAGTTTGTGG - Intergenic
1095737068 12:45569001-45569023 CCTTGGGACTCTGAAGCTTGTGG + Intergenic
1095749606 12:45696405-45696427 CTTTGGGGCTCTGCAGTTCCAGG - Intergenic
1097500338 12:60393097-60393119 CTCTGGGGCTCTGCAGTTTCCGG + Intergenic
1097684322 12:62677449-62677471 CTTTGGGGCTCTACAGTTCCTGG + Intronic
1098519563 12:71420505-71420527 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
1099049678 12:77767729-77767751 CTTTGGGGCTCTGCAGTTTCTGG - Intergenic
1099683247 12:85855671-85855693 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1101026288 12:100609671-100609693 CCTCAGAGCACTCCAGTTTGTGG + Intronic
1102424910 12:112836071-112836093 CCTTGTAGTTCCCCAGTTTGGGG - Intronic
1103085635 12:118060692-118060714 CCTTGGGGATCTCCGTTTTAGGG + Intronic
1106395313 13:29374353-29374375 CCTTGGGCTTATCCTGTTTGTGG - Intronic
1106614141 13:31310776-31310798 CCTTGGGGCTCCGCAGTTGCTGG + Intronic
1107768631 13:43765408-43765430 CCAAGGGGCTCTCCAGGTGGAGG - Intronic
1107841251 13:44459677-44459699 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
1108249690 13:48551755-48551777 CTTTGGGGTTCTGCAGTTTCTGG + Intergenic
1108559273 13:51627170-51627192 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
1108848236 13:54700207-54700229 CCTTGGGGCTCTGTGGTTTCTGG - Intergenic
1108915569 13:55606303-55606325 CCTTGGGGCTCCGCAGTTGCTGG + Intergenic
1108942708 13:55977501-55977523 CCTTGGGGCCCTGCAGTTACTGG + Intergenic
1109348561 13:61146126-61146148 CCTTGGGGCTCTGTGGTTTCTGG + Intergenic
1109837533 13:67878374-67878396 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1109851906 13:68076021-68076043 CTTTGGGGCTCACCAGTTCCTGG + Intergenic
1110186704 13:72683381-72683403 CCTTGGGGCTGTACATTTTATGG + Intergenic
1111337074 13:86838755-86838777 CTTTGGGGTTCTGCAGTTTCTGG - Intergenic
1111474421 13:88726105-88726127 CTTTGGGGCTCTGCAGTTCTTGG + Intergenic
1113940136 13:114014678-114014700 CCTAGGGGATCTCCGGCTTGGGG + Intronic
1114306601 14:21429277-21429299 CCTTGGGGACCTCCAGACTGTGG + Exonic
1114554714 14:23555444-23555466 CCCAGGTGCTCTCCAGTTTCTGG + Intronic
1114776630 14:25490622-25490644 AACTAGGGCTCTCCAGTTTGAGG - Intergenic
1115011984 14:28559581-28559603 CCCTTGGGCTCTGCAGTTGGTGG + Intergenic
1115059187 14:29169368-29169390 CTTTGAGGCTCTGCAGTTTCTGG + Intergenic
1117101740 14:52355670-52355692 CCTTGTGGCTCTCCACTTTATGG + Intergenic
1119223763 14:72928871-72928893 CCTTGGGGCTCTCCAGTTTGGGG - Intronic
1121402859 14:93696222-93696244 TCTAGGGGGTTTCCAGTTTGGGG + Intronic
1122097950 14:99385001-99385023 CCTTTGTGCTCTCCAATCTGTGG + Intergenic
1123041618 14:105492563-105492585 CCTTGCCCCTCTCCAGTGTGAGG + Exonic
1124820966 15:33045075-33045097 CTTTGGGGCTCTGCAGTTTCTGG + Intronic
1125113969 15:36067209-36067231 CTTTGGGGCTCTGCAGTTAATGG - Intergenic
1125337835 15:38645176-38645198 CCTTGAAGTTCTTCAGTTTGGGG - Intergenic
1125920908 15:43525136-43525158 CCTTGGCACCCTCCAGTTTGGGG + Exonic
1127910709 15:63413807-63413829 CTTTGAGGCTCTGAAGTTTGAGG - Intergenic
1128520259 15:68370391-68370413 CCTGGGGACCCTCCAGTCTGAGG - Intronic
1128866497 15:71118525-71118547 CCTTGGGCCTCTCCAGGTCATGG + Intronic
1129458628 15:75688934-75688956 CACTGGGGCCCTGCAGTTTGGGG - Exonic
1130195111 15:81772190-81772212 CCTTGGGGCTCTCCCAGCTGGGG - Intergenic
1130995233 15:88899733-88899755 CTTTGGCTCTGTCCAGTTTGTGG - Exonic
1132496588 16:266299-266321 CTCTGGGGGTCTCCGGTTTGAGG + Intronic
1133067706 16:3221181-3221203 CCCAGGGGCTCTCGTGTTTGGGG + Intergenic
1133994728 16:10739837-10739859 CCTTGAGCCACTTCAGTTTGGGG + Intergenic
1137697094 16:50468624-50468646 CCTTTGGGCTCTCCAATCCGAGG + Intergenic
1138898854 16:61244269-61244291 CCTTGGGGCTCCACAGTTGTTGG - Intergenic
1139011832 16:62644467-62644489 CCTTGGGGCTCCACAGTTGCTGG + Intergenic
1139015561 16:62684812-62684834 CTTTGGGGCTCTGCAGTTCCAGG + Intergenic
1139844652 16:69911544-69911566 CGGTGGGGCTCTCAGGTTTGGGG + Intronic
1142370039 16:89674243-89674265 CCTTGGGGCTCTGCCGTTCCTGG - Intergenic
1143317633 17:6044569-6044591 CCTTTTGACTCTCCTGTTTGAGG + Intronic
1143334456 17:6162010-6162032 TCAGGGGGCTCCCCAGTTTGTGG - Intergenic
1146425395 17:32732879-32732901 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
1146885000 17:36464669-36464691 CCGTGGGGCTCTCCACTTTTCGG - Intergenic
1149358889 17:55872115-55872137 CCTTTGGGCTCTACAGAATGTGG - Intergenic
1150609750 17:66724399-66724421 CCATGGGGGTCTCCAGCCTGTGG + Intronic
1150745472 17:67813333-67813355 CCCTGGGCCTCTCCAGCCTGCGG + Intergenic
1151211450 17:72547565-72547587 GCTTGTGGCTTTCCACTTTGTGG - Intergenic
1152106037 17:78329688-78329710 CCTTGGGGCTTGCCACTGTGGGG - Intergenic
1152738137 17:82007473-82007495 CCTTGGCACTGTCCAGTATGCGG + Intronic
1152800164 17:82327174-82327196 CCTTGGGACCCTCCTGTTTTTGG - Exonic
1153751793 18:8239655-8239677 CTTTTGGTCTCTCCAATTTGGGG + Intronic
1154139112 18:11807720-11807742 CCTTGGCGATCTCCACTTTGTGG - Intronic
1155249222 18:23939309-23939331 TCATGGAGCCCTCCAGTTTGGGG + Exonic
1155802856 18:30131118-30131140 CCTTGGGGCTCCACAGTTGCTGG + Intergenic
1155819269 18:30353464-30353486 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1156216389 18:35002352-35002374 CCTGGGTGGTTTCCAGTTTGGGG + Intronic
1156370387 18:36467446-36467468 CCTAGAAGCTCTCCAGCTTGGGG + Intronic
1157042811 18:44060550-44060572 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1160238602 18:77106012-77106034 CCTTGGGGCTCTTCAGCTGAGGG + Intronic
1163013662 19:14440838-14440860 CCTTGGGACCCTCTAGTTTGGGG + Intronic
1163767586 19:19172074-19172096 CCTTGGGGCACCCCAGTGTATGG - Intronic
1164984515 19:32638629-32638651 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
1165971880 19:39638575-39638597 CCTTGTTCCTTTCCAGTTTGAGG - Intergenic
1166288913 19:41849213-41849235 CCTTGGGGCTCTCCAGAAAGAGG - Exonic
1166311426 19:41965065-41965087 ACTTAGGGGTTTCCAGTTTGGGG - Intergenic
925288587 2:2731388-2731410 CCTTGGAGTTCTCCAGGCTGGGG + Intergenic
925396057 2:3534496-3534518 CCTTGGGGCTCTGCGGTTCCTGG + Intronic
929610528 2:43267639-43267661 CCTTCCGGCTCACCAGATTGTGG + Intronic
930729102 2:54710210-54710232 CTTTAGGGCTCTGCAGTTTCTGG + Intergenic
931976171 2:67646568-67646590 CCTTGGGGCTCTGCAGTTGCTGG - Intergenic
932082517 2:68727819-68727841 CCATCGAGCTCTCCAGGTTGTGG - Intronic
932398170 2:71462378-71462400 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
932401819 2:71486089-71486111 CCTCAGGCCTCTCCAGTTGGTGG + Intronic
933455001 2:82508670-82508692 CTTTGGGGCTCTGCAGTTTCTGG + Intergenic
933717891 2:85375155-85375177 ATTTGGGCCTCTCCTGTTTGAGG + Intronic
934552601 2:95271504-95271526 CCTTGGGGCTGTGGGGTTTGGGG + Intergenic
934652476 2:96100408-96100430 CCCTCGGGCTCTCCAGCCTGGGG - Intergenic
934870978 2:97865090-97865112 AACTGGGGCTCTCCATTTTGGGG + Intronic
935382048 2:102462673-102462695 CCTTGGAGCTCTCTAATTGGGGG + Intergenic
937044142 2:118842146-118842168 GCTGGCGGCTCTCCTGTTTGCGG - Intergenic
937966357 2:127514572-127514594 CCTTGGGGCTCTGCAGTTCCTGG + Intronic
938139040 2:128781754-128781776 CCTTGGGGTTCTCCACTGGGGGG + Intergenic
938957264 2:136310144-136310166 CCTTGGGGATTTCCAGGGTGGGG - Intergenic
939500115 2:142974029-142974051 CCTTGAGGTTATTCAGTTTGTGG - Intronic
940129955 2:150369912-150369934 CCTTGGGGCTCTGCAGTTCCTGG + Intergenic
941131154 2:161651568-161651590 CTTTGGGGCTCTGCGGTTTCTGG + Intronic
941151492 2:161919894-161919916 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
941678621 2:168371290-168371312 CCTTGGGGGTCCCCAGTTCCAGG + Intergenic
941750408 2:169129770-169129792 TCTTTGGGTTCTCCAGTTTATGG - Intronic
942046313 2:172101287-172101309 CCTTGGGGGTTTCCAGCTTTGGG + Intronic
943191131 2:184680877-184680899 CTTTGGGGCTCTGCAGTTGCTGG + Intronic
943191610 2:184685291-184685313 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
943426619 2:187745746-187745768 CTTTGGGGCTCTGCAGTTTCTGG - Intergenic
943426909 2:187749358-187749380 CTTTGGGGCTGTGCAGTTTCTGG - Intergenic
944146844 2:196515035-196515057 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
944274342 2:197818812-197818834 CCCTGATGCTCTCCTGTTTGTGG + Intronic
947715746 2:232338128-232338150 GTTTGGGGCTCTCCTGTTTGGGG - Intronic
948334833 2:237199940-237199962 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
948624863 2:239262679-239262701 CCTTGGGGGTGTCCCGCTTGTGG - Intronic
948837151 2:240631348-240631370 CTTCGGGGCTCTTCACTTTGAGG + Intergenic
1169145914 20:3252254-3252276 CCTTTGGGCTCTTGAGGTTGGGG - Exonic
1169309427 20:4522277-4522299 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1171957748 20:31472971-31472993 CCTTGTGGCTCTCCTGGTTCTGG - Exonic
1172392487 20:34575316-34575338 CCTTGGGCCTCTCCATTCAGGGG - Intronic
1173740235 20:45395049-45395071 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
1173930114 20:46811250-46811272 CCCTGGGGCTTTCCAGCCTGGGG - Intergenic
1174292576 20:49519513-49519535 CCCTGGGGCTCTCCAGTGGTGGG - Intronic
1174451494 20:50623536-50623558 CCTGGGGCCTCTCTAGTTTTGGG + Intronic
1174906936 20:54561565-54561587 CCCTGGGGTTCTACAGTGTGAGG - Intronic
1175994875 20:62807553-62807575 CCTCGTGGCTCGCCAGTTTCTGG - Exonic
1176104691 20:63380455-63380477 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1177112831 21:17049327-17049349 CCTTGGGGTTCTGCAGTTGCTGG - Intergenic
1178420629 21:32440276-32440298 CCAAGTGGCTCTGCAGTTTGAGG + Intronic
1178897598 21:36572297-36572319 CCTTGGGGTCTTCCTGTTTGGGG - Intronic
1178937515 21:36875903-36875925 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
1180086967 21:45512039-45512061 CCATGTGGCCCTCCAGGTTGTGG + Intronic
1184388246 22:44188291-44188313 CCTTGGAGCTTTCCAGACTGAGG - Intronic
1185170867 22:49293238-49293260 CCTGGGGGCTCGTGAGTTTGTGG + Intergenic
953407633 3:42667298-42667320 CCTTGGGGCTCTCTGGTCTCAGG + Intergenic
954286236 3:49621361-49621383 CCCTGGGTCTCTCCAGTGTAAGG + Intronic
955770195 3:62377992-62378014 GCTTGCGGCTCCCGAGTTTGGGG + Intergenic
956296047 3:67714665-67714687 CCTTTGGCTTCACCAGTTTGGGG + Intergenic
957156588 3:76551661-76551683 TCTTGGGGCTTTGCAGTTTCTGG + Intronic
957218142 3:77348224-77348246 CCTTGGGGCTGCCCTGTCTGTGG - Intronic
957417983 3:79930142-79930164 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
957618708 3:82567242-82567264 CCTTGGGACTCTGCAGTTGCTGG + Intergenic
957923162 3:86772784-86772806 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
958141681 3:89570800-89570822 CTTTGGGGCTCTGCAGTTTCTGG - Intergenic
959037560 3:101384440-101384462 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
959122368 3:102247724-102247746 CCTTGGGGAAACCCAGTTTGAGG + Intronic
959327596 3:104956966-104956988 CCTTGGGGCTCGACAGTTGCTGG - Intergenic
959460795 3:106623212-106623234 CCTTGTGGCTCTGCAGTTCTGGG + Intergenic
960816187 3:121675413-121675435 ATTTGGGCTTCTCCAGTTTGGGG - Intronic
961114855 3:124320485-124320507 TGTTGGGGCTCTTCACTTTGTGG - Intronic
961661195 3:128469631-128469653 CCACGGGGCTCTGCAGTTTCCGG + Intergenic
961883393 3:130079235-130079257 CCAAGTGGCTCTGCAGTTTGAGG - Intergenic
965115125 3:164478320-164478342 CTTTAGGGCTCTGCAGTTTCTGG + Intergenic
967519604 3:190414650-190414672 CCTTGGGGCTCCACAGTTGTTGG - Intergenic
968235232 3:197027411-197027433 CCATGGGGCTCTCCAGAATGGGG - Intronic
969513517 4:7633241-7633263 CCTTGTGTGTCTCCAGTTAGCGG - Intronic
969671169 4:8591165-8591187 CCTTGGGGCTCATGAGGTTGGGG - Intronic
969821374 4:9723060-9723082 CCAAGTGGCTCTGCAGTTTGAGG + Intergenic
970670466 4:18391009-18391031 CTTTGGTGCTCTCCATTTTTTGG + Intergenic
970959755 4:21857897-21857919 CTTTGGGGTTCTGCAGTTTCTGG + Intronic
974521520 4:62987132-62987154 CCTTGGGGTTCTGCAGTTGCTGG - Intergenic
974607771 4:64174529-64174551 CCTTGGGGCTCTGCGGTTCCTGG + Intergenic
974615338 4:64272438-64272460 CCTTGGGGTTCTGCAGTTGCTGG + Intergenic
974686732 4:65241539-65241561 CTTTGGGGCTCCGCAGTTTCTGG - Intergenic
974698012 4:65399114-65399136 CTTTGGGGCTTTGCAGTTTCTGG + Intronic
974826396 4:67136307-67136329 GCATGTGGCTCTCCAATTTGGGG - Intergenic
975669909 4:76770649-76770671 CCTGGAGGGTCTCCAGCTTGTGG - Exonic
975905898 4:79211630-79211652 CCTTCTGGCCCTCCAGCTTGTGG - Intergenic
977191821 4:94010416-94010438 GCTTAGGGCTCTCCTGTTTTAGG - Intergenic
977487250 4:97665094-97665116 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
977816155 4:101416324-101416346 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
977911880 4:102546706-102546728 CCTTGGGCCTTTCCAATCTGAGG + Intronic
977980571 4:103316112-103316134 CTTTTTGGCTCTCCAATTTGTGG + Intergenic
978219627 4:106255584-106255606 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
979856455 4:125639099-125639121 CCTTGGGACTCTGCAGTTGCTGG + Intergenic
980007688 4:127559998-127560020 CTTTGGGGCCCTGCAGTTTCTGG + Intergenic
980282392 4:130737864-130737886 CTTTGGGTCTCTGCAGTTTCTGG + Intergenic
983323870 4:166228096-166228118 CTTTGGGGCTCTGCAGTTCTTGG + Intergenic
983492010 4:168399320-168399342 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
983650652 4:170032995-170033017 CCTTTGGGCTCCCCACTGTGAGG - Intronic
984526605 4:180866127-180866149 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
986882020 5:12185632-12185654 CTTGGGTACTCTCCAGTTTGGGG - Intergenic
988081081 5:26416298-26416320 CCTTGGTGCTCTACAGTTCTTGG - Intergenic
991230959 5:64331852-64331874 CCTTGGGGTTCTGCAGTTCCTGG + Intronic
992029589 5:72708475-72708497 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
992441578 5:76801931-76801953 CCTCAGGGCTCTCCAGTGTGTGG + Intergenic
992859924 5:80899435-80899457 TCTTGGGGCTCTCCATTTGAGGG + Intergenic
992887065 5:81169466-81169488 CCTTGGGGTTCCCCAGCTGGTGG + Intronic
994303955 5:98180159-98180181 CCTTCGGGTTCCCCAGTGTGGGG - Intergenic
994692278 5:103034024-103034046 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
995395195 5:111679888-111679910 CCTTGGGGCTCTGCGGTTGCTGG - Intronic
996217412 5:120886856-120886878 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
997256851 5:132435616-132435638 TGTTGGGGCTCACCAGTCTGGGG + Intronic
997270345 5:132531557-132531579 CCTTGGTGCTCTGCTCTTTGGGG + Intergenic
997658774 5:135574612-135574634 GCTTGGTGCTCTGCAGCTTGGGG + Exonic
997681105 5:135751309-135751331 CCTTGAGTCACTTCAGTTTGGGG - Intergenic
1001538050 5:172513545-172513567 CCATCTGTCTCTCCAGTTTGGGG - Intergenic
1001568736 5:172716629-172716651 CTTTGGGGCTCTGCACTTTGGGG + Intergenic
1005498444 6:26409463-26409485 ACTTGGGGCGCTGCAGTCTGGGG + Intronic
1007273050 6:40652898-40652920 CCTTGGGGACCCCCAGTCTGAGG + Intergenic
1007729605 6:43937935-43937957 CCTTGGGGAACCCCAGTCTGAGG - Intergenic
1007736697 6:43986480-43986502 CCTCAGGGATCTCCAGTCTGAGG - Intergenic
1008053055 6:46919763-46919785 CCTAGTGGCTCTATAGTTTGGGG + Intronic
1009643015 6:66362273-66362295 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1009645595 6:66396502-66396524 CCTTGGGGCTCCACAGTTGCTGG + Intergenic
1009782945 6:68293500-68293522 TCTTGGGGGTCTCCAGTTCCAGG + Intergenic
1010846979 6:80720780-80720802 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1011556193 6:88573395-88573417 CCTGGTGGAGCTCCAGTTTGGGG + Intergenic
1011822541 6:91270910-91270932 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1013438508 6:110138284-110138306 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
1014227076 6:118861259-118861281 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
1016076667 6:139804546-139804568 CTTTGGGGCTCTGCAGTTTCTGG - Intergenic
1016237948 6:141890756-141890778 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1016399028 6:143658051-143658073 CGTTTGGCCTGTCCAGTTTGGGG + Intronic
1019134015 6:169897096-169897118 CCATGGGGCTCTCCCGATGGAGG - Intergenic
1019652337 7:2166838-2166860 CCCTGGGCCTCTTCTGTTTGAGG - Intronic
1021455554 7:20826380-20826402 CCTGGGGGCTTTCAAGTTTATGG - Intergenic
1021656977 7:22882288-22882310 CCTGGGGACTCCCCAGTCTGTGG + Intergenic
1022177427 7:27885178-27885200 CCTTTGTGCTATCCAATTTGGGG - Intronic
1022391982 7:29951115-29951137 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
1022511687 7:30938781-30938803 CCTTGGGGATCAGCAGTTTCTGG - Intronic
1024203637 7:47132495-47132517 CCTTAGGGTTATCCTGTTTGAGG + Intergenic
1027376668 7:77557400-77557422 CCTTCTGTCTCTCCAGTTTGGGG + Intronic
1028052170 7:86202124-86202146 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1028053002 7:86208120-86208142 CTTTGGAGCTCTGCAGTTTCTGG - Intergenic
1028054445 7:86225450-86225472 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1028077583 7:86534756-86534778 CCTTTGGGCTCTCAAGGGTGTGG - Intergenic
1032845690 7:135749605-135749627 CCTGTGGGTTTTCCAGTTTGTGG + Intergenic
1033560822 7:142528785-142528807 CCTTGGAGATCTCCTGTTTCTGG - Intergenic
1033684255 7:143624124-143624146 CCTAGGGGCTCTCCTGGTTCTGG - Intronic
1033687432 7:143703343-143703365 CCTAGGGGCTCTCCTGGTTCTGG - Exonic
1033700356 7:143833499-143833521 CCTAGGGGCTCTCCTGGTTCTGG + Intergenic
1036760410 8:11504788-11504810 CCCTGGTGCTCTCCAGCATGTGG + Intronic
1037742182 8:21616608-21616630 CCTTTGTGCTCTCCAGCTAGAGG + Intergenic
1039521473 8:38176033-38176055 GCTTGGGGCTCACCAGCTAGAGG + Intronic
1040786815 8:51176378-51176400 ACTTGGGGCTCTGCAGTTGCTGG - Intergenic
1041274497 8:56143087-56143109 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1042856562 8:73273470-73273492 CCTTGGCCCTCTCCAGACTGTGG + Intergenic
1043662220 8:82758190-82758212 CCTTGGGGCTCTGCAGTTGCTGG - Intergenic
1043707969 8:83377620-83377642 CTTTGGGGCTCTGCAGTTTCTGG - Intergenic
1043750243 8:83925906-83925928 CTTTGGGGCTCTACAGTTCCTGG - Intergenic
1046026715 8:108733229-108733251 CCTTGGGTTGTTCCAGTTTGGGG - Intronic
1046049487 8:109005075-109005097 CCTTAGTGATCTCCAGTTTATGG - Intergenic
1046195817 8:110861262-110861284 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1046674567 8:117094063-117094085 CTTTGGGGCTCTGCAGTTCTTGG - Intronic
1046995084 8:120510455-120510477 CCTAGGCTCTTTCCAGTTTGAGG - Intronic
1048452972 8:134550154-134550176 CCTTGAGCCTCTCCACTTTCAGG - Intronic
1050937303 9:11414251-11414273 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1051499695 9:17763659-17763681 CTTTGAGGCTGCCCAGTTTGTGG + Intronic
1052652301 9:31320840-31320862 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1052691546 9:31821595-31821617 CTTGGGGGCTCTGCAGTTTCTGG + Intergenic
1057179069 9:93020130-93020152 CCTTGGAGCTGTCCAGATTGAGG - Intronic
1058332037 9:103774365-103774387 TCTTTAGGCTTTCCAGTTTGTGG + Intergenic
1058487587 9:105457978-105458000 CCTTGGGGCTCTGCAGTTACTGG - Intronic
1059119217 9:111627070-111627092 CCTTGGCATTCTCCGGTTTGTGG + Intergenic
1061155778 9:128860472-128860494 CTTTCTGCCTCTCCAGTTTGGGG + Intronic
1061571184 9:131478292-131478314 CCTTGGGCCTCTTTGGTTTGGGG + Intronic
1062329215 9:136029625-136029647 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
1062674398 9:137731985-137732007 CCTTGGGGCTCTGCAGTTGCTGG - Intronic
1062703386 9:137919847-137919869 CGTGGGGGCACTCCAGCTTGAGG + Intronic
1187394379 X:18906983-18907005 CCTTGGGGACCTCAGGTTTGCGG - Intronic
1187683561 X:21793458-21793480 CCTTGGGTTTATCCTGTTTGGGG - Intergenic
1187762582 X:22603926-22603948 CTGTGTGTCTCTCCAGTTTGAGG + Intergenic
1187871119 X:23766298-23766320 CTTTGGGGCTCTGCGGTTTCTGG - Intronic
1187956501 X:24523839-24523861 CCCTGGGGCTCTCCATTAAGTGG - Intronic
1193417518 X:81241745-81241767 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
1194000315 X:88420484-88420506 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1194165043 X:90505690-90505712 CCCAGGGGCTCTTCAGTTAGTGG - Intergenic
1198219194 X:134584235-134584257 CTTGGGGGCTCACCACTTTGGGG + Intronic
1199162447 X:144628884-144628906 CCCTGGGGCTCTTCAGTCAGTGG - Intergenic
1199191800 X:144980101-144980123 CCCAGGGGCTCTTCAGTTAGCGG - Intergenic
1199488438 X:148373063-148373085 ACTCGGGGCTCTTCAGCTTGGGG - Intergenic
1199777274 X:151023682-151023704 CCTGGGGACTGCCCAGTTTGTGG - Intergenic
1199977104 X:152900550-152900572 CCTTTGGGCTCTCATGTTTAGGG + Intergenic
1200511308 Y:4083493-4083515 CCCAGGGGCTCTTCAGTTAGTGG - Intergenic
1200922080 Y:8622284-8622306 GCTTGCTGCACTCCAGTTTGTGG + Intergenic
1200977278 Y:9226788-9226810 CACTGGGGCTCTCCAGTTTCTGG - Intergenic
1202133526 Y:21636103-21636125 CTCTGGGGCTCTCCAGTTTCTGG + Intergenic