ID: 1119225600

View in Genome Browser
Species Human (GRCh38)
Location 14:72942611-72942633
Sequence CGGCTGCCGGGAAGAGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119225600_1119225608 3 Left 1119225600 14:72942611-72942633 CCTGGGGCTCTTCCCGGCAGCCG 0: 1
1: 0
2: 2
3: 16
4: 199
Right 1119225608 14:72942637-72942659 CCTGGGGCTCTTCCCAGCAGCGG 0: 1
1: 0
2: 5
3: 38
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119225600 Original CRISPR CGGCTGCCGGGAAGAGCCCC AGG (reversed) Intronic
900557148 1:3286365-3286387 CCCCTGCCTGGCAGAGCCCCAGG + Intronic
900633939 1:3652633-3652655 CGGCTGCAGGTAGGAGGCCCAGG + Exonic
900968951 1:5978705-5978727 CGCCTGCCAGGATGAGGCCCAGG + Intronic
902202781 1:14846029-14846051 CGTTTGCTGGGAAGAGCCCAGGG + Intronic
902472279 1:16657230-16657252 CAGCTGCAGGGAAGGGCCCTGGG + Intergenic
902486524 1:16750216-16750238 CAGCTGCAGGGAAGGGCCCTGGG - Intronic
902504356 1:16929826-16929848 CAGCTGCAGGGAAGGGCCCTGGG - Exonic
904274181 1:29369598-29369620 TCTCTGCAGGGAAGAGCCCCTGG - Intergenic
904423785 1:30410493-30410515 ACTCTGCAGGGAAGAGCCCCTGG + Intergenic
904483324 1:30807462-30807484 CGGCTTCCGGGGCGCGCCCCGGG - Intergenic
904928543 1:34067519-34067541 GGGCTGCCAGGAAGAGCCTCAGG + Intronic
906714105 1:47954287-47954309 CGGAGGCCTGGAAAAGCCCCTGG - Intronic
912775158 1:112502199-112502221 CGGACGCCGGGAGGAGCCACCGG + Intronic
913287045 1:117236179-117236201 CAGCTGCCTGGAAGAGTGCCTGG - Intergenic
916745362 1:167680943-167680965 GGACTGCCGTGAAGAGCTCCTGG + Intronic
919640688 1:200041429-200041451 TGCCTGTCGGGAGGAGCCCCTGG + Intronic
919760324 1:201094072-201094094 CGGCTGCAGGGAAGAGAGCAAGG - Intronic
922443594 1:225677598-225677620 CGGCTCCCGGGAAGGCCCCAGGG - Intergenic
923080518 1:230649345-230649367 GGGCTGGAGGGAAGAGCTCCAGG + Intronic
1063578267 10:7281337-7281359 CGGCAGCAGGGAAGAGCTCGTGG + Intronic
1064172878 10:13049741-13049763 AGGCTGCCCAGAAGAGCCCTGGG + Intronic
1066130705 10:32390680-32390702 AGGATGCCTGGAAGAGCCCTAGG + Intergenic
1066180484 10:32957581-32957603 CGGCTGCCAGGAGGCGGCCCTGG - Intronic
1070966999 10:80536019-80536041 CGGCCGCCAGGGAGCGCCCCAGG + Intergenic
1071835726 10:89415189-89415211 CCGCTGCCGAGAAGAGCCGTCGG - Intronic
1073036468 10:100567334-100567356 CGGCTGCAGGGAACAGGCCTAGG + Intergenic
1073057205 10:100710334-100710356 CGGCGCCCGGGAGGAGCCGCGGG - Intergenic
1082242465 11:49887355-49887377 CTGCTCCCAGGAGGAGCCCCGGG + Intergenic
1083669556 11:64292357-64292379 CGGCGGCCGGGACCCGCCCCTGG + Intronic
1084021079 11:66418661-66418683 GGGCTCAGGGGAAGAGCCCCTGG - Intergenic
1084524023 11:69684830-69684852 AGGCTGCGGGGATGAGCCTCGGG - Intergenic
1089694653 11:120209811-120209833 CGGGTAGCGGGAAGGGCCCCTGG + Intergenic
1089745007 11:120610528-120610550 CGGCTGCCTGGGCCAGCCCCAGG - Intronic
1091222423 11:133937175-133937197 CGGCTGCCTGGGAGAGGGCCAGG - Intronic
1091401392 12:182630-182652 CGGCTGCTGGGAAGACGACCTGG + Intergenic
1100469049 12:94873816-94873838 CCGCAGCCCGGGAGAGCCCCGGG - Intergenic
1102584253 12:113912130-113912152 TGGCCTCCGGGAAGGGCCCCAGG + Intronic
1103476378 12:121221990-121222012 AGGCCCCCGGGAAGAGCCCCAGG + Intronic
1103595342 12:122021782-122021804 CGGCCACCGGGCAGCGCCCCCGG - Exonic
1113793835 13:113045372-113045394 CGGGCGCAGGGCAGAGCCCCGGG - Intronic
1113803259 13:113097077-113097099 GGGCCGCAGGGAACAGCCCCGGG + Intronic
1114397072 14:22373791-22373813 GGTCTGCCTGGAAGAGTCCCTGG - Intergenic
1119219310 14:72893407-72893429 GGGCTGCCGGGGAAAGCCCGGGG + Intronic
1119225600 14:72942611-72942633 CGGCTGCCGGGAAGAGCCCCAGG - Intronic
1119225607 14:72942637-72942659 CCGCTGCTGGGAAGAGCCCCAGG - Intronic
1119475670 14:74926188-74926210 CAGCTGCTGGGCAAAGCCCCTGG - Intergenic
1120834490 14:89027550-89027572 CGGGTTCCAGGATGAGCCCCGGG - Intergenic
1120997253 14:90426232-90426254 CTGCTGGCGGGAGGAGCCCCAGG + Intergenic
1121777797 14:96602183-96602205 GGGCTGCAGGGGACAGCCCCAGG + Intergenic
1122124259 14:99570668-99570690 CTGGTGCCGGGAAGACCCCCTGG - Intronic
1122812011 14:104293752-104293774 GGGCTGCCAGGAAGGGGCCCTGG + Intergenic
1122940773 14:104980421-104980443 CCACTGCTGGGAAGAGGCCCTGG + Intergenic
1124247265 15:28081692-28081714 GGGCTGCCGGGCAGAGCTCTTGG - Exonic
1125601872 15:40919768-40919790 GGGCTGCCAGGAAGGGCCTCGGG + Intergenic
1127474879 15:59323831-59323853 TGGCTGCCCATAAGAGCCCCTGG + Intronic
1128830360 15:70763141-70763163 CGGCGGCGGGGAGGATCCCCGGG + Intronic
1130412147 15:83655763-83655785 TGGCTTCCTGGACGAGCCCCTGG + Exonic
1130559054 15:84944612-84944634 AGGCTCCCGTGAAGAGCGCCCGG - Exonic
1131277630 15:90994904-90994926 CGGCTGCCGGGAACGGGCGCGGG + Intronic
1132549272 16:547645-547667 CGGCTGCAGGGGAGCCCCCCAGG + Exonic
1132568836 16:635322-635344 CTGCTGCTCTGAAGAGCCCCTGG + Exonic
1132646315 16:1000843-1000865 TGGCGGCCGGGAAAAGCCCCCGG + Intergenic
1132646856 16:1003209-1003231 CAGCTGCAGGGAAGGCCCCCGGG - Intergenic
1132654485 16:1036182-1036204 GGCCTGGCGGGAAGAGGCCCCGG + Intergenic
1132702249 16:1226820-1226842 TGGCTGCCGGCAGGAGGCCCTGG - Intergenic
1132706072 16:1244048-1244070 TGGCTGCCGGCAGGAGGCCCTGG + Intergenic
1132736384 16:1388093-1388115 CTGTTGCCTGGAAGGGCCCCGGG + Intronic
1132747722 16:1443923-1443945 CTCCTGCCAGGAGGAGCCCCAGG + Exonic
1133138889 16:3730374-3730396 CAGCTGCCGTGAAGTGCCTCTGG + Intronic
1133219539 16:4313945-4313967 CGGCTGCAGGGCAGGGCTCCGGG + Intergenic
1133621906 16:7534530-7534552 CTGATCCCAGGAAGAGCCCCTGG + Intronic
1133680393 16:8115124-8115146 TGGCGGCCGGGAAGAGGCGCTGG - Intergenic
1134519550 16:14912266-14912288 GGGCTGCAGGGAAGAGTTCCAGG + Intronic
1134554381 16:15153969-15153991 GGGCTGCAGGGAAGAGTTCCAGG - Intergenic
1134707222 16:16310922-16310944 GGGCTGCAGGGAAGAGTTCCAGG + Intergenic
1134960319 16:18401203-18401225 GGGCTGCAGGGAAGAGTTCCAGG - Intergenic
1140657437 16:77155303-77155325 CAGCTTCCCTGAAGAGCCCCAGG - Intergenic
1141443666 16:84044938-84044960 GTGCTCCCGGGAAGGGCCCCGGG + Intergenic
1142278778 16:89137263-89137285 GGACTGAGGGGAAGAGCCCCAGG + Intronic
1142278900 16:89137648-89137670 GGACTGAGGGGAAGAGCCCCAGG + Intronic
1142353692 16:89591229-89591251 CGGCGGCCGAGGAGAGCACCGGG + Exonic
1142429708 16:90019470-90019492 CGGCGGCAGGGAGGAGCCCGCGG + Intronic
1143084495 17:4405706-4405728 CTGCTGGTGGGCAGAGCCCCAGG - Intergenic
1144778890 17:17798194-17798216 CCACTGCCGGGAAGCCCCCCAGG + Exonic
1145197636 17:20908632-20908654 CGGGTGGCGGGAAGAGCCCAGGG + Intergenic
1145883047 17:28365491-28365513 TGGCTGCCTGGAAGGACCCCTGG - Intronic
1147184637 17:38706413-38706435 AGCGTGGCGGGAAGAGCCCCGGG - Intronic
1149891247 17:60392087-60392109 CGGCGACCGGGAGGAGCCGCCGG - Exonic
1150326736 17:64263500-64263522 GGGTTACCTGGAAGAGCCCCAGG + Intergenic
1152463748 17:80454609-80454631 CCGCAGGCGGGAAGAGTCCCCGG - Intergenic
1152639673 17:81444350-81444372 CGGCGGCAGGGCTGAGCCCCAGG + Intronic
1153489269 18:5630549-5630571 CGGCGGCGGGAAAGAGCTCCTGG + Intronic
1155522804 18:26685954-26685976 TGGCTGCCTGCAACAGCCCCAGG + Intergenic
1160453044 18:78978820-78978842 CGGCCGCCAGGATGTGCCCCCGG - Intergenic
1160747643 19:719496-719518 CGGCAGCCGCGCAGAGCCCCTGG - Intronic
1160908992 19:1466217-1466239 CGGCTGCCAGGCCGAGCCCCCGG + Exonic
1161104539 19:2436862-2436884 CAGGGGCCGGGAAGAGGCCCTGG - Intronic
1161125019 19:2550919-2550941 CGGCTGCTGGGAACAGGGCCAGG + Intronic
1161628463 19:5339893-5339915 CGTCTGCCTGCCAGAGCCCCTGG + Intronic
1162551494 19:11360847-11360869 GGGCAGGCAGGAAGAGCCCCAGG + Intronic
1162786125 19:13036108-13036130 CGGCTGGAGGGAGGGGCCCCTGG + Intronic
1162943845 19:14030850-14030872 CGGCTGCCCCGAAGAACCCCAGG - Exonic
1163702963 19:18795702-18795724 CGTCTGCCAGGAAGGGCCCCGGG - Intergenic
1164673661 19:30087980-30088002 CACCTCCCGGGAGGAGCCCCGGG + Intergenic
1164693585 19:30227721-30227743 CGGCTGCCGGGAGAAGGCGCAGG - Intergenic
1165811478 19:38614389-38614411 TGTCTGCCGGGAAGTGCTCCAGG - Exonic
1165857575 19:38889184-38889206 CGACTGCAGGGAACAGCCACAGG + Intronic
1166197971 19:41219230-41219252 CGGCTGCTGGGCAGAGCCGGTGG + Exonic
1167036350 19:46997360-46997382 AGGCTGCCCGGGAGAGCTCCTGG + Intronic
1167391314 19:49196866-49196888 GGGCTGCCGGTGAGTGCCCCGGG + Exonic
1202704676 1_KI270713v1_random:14024-14046 CAGCTGCAGGGAAGGGCCCTGGG + Intergenic
925102182 2:1256861-1256883 CGGCTGTCAGGAAAAGCCTCAGG + Intronic
925421907 2:3719400-3719422 AGGCAGCGGGAAAGAGCCCCTGG - Intronic
926754573 2:16224950-16224972 CGGCTGCCTGAAGGATCCCCTGG - Intergenic
931722813 2:65079736-65079758 TGGCAGCCTGGCAGAGCCCCTGG + Intronic
943143990 2:184018628-184018650 CAGCTGCCTGGAAAAGCCACAGG + Intergenic
947328390 2:229002385-229002407 GGTCTGCCTGGAAGATCCCCGGG - Intronic
947868616 2:233419413-233419435 GGGCAGCAGGTAAGAGCCCCAGG + Intronic
1173876814 20:46377894-46377916 CGATGGCAGGGAAGAGCCCCTGG - Intronic
1173946194 20:46952696-46952718 AGCCTGCCAGGAAGAGCTCCAGG - Intronic
1175074843 20:56363544-56363566 CACCTGCCGGGACAAGCCCCAGG + Intronic
1175988059 20:62774022-62774044 CTGCTGCCTGGAACAGCCCCAGG - Intergenic
1176009820 20:62887030-62887052 GGGGTGCCGAGAAGGGCCCCAGG + Intronic
1176018462 20:62950841-62950863 GGGGTGCAGGGAGGAGCCCCAGG + Intergenic
1176019002 20:62953130-62953152 GCCCTGCCTGGAAGAGCCCCAGG - Intronic
1176059481 20:63166143-63166165 CGGCTTCCAGGAGGAGGCCCTGG - Intergenic
1176201012 20:63860590-63860612 CGCCTGCCAGGAGGAGCCCCAGG - Intergenic
1176234427 20:64047903-64047925 GGGCTTCCTGGAAAAGCCCCGGG + Exonic
1176372185 21:6068843-6068865 GGGATGCCAGCAAGAGCCCCGGG + Intergenic
1179393076 21:41011347-41011369 CTGCTTCCGGGGAGATCCCCAGG + Intergenic
1179655465 21:42841908-42841930 CCTCTGCCGGGAAGAGGTCCTGG + Intergenic
1179751334 21:43469696-43469718 GGGATGCCAGCAAGAGCCCCGGG - Intergenic
1180066654 21:45415785-45415807 CTGCAGCCGGGTGGAGCCCCAGG + Intronic
1180167869 21:46039324-46039346 GGGTTGCCGGGCAGAGTCCCTGG - Intergenic
1181017537 22:20080005-20080027 CGGCGGCCGCGAGGAGCGCCGGG - Intergenic
1181572206 22:23773739-23773761 CTGGTGCCTGGAAGCGCCCCAGG - Intronic
1183508474 22:38221967-38221989 TGGCTGCAGGGAAGGGACCCAGG + Intronic
1185004073 22:48265131-48265153 CGGCTGGCGGAAACTGCCCCAGG + Intergenic
1185232305 22:49690122-49690144 CGGCTCCCTGGTAGAGCCTCAGG - Intergenic
1185395153 22:50582961-50582983 CGGCCTTCGGAAAGAGCCCCCGG - Exonic
950386350 3:12663684-12663706 CGGCTGCCGGGCAGAGGGCTTGG - Intronic
953099196 3:39809311-39809333 GCGCCGCAGGGAAGAGCCCCGGG + Intronic
954763889 3:52897244-52897266 CGGCTGCCGCGCAGGGCCTCCGG + Intronic
954973814 3:54674473-54674495 CGGCAGTGGGGAGGAGCCCCTGG + Intronic
960602178 3:119469184-119469206 CGGCTCCCGGGAAGATGCCGTGG + Intronic
960998299 3:123353718-123353740 CGGCTGCCTGGCAGTGGCCCTGG + Intronic
961039993 3:123671500-123671522 CAGATGCTGGGAAGAGCACCAGG + Intronic
961548353 3:127651928-127651950 TGGCTGGCGTTAAGAGCCCCAGG - Intronic
968061546 3:195729793-195729815 GGGCTGCAGGGAAGACCCGCAGG + Intronic
968474360 4:795959-795981 GGGTTCCCGGGAAGAGCCTCAGG - Intronic
968869234 4:3233092-3233114 CGGCTGTGGGGAGGAGCCACTGG + Intronic
969760120 4:9175477-9175499 TGGCTGCCGAGAAGTTCCCCAGG + Exonic
971478695 4:27095408-27095430 AGGCTGCTGGGAACAGCCCAGGG - Intergenic
979292238 4:118990945-118990967 GGGCTTCCGGCAAGAGCACCAGG + Intronic
980425091 4:132618101-132618123 CGGGTGCCTGGAAAAGCCACAGG - Intergenic
991259743 5:64653732-64653754 CTGCTTCTGGTAAGAGCCCCAGG - Intergenic
995586843 5:113656584-113656606 AGGCTGCAAGGCAGAGCCCCTGG - Intergenic
998798414 5:145843169-145843191 CGGCAGCCATGAAGGGCCCCAGG + Intergenic
999341682 5:150778733-150778755 CGGCTGCTGGGGACCGCCCCCGG - Exonic
1001496089 5:172188402-172188424 CCGCTCCCCGGCAGAGCCCCGGG + Intergenic
1002289008 5:178187204-178187226 CGGCCTCCGGGCCGAGCCCCTGG + Intergenic
1003035809 6:2639372-2639394 CGGCTGCCAGGAAGCCCCTCTGG - Intergenic
1007408668 6:41649083-41649105 GGGCTGCAGTGAGGAGCCCCTGG + Intronic
1013627536 6:111952554-111952576 CCGCTCCCTGGCAGAGCCCCTGG - Intergenic
1018055379 6:160047836-160047858 TGCCTGCCCGGAGGAGCCCCTGG + Exonic
1018949653 6:168370854-168370876 CGGCTGACGGCAGGAGCCCGGGG + Intergenic
1019129741 6:169864862-169864884 CGGCAGCAGGGCAGAGCCTCTGG + Intergenic
1019703743 7:2487776-2487798 AGGCTGCGGGGAAAAGACCCAGG + Intergenic
1022943241 7:35258545-35258567 CCACTGCCGGGAGGAGGCCCGGG - Intergenic
1025959084 7:66205077-66205099 CGGCTGCCGGGAAGCCCCCTCGG + Intergenic
1026876277 7:73880782-73880804 GGGCTGCCGGGAGGGGACCCTGG + Intergenic
1029587800 7:101486540-101486562 CAGCTGCAGGGAAGAGGACCGGG + Intronic
1034497729 7:151432312-151432334 GGGCTGCCAGGAAGTCCCCCGGG + Intronic
1035690634 8:1557350-1557372 AGGGTCCCGGAAAGAGCCCCTGG + Intronic
1035751720 8:2001483-2001505 CGCGTGCCCGGAAGAGCCCGCGG + Exonic
1036263741 8:7259224-7259246 TGGCTGCCGAGAAGTTCCCCAGG + Intergenic
1036265041 8:7266846-7266868 TGGCTGCCGAGAAGTTCCCCAGG + Intergenic
1036266342 8:7274468-7274490 TGGCTGCCGAGAAGTTCCCCAGG + Intergenic
1036267644 8:7282090-7282112 TGGCTGCCGAGAAGTTCCCCAGG + Intergenic
1036268947 8:7289712-7289734 TGGCTGCCGAGAAGTTCCCCAGG + Intergenic
1036297640 8:7549719-7549741 TGGCTGCCGAGAAGTTCCCCAGG - Intergenic
1036298945 8:7557368-7557390 TGGCTGCCGAGAAGTTCCCCAGG - Intergenic
1036300250 8:7565018-7565040 TGGCTGCCGAGAAGTTCCCCAGG - Intergenic
1036302855 8:7580312-7580334 TGGCTGCCGAGAAGTTCCCCAGG - Intergenic
1036317090 8:7725411-7725433 TGGCTGCCGAGAAGTTCCCCAGG + Intergenic
1036318399 8:7733059-7733081 TGGCTGCCGAGAAGTTCCCCAGG + Intergenic
1036319708 8:7740706-7740728 TGGCTGCCGAGAAGTTCCCCAGG + Intergenic
1036321015 8:7748354-7748376 TGGCTGCCGAGAAGTTCCCCAGG + Intergenic
1036322323 8:7756002-7756024 TGGCTGCCGAGAAGTTCCCCAGG + Intergenic
1036323632 8:7763650-7763672 TGGCTGCCGAGAAGTTCCCCAGG + Intergenic
1036324931 8:7771298-7771320 TGGCTGCCGAGAAGTTCCCCAGG + Intergenic
1036351107 8:8013010-8013032 TGGCTGCCGAGAAGTTCCCCAGG - Intergenic
1036352410 8:8020656-8020678 TGGCTGCCGAGAAGTTCCCCAGG - Intergenic
1036353708 8:8028304-8028326 TGGCTGCCGAGAAGTTCCCCAGG - Intergenic
1036390250 8:8318759-8318781 CGCCTCCCCGGAAGGGCCCCGGG - Exonic
1036846393 8:12173429-12173451 TGGCTGCCGAGAAGTTCCCCAGG - Intergenic
1036867756 8:12415748-12415770 TGGCTGCCGAGAAGTTCCCCAGG - Intergenic
1037994822 8:23344220-23344242 GGGCTGGTGGGGAGAGCCCCGGG + Intronic
1044531619 8:93314202-93314224 CAGCTTCCTGGTAGAGCCCCTGG + Intergenic
1048881709 8:138877248-138877270 GGGCTGCTGGGAAGAGCCGAGGG + Intronic
1049199306 8:141332065-141332087 CTGCTGCCGGGAAGGGCCCTGGG + Intergenic
1049323749 8:142011065-142011087 GGGTTGCCGGGGAGAACCCCAGG + Intergenic
1049451801 8:142666023-142666045 CGGCTGCCGGGAAGAGCAGAGGG - Exonic
1049498323 8:142947167-142947189 CGTCTGTCAGGAAGACCCCCAGG - Intergenic
1049651419 8:143771561-143771583 CCGCCGCCGGGAGGAGCGCCGGG + Intergenic
1049766650 8:144358235-144358257 CGGCTGCCGGGGAGTGCGGCGGG + Exonic
1052362191 9:27573365-27573387 CGGCTGCCGGGAAGAGGCGCGGG - Intronic
1056768412 9:89459602-89459624 CAGCTGCAGGGAAGAGGCTCTGG - Intronic
1056951597 9:91044565-91044587 GGGATGCTGGGCAGAGCCCCTGG + Intergenic
1057147073 9:92765297-92765319 CGGCTGCCGGGAGAACCCCCAGG + Intergenic
1057880633 9:98790395-98790417 CGGCAGCAGGGATGAGCCCTTGG - Exonic
1058312993 9:103529280-103529302 CTGCTTCTGGGAAGAGCCACAGG - Intergenic
1060749348 9:126158775-126158797 GGGCAGCAGGGAAGAGACCCTGG + Intergenic
1061954972 9:133956678-133956700 CGGCTGGTGGGCAGAGCACCAGG + Intronic
1062291060 9:135794560-135794582 CGGCTGCCCGCATGAGCTCCAGG - Intergenic
1189474017 X:41334986-41335008 CGGCTGCGGCGCAGGGCCCCCGG - Intronic
1190265909 X:48827066-48827088 CCGCTCCCGGGAGGAGCCCGAGG - Intergenic
1200138267 X:153885395-153885417 CGCCTCCGGGGAGGAGCCCCTGG + Intronic