ID: 1119225607

View in Genome Browser
Species Human (GRCh38)
Location 14:72942637-72942659
Sequence CCGCTGCTGGGAAGAGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 256}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119225607_1119225619 28 Left 1119225607 14:72942637-72942659 CCTGGGGCTCTTCCCAGCAGCGG 0: 1
1: 0
2: 2
3: 22
4: 256
Right 1119225619 14:72942688-72942710 CCGCACTTTCGTCATCTCAGGGG 0: 1
1: 0
2: 0
3: 3
4: 49
1119225607_1119225615 26 Left 1119225607 14:72942637-72942659 CCTGGGGCTCTTCCCAGCAGCGG 0: 1
1: 0
2: 2
3: 22
4: 256
Right 1119225615 14:72942686-72942708 TCCCGCACTTTCGTCATCTCAGG 0: 1
1: 0
2: 1
3: 5
4: 49
1119225607_1119225617 27 Left 1119225607 14:72942637-72942659 CCTGGGGCTCTTCCCAGCAGCGG 0: 1
1: 0
2: 2
3: 22
4: 256
Right 1119225617 14:72942687-72942709 CCCGCACTTTCGTCATCTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119225607 Original CRISPR CCGCTGCTGGGAAGAGCCCC AGG (reversed) Intronic
900363652 1:2301694-2301716 CTGGAGGTGGGAAGAGCCCCCGG + Intronic
900399837 1:2468406-2468428 CTCCTGCTGTGAACAGCCCCGGG - Intronic
900503474 1:3017789-3017811 CCGCTGATGGGAAGAGGCCGAGG + Intergenic
900557148 1:3286365-3286387 CCCCTGCCTGGCAGAGCCCCAGG + Intronic
900716314 1:4147315-4147337 CCTGTGCTGGGCAGAGACCCAGG - Intergenic
900945993 1:5831759-5831781 CCCATGCTGGCAAGAGCCCCAGG + Intergenic
901308764 1:8252850-8252872 CTGCTTCTGGTGAGAGCCCCAGG + Intergenic
901696635 1:11012713-11012735 CCGCTGCTGGGAAGCCCGACAGG - Exonic
902202781 1:14846029-14846051 CGTTTGCTGGGAAGAGCCCAGGG + Intronic
902472279 1:16657230-16657252 CAGCTGCAGGGAAGGGCCCTGGG + Intergenic
902486524 1:16750216-16750238 CAGCTGCAGGGAAGGGCCCTGGG - Intronic
902504356 1:16929826-16929848 CAGCTGCAGGGAAGGGCCCTGGG - Exonic
904274181 1:29369598-29369620 TCTCTGCAGGGAAGAGCCCCTGG - Intergenic
904364470 1:30001688-30001710 TCTCTGCAGAGAAGAGCCCCTGG - Intergenic
904423785 1:30410493-30410515 ACTCTGCAGGGAAGAGCCCCTGG + Intergenic
905293659 1:36940631-36940653 CAGATGCTGGGCAGTGCCCCGGG - Intronic
905371801 1:37486389-37486411 CCCCTGCTGGTGAGAGCCCAAGG - Intergenic
905485409 1:38292500-38292522 CCGTCGCTGGGAACAGGCCCTGG + Intergenic
906258463 1:44368198-44368220 CCACTGCAGGGATGAGCCCTGGG + Intergenic
909418012 1:75429633-75429655 CTGCTTCTGGTGAGAGCCCCAGG + Intronic
909903101 1:81161746-81161768 CCACGGTTGGGAAGAGCACCTGG + Intergenic
917668457 1:177248635-177248657 CAGCTGCTGGAAACAGCACCTGG + Intronic
918618756 1:186578262-186578284 CTGCTGCTGGGGATAGCCCAAGG - Intergenic
919431367 1:197496589-197496611 CTGCTTCTGGGGAGAGCCTCAGG + Intergenic
920404249 1:205697203-205697225 ATGTGGCTGGGAAGAGCCCCTGG - Intergenic
920448383 1:206037893-206037915 GCACAGCTGGGAAGAGCCCCAGG - Intronic
920531645 1:206706689-206706711 CCGCTGCTGGGAAGACGTTCAGG + Intronic
922088783 1:222376049-222376071 CCCAGGCTGGGAAGAGACCCAGG + Intergenic
922569925 1:226628379-226628401 CCGCTGCTGTGGAGACCTCCTGG + Intergenic
922998057 1:229982604-229982626 CCGCTTCTGGTAAGGGCCTCAGG + Intergenic
923092259 1:230749577-230749599 CCCCTGGTGAGCAGAGCCCCTGG + Intronic
923242841 1:232102346-232102368 CTGCTTCTGGTGAGAGCCCCAGG - Intergenic
1063010872 10:2020405-2020427 ACGGTGATGGGAGGAGCCCCGGG - Intergenic
1063462862 10:6225502-6225524 TCCCTGCAGGGAAGAGCTCCAGG - Intronic
1063705916 10:8430689-8430711 CTGCTGCTGGGAGGAGACCTGGG + Intergenic
1064619478 10:17201171-17201193 CCCCAGCTGGGAAGCCCCCCAGG + Intronic
1067269025 10:44773675-44773697 CCGCTGCTGGAAGGTGCCGCTGG + Intergenic
1071835726 10:89415189-89415211 CCGCTGCCGAGAAGAGCCGTCGG - Intronic
1074118251 10:110473922-110473944 CTGCTGCTGGGGAGTGTCCCGGG + Intergenic
1074819332 10:117166963-117166985 CCGCTGCAGGAAAGGCCCCCAGG + Intergenic
1076326302 10:129626158-129626180 CCGCGCTTGGGAAGAGCCACTGG + Intronic
1076810401 10:132883605-132883627 CCACTGCTGGGCTGTGCCCCCGG + Intronic
1077078283 11:710991-711013 CCCTGGATGGGAAGAGCCCCTGG + Intronic
1077169233 11:1158997-1159019 CCTCTCCTGGGAGCAGCCCCGGG - Intronic
1077186634 11:1238405-1238427 CCGCTGGAGGGAAGGCCCCCAGG + Intronic
1077423238 11:2462734-2462756 GCGCTGCTGGCAAGAACCACAGG + Intronic
1078626806 11:12965347-12965369 CCCATGCAGGGAAGACCCCCTGG - Intergenic
1081430088 11:42967294-42967316 CCTCTGCTGGGATAAGCCCAGGG + Intergenic
1082641035 11:55661881-55661903 CACCTGCTGGGAGTAGCCCCTGG + Intergenic
1082802522 11:57425385-57425407 CAGCTGTTAGGAACAGCCCCAGG - Intronic
1083622643 11:64056673-64056695 CTGCTGGTGGGCACAGCCCCGGG - Intronic
1083715396 11:64572360-64572382 CCTGTGCTGGAAAGAGCCCTGGG - Exonic
1084128748 11:67118401-67118423 CCGCTGCACCGAGGAGCCCCCGG + Intergenic
1085023726 11:73224576-73224598 CCACTGCTGGGCAGGGCACCTGG - Intronic
1085325154 11:75601030-75601052 CCTCTGCTGCCCAGAGCCCCAGG - Intronic
1088814040 11:113409674-113409696 CTGCAGCTTGGGAGAGCCCCTGG - Exonic
1089713770 11:120336647-120336669 CCGGTGCTGGGACGAGCCGCTGG - Intergenic
1091401392 12:182630-182652 CGGCTGCTGGGAAGACGACCTGG + Intergenic
1100469049 12:94873816-94873838 CCGCAGCCCGGGAGAGCCCCGGG - Intergenic
1101900281 12:108786918-108786940 CTGCTGCTGGGAAGAGCTGGAGG + Exonic
1102081799 12:110104319-110104341 CCACTTCTGAGAAGAGCACCTGG + Intergenic
1103534682 12:121626555-121626577 GCGCCGCTGGCAAAAGCCCCCGG - Exonic
1103940602 12:124499432-124499454 CCAGGGCTGGGCAGAGCCCCTGG - Intronic
1104583920 12:130031710-130031732 ACCCTGATGGGAAAAGCCCCTGG - Intergenic
1104641792 12:130471818-130471840 CCTCTCCTGGGAAGAACCTCTGG + Intronic
1105321056 13:19322926-19322948 CCGCTCCTGGTGAGAGCCTCAGG + Intergenic
1112234781 13:97625413-97625435 CCGCTGCTGGGAAGCAGCACTGG - Intergenic
1114416667 14:22549470-22549492 CACCTGCTAGGGAGAGCCCCTGG - Intergenic
1114927381 14:27421301-27421323 CTGCTTCTGGTAAGGGCCCCAGG + Intergenic
1116195814 14:41723530-41723552 CCACTCCTGGGAAGATCACCAGG - Intronic
1117445448 14:55799852-55799874 GCCCTGCTGGGGAGAGACCCAGG - Intergenic
1118610233 14:67533663-67533685 CCGCTCCTGGGAAGGGCCCTCGG + Intronic
1119225600 14:72942611-72942633 CGGCTGCCGGGAAGAGCCCCAGG - Intronic
1119225607 14:72942637-72942659 CCGCTGCTGGGAAGAGCCCCAGG - Intronic
1119475670 14:74926188-74926210 CAGCTGCTGGGCAAAGCCCCTGG - Intergenic
1120997253 14:90426232-90426254 CTGCTGGCGGGAGGAGCCCCAGG + Intergenic
1121275149 14:92662334-92662356 CCTTTGCTGGGAACAGCCTCGGG + Intronic
1121579271 14:95014649-95014671 CCTGGGCTGTGAAGAGCCCCAGG + Intergenic
1122009517 14:98734544-98734566 CCTCTGCTGAAAAGACCCCCAGG - Intergenic
1122124259 14:99570668-99570690 CTGGTGCCGGGAAGACCCCCTGG - Intronic
1122940773 14:104980421-104980443 CCACTGCTGGGAAGAGGCCCTGG + Intergenic
1124642208 15:31402657-31402679 CAGCTGCTGCACAGAGCCCCAGG + Intronic
1127615124 15:60677097-60677119 CCCCTGTTGGGGAGAGGCCCAGG + Intronic
1128979636 15:72176691-72176713 CCACTGGGGGGAAGAGTCCCAGG - Intronic
1131076019 15:89495500-89495522 CTGATTTTGGGAAGAGCCCCAGG + Intronic
1132040616 15:98522125-98522147 TCACTGCTGGGAATAGCTCCTGG + Intergenic
1132110690 15:99100043-99100065 CCCTTCCTGGGCAGAGCCCCAGG - Intronic
1132568836 16:635322-635344 CTGCTGCTCTGAAGAGCCCCTGG + Exonic
1132646856 16:1003209-1003231 CAGCTGCAGGGAAGGCCCCCGGG - Intergenic
1132908373 16:2295929-2295951 CTCCTGCTGGGAAGAGCTGCTGG + Intronic
1132983641 16:2752392-2752414 CCGCTGCGGGGAGGAGCACAGGG - Exonic
1133709281 16:8385571-8385593 CTGCTCCTGGGAAGAGCACGTGG + Intergenic
1137222394 16:46469401-46469423 ACCCTGCTGGAAACAGCCCCGGG + Intergenic
1137719329 16:50618715-50618737 CCCATGCTGGGAGGGGCCCCTGG + Intronic
1138105577 16:54285770-54285792 CCGCAGCTGGTAAGAGCCCGCGG - Exonic
1143084495 17:4405706-4405728 CTGCTGGTGGGCAGAGCCCCAGG - Intergenic
1144778890 17:17798194-17798216 CCACTGCCGGGAAGCCCCCCAGG + Exonic
1146481035 17:33205167-33205189 CCCCTGCTGGAAAGAGAGCCTGG + Intronic
1147239623 17:39082072-39082094 CAGCTGGTGGGAAGAACACCTGG + Intronic
1147285613 17:39401140-39401162 CCGCTGGTGGGAAGAGACGGGGG + Intronic
1147391627 17:40112762-40112784 CCCTGGATGGGAAGAGCCCCAGG - Intergenic
1147583326 17:41638787-41638809 CCTCTTTTGGGAAGGGCCCCTGG - Intergenic
1147615021 17:41822498-41822520 CCTCTGCTGGGATGAGGTCCAGG + Exonic
1148862544 17:50612269-50612291 CCCCTGCTGGGAGCAGCACCAGG - Intronic
1151479420 17:74361620-74361642 CAGCTGCTGGGGAGAGCACGGGG - Intronic
1151705451 17:75764819-75764841 CCGGTGCACGGAAGAGTCCCCGG - Intronic
1152463748 17:80454609-80454631 CCGCAGGCGGGAAGAGTCCCCGG - Intergenic
1152764110 17:82126635-82126657 CTGCTGCTGGGAGCAGCCTCTGG + Intronic
1154199192 18:12287663-12287685 CCTCTGCTGGGAGGAGCGGCTGG - Intergenic
1155442392 18:25875858-25875880 CAGCTGCTGGTAAGGGCCTCAGG - Intergenic
1155469913 18:26180582-26180604 CCCCTGCTGCTAAGAGCCCAGGG + Intronic
1158424386 18:57325992-57326014 CAGCTGCTGGGACGTGCCCAAGG - Intergenic
1159909598 18:74132918-74132940 CCGCTGCTGGGATGGGGCACTGG + Intronic
1160183414 18:76655639-76655661 CCATTTCTGGGAAGAGCCCGTGG - Intergenic
1160863819 19:1248770-1248792 CCGGTCCTGGGAAGCCCCCCGGG + Intronic
1161038059 19:2096394-2096416 CCGCTTCTGCGCGGAGCCCCGGG - Intronic
1161125019 19:2550919-2550941 CGGCTGCTGGGAACAGGGCCAGG + Intronic
1161321554 19:3643909-3643931 CCGCCCCAGGGAAGAGCCCAGGG - Intronic
1163033449 19:14558889-14558911 CAGCTGCTGAACAGAGCCCCAGG - Intronic
1164618510 19:29680566-29680588 CCGCTCCTGGGCTCAGCCCCTGG + Intergenic
1165072021 19:33261219-33261241 CCCCTGCTTGGGAGTGCCCCTGG + Intergenic
1165777090 19:38411075-38411097 CCGGTGCTGGGAAGGGGCCTGGG - Intronic
1166197971 19:41219230-41219252 CGGCTGCTGGGCAGAGCCGGTGG + Exonic
1166870384 19:45867031-45867053 CCGGGGCTGGGATGAACCCCTGG - Intronic
1166918485 19:46212381-46212403 CCCCTGCTGGGAATAACCCTGGG + Intergenic
1202704676 1_KI270713v1_random:14024-14046 CAGCTGCAGGGAAGGGCCCTGGG + Intergenic
926305950 2:11637330-11637352 CTGTGGGTGGGAAGAGCCCCGGG + Intronic
928051518 2:28001660-28001682 CTGCTTCTGGAAAGAGCCTCAGG + Intronic
931720153 2:65061650-65061672 GCCCTGCTGGGAAGTCCCCCTGG - Intronic
934765838 2:96879599-96879621 GCGCTGCTGGTGGGAGCCCCAGG - Intronic
935559518 2:104545602-104545624 GCGCTGATGGAAAGAGGCCCTGG + Intergenic
936068207 2:109348001-109348023 CTGTGGCTGGGAAGAGCCCTGGG - Intronic
937333695 2:121047562-121047584 CCGGTCCTGGGCAGAGCTCCAGG - Intergenic
938413062 2:131081400-131081422 TCGCTGCTGTCAGGAGCCCCAGG + Intronic
938912467 2:135898303-135898325 CTTCTGATGGGAGGAGCCCCAGG + Intergenic
941953566 2:171181551-171181573 CTGCTTCTGGTAAGAGCCTCAGG + Intronic
942387231 2:175455338-175455360 GCGGTTCTGGGAAGAGCACCAGG - Intergenic
946404038 2:219483459-219483481 CCGCAGCTGGGGCTAGCCCCAGG + Exonic
947501638 2:230675307-230675329 CCTCTGTTGGGATGAGGCCCTGG - Intergenic
947641727 2:231710743-231710765 CCGCTGCTTGGCGGTGCCCCAGG - Intronic
947717076 2:232346291-232346313 CCACTCCTGGGATAAGCCCCTGG + Intergenic
947818965 2:233057632-233057654 ATGCTGATGGGAAGAGCCCGTGG - Intergenic
948458137 2:238116778-238116800 CCCCTGCTGGGAAGGGCATCAGG + Intronic
948477838 2:238231839-238231861 CCGCTGCTGGGAAGCCCGACAGG - Intergenic
948688966 2:239690250-239690272 CCTGAGCTGGGAAGGGCCCCTGG - Intergenic
948864830 2:240769992-240770014 TCGCTGCTGCCAAGAGGCCCAGG + Intronic
1170594696 20:17796384-17796406 CAGGTGCTGGAAAGAGCCCTTGG - Intergenic
1170596110 20:17806990-17807012 CCTCTGCTGGGGAGAGCCCGAGG + Intergenic
1170629955 20:18057565-18057587 CCGCAGCTGGGATGAGCTCCCGG - Exonic
1172902247 20:38343878-38343900 CCACTGCTGGTCAGAACCCCTGG - Intergenic
1175120443 20:56712416-56712438 CCGGTGCTGGGAAGGGCTCCCGG - Intergenic
1175514362 20:59559546-59559568 CCGCTCCTGCGCAGAGCCCTGGG + Intergenic
1175962621 20:62644804-62644826 CATCTGCTGGGGAGAGCACCAGG - Intronic
1175988059 20:62774022-62774044 CTGCTGCCTGGAACAGCCCCAGG - Intergenic
1176019002 20:62953130-62953152 GCCCTGCCTGGAAGAGCCCCAGG - Intronic
1177856487 21:26405954-26405976 ACTCTGCTGAGAAGAGCCCTTGG - Intergenic
1179655465 21:42841908-42841930 CCTCTGCCGGGAAGAGGTCCTGG + Intergenic
1179981319 21:44897370-44897392 GCCCAGCTGGGCAGAGCCCCAGG + Intronic
1180014565 21:45074068-45074090 CCGCTGCAGGGAGGAGCGCGGGG + Intronic
1180875502 22:19173340-19173362 CCAGTGCTGGGGAGAGCCCCAGG - Intergenic
1181068732 22:20319784-20319806 GCGCTGCTGGAAAGAGCTGCGGG + Exonic
1182131564 22:27856784-27856806 CAGCTGCTTGGAAGAGCCAAAGG + Intronic
1182321692 22:29481868-29481890 CAGCTGCTGGGCACAGCCTCAGG - Intronic
1182417838 22:30232856-30232878 CACCTGCTTGGAAGAGCCCTTGG + Intergenic
1183520783 22:38295058-38295080 TCCCTGATGAGAAGAGCCCCTGG - Intronic
1184251847 22:43264994-43265016 CCTGAGCTGGGAAGAGCCCAAGG + Intronic
1185027803 22:48425484-48425506 CAGCTCCTGGGAAGTGCCCAGGG + Intergenic
1185126478 22:49013891-49013913 TCGCTGCTGTGAAGAGCCGTGGG + Intergenic
1185283594 22:49988723-49988745 CTGCTTCTGGCAAGAGCCTCAGG - Intergenic
950042580 3:9929832-9929854 CACCTGCTGGGAAGAGACCATGG - Exonic
952406174 3:33007068-33007090 CTGCTGCTGGGGACAGTCCCAGG - Intronic
953099196 3:39809311-39809333 GCGCCGCAGGGAAGAGCCCCGGG + Intronic
956145679 3:66188599-66188621 CTGCTTCTGGCAAGAGCCTCAGG - Intronic
957172743 3:76759847-76759869 CCGCTGCTGTGAAAAGCACCTGG - Intronic
959063369 3:101635156-101635178 CCCCTTCTCTGAAGAGCCCCAGG + Intergenic
961013079 3:123448663-123448685 CCGCTGCAGCGCAGGGCCCCGGG - Exonic
961039993 3:123671500-123671522 CAGATGCTGGGAAGAGCACCAGG + Intronic
961640648 3:128362788-128362810 CCGCTGCTAGGATGAGGCCGCGG - Intronic
962061265 3:131930039-131930061 TCGCTGCTGGCAAGACCTCCAGG - Intronic
966931650 3:184679244-184679266 CTGCAGCTCGAAAGAGCCCCTGG + Intronic
967870470 3:194225117-194225139 CCGCAGCAGGGCAGAGCCCACGG + Intergenic
968549211 4:1213787-1213809 CCGCCGCTGTCAGGAGCCCCTGG - Intronic
968596448 4:1488545-1488567 CAGCTGCTGCCACGAGCCCCCGG + Intergenic
968872358 4:3248388-3248410 GCACTCCTGGGAAGAGCCACGGG - Exonic
968878607 4:3287159-3287181 CCGACGCTGTGCAGAGCCCCGGG + Intergenic
971478695 4:27095408-27095430 AGGCTGCTGGGAACAGCCCAGGG - Intergenic
972457120 4:39265380-39265402 CCGCTGCAGAGGAGGGCCCCTGG + Intronic
973057618 4:45680027-45680049 CTGCTCCTGGGTAGGGCCCCAGG - Intergenic
973926428 4:55743132-55743154 CAGCTGCTGAGAGGAGCCGCAGG + Intergenic
979306772 4:119155014-119155036 CTGCTTCTGGTAAGGGCCCCTGG + Intronic
982209672 4:153024176-153024198 CCGCGGCTGGGAAGATCTGCGGG - Intergenic
984702255 4:182825895-182825917 CCCCTGCTGGAAGGCGCCCCAGG + Intergenic
984736584 4:183114266-183114288 CAGCTCCTGGGAAGAGCTTCAGG - Intronic
985054894 4:186027562-186027584 CAGCTGCTGGGTGGAGCCACAGG + Intergenic
985933873 5:3079991-3080013 CACCTGCTGAGAACAGCCCCAGG + Intergenic
991259743 5:64653732-64653754 CTGCTTCTGGTAAGAGCCCCAGG - Intergenic
991608729 5:68428897-68428919 CCTCTGCTGGGAAGCAGCCCTGG + Intergenic
992182896 5:74215300-74215322 CAGTTGCTGGGAAGATCCCTGGG - Intergenic
994175193 5:96703002-96703024 CCGCTGCAGGGACCAGGCCCCGG - Intronic
995385535 5:111584790-111584812 CCCCTGCTGATAATAGCCCCAGG - Intergenic
995528277 5:113068098-113068120 CCGCCGCTCGGAACTGCCCCAGG + Exonic
998797423 5:145835064-145835086 CCGCAGCTGGAAAGAGACACTGG + Intronic
999341682 5:150778733-150778755 CGGCTGCTGGGGACCGCCCCCGG - Exonic
1001044410 5:168360932-168360954 CAGCACCTGGGAAGAGCCCTTGG + Intronic
1001127899 5:169037041-169037063 CCTCTGCTCAGAAGAGCCCTTGG - Intronic
1001328976 5:170748999-170749021 CTGCAGCTGGGAAGGACCCCAGG - Intergenic
1001496089 5:172188402-172188424 CCGCTCCCCGGCAGAGCCCCGGG + Intergenic
1001528836 5:172448160-172448182 CTGCTGCTGGGATAGGCCCCCGG - Intronic
1002026792 5:176401182-176401204 GCGGTGCTGGGAGGAGTCCCTGG - Intronic
1002563917 5:180099650-180099672 CCCCTGCTGGGGTGAGCCTCGGG + Intergenic
1002597747 5:180335250-180335272 CTCCACCTGGGAAGAGCCCCTGG + Intronic
1005298589 6:24449702-24449724 CCAACGCTGGGATGAGCCCCTGG - Intronic
1006099215 6:31675652-31675674 CCAGAGCTGGGAAGAGCACCTGG - Intergenic
1013627536 6:111952554-111952576 CCGCTCCCTGGCAGAGCCCCTGG - Intergenic
1015044317 6:128760220-128760242 CCCCTGGTGGGCAGACCCCCAGG + Intergenic
1017544377 6:155435237-155435259 ACGCTGCTGGGAGCAGGCCCTGG + Intronic
1018422641 6:163652711-163652733 TAGCAGCTGGGATGAGCCCCTGG - Intergenic
1018826083 6:167408693-167408715 CCTCTGCAGCCAAGAGCCCCGGG + Intergenic
1019474798 7:1238863-1238885 GCGCTGCTGGGACGCGGCCCTGG - Intergenic
1019596892 7:1862236-1862258 CCTCTGGTGGGCAGAGGCCCGGG - Intronic
1019640272 7:2099772-2099794 ACCCTGCAGGGAGGAGCCCCTGG + Intronic
1020194059 7:6023510-6023532 CTGCTCTTGGGAAGAGCCCTTGG + Exonic
1022943241 7:35258545-35258567 CCACTGCCGGGAGGAGGCCCGGG - Intergenic
1023814472 7:43939081-43939103 CAGCTGCTGGAAAGTGCCCTTGG + Intronic
1024526422 7:50353629-50353651 CCGAGGCTGTGAAGAGCCCAGGG + Intronic
1025992144 7:66504394-66504416 CAGAGGCTGGGAAGGGCCCCTGG - Intergenic
1027233604 7:76285553-76285575 CCGCTGCTGGGATGGGGCTCGGG + Intronic
1029112016 7:98217435-98217457 CTGCTCCTGGGACGAGCTCCGGG + Exonic
1029587800 7:101486540-101486562 CAGCTGCAGGGAAGAGGACCGGG + Intronic
1032487740 7:132300730-132300752 CCCCAGCTGGGAGGTGCCCCTGG + Intronic
1034443481 7:151099995-151100017 ACTGTGCTGGGAAGAGCCCGCGG + Intronic
1034450147 7:151132897-151132919 CCTCTGCTGAAAAGAGCCCAGGG - Intronic
1035638215 8:1163067-1163089 CCTCGGCTGGTAAGAGGCCCGGG + Intergenic
1035746196 8:1963438-1963460 ACGCCGGAGGGAAGAGCCCCCGG - Intergenic
1036685973 8:10910588-10910610 CAGCTGCTCAGAAGAGCCCAGGG - Intronic
1036690466 8:10941598-10941620 CTGCTCCTGGGAAGACCCACAGG + Intronic
1037187102 8:16077550-16077572 CTGCTTCTGGTAAGGGCCCCAGG + Intergenic
1037994822 8:23344220-23344242 GGGCTGGTGGGGAGAGCCCCGGG + Intronic
1042381592 8:68120989-68121011 ACGCTGCTGGGAAGATTCCAAGG - Exonic
1042517294 8:69672931-69672953 TTGCTTCTGGGAAGGGCCCCGGG + Exonic
1043516676 8:81001214-81001236 CCTCTGCTGGGCTAAGCCCCAGG + Intronic
1045507589 8:102789420-102789442 CCGGGGCTGGGAAAAGGCCCTGG - Intergenic
1045542039 8:103095739-103095761 TCTCTGCTGGGAAGGGACCCAGG + Intergenic
1047784433 8:128139949-128139971 CCCTTGCTCAGAAGAGCCCCAGG + Intergenic
1048299165 8:133238905-133238927 GTGCTGCTGGGAACAGCGCCGGG - Exonic
1048553757 8:135456713-135456735 CCGCTCCTGGGGAGAGGCCCTGG - Intergenic
1048881709 8:138877248-138877270 GGGCTGCTGGGAAGAGCCGAGGG + Intronic
1049125924 8:140787799-140787821 CAGCTTTTGGGATGAGCCCCGGG - Intronic
1049195228 8:141312051-141312073 CCGATGCTGGGACGAGTCCAGGG + Intergenic
1049199306 8:141332065-141332087 CTGCTGCCGGGAAGGGCCCTGGG + Intergenic
1049651419 8:143771561-143771583 CCGCCGCCGGGAGGAGCGCCGGG + Intergenic
1049818862 8:144622123-144622145 CCGCTGCTGGCACGAGGCCGTGG - Intergenic
1050723649 9:8620928-8620950 CCGCTGCTGGGATGGGGCCAAGG - Intronic
1051334107 9:16051367-16051389 CCTGTGCTGGGAGGAGTCCCAGG + Intronic
1051693727 9:19745214-19745236 CTGCTTCTGGGAAGGGCCTCAGG - Intronic
1052362191 9:27573365-27573387 CGGCTGCCGGGAAGAGGCGCGGG - Intronic
1056768412 9:89459602-89459624 CAGCTGCAGGGAAGAGGCTCTGG - Intronic
1056951597 9:91044565-91044587 GGGATGCTGGGCAGAGCCCCTGG + Intergenic
1057432331 9:95005270-95005292 CCGCGGCTGGCGAGAGGCCCTGG + Intronic
1058312993 9:103529280-103529302 CTGCTTCTGGGAAGAGCCACAGG - Intergenic
1059341423 9:113599643-113599665 CTTCTGCTGGGAGGAGCCACTGG + Intergenic
1060776263 9:126376949-126376971 CCGATACTGAGCAGAGCCCCAGG - Intronic
1060779258 9:126399624-126399646 CAGAGGTTGGGAAGAGCCCCAGG + Intronic
1060814375 9:126626957-126626979 CCTCTGCAGGGAAGAGGCCTTGG + Intronic
1061371591 9:130200682-130200704 CCGCTGCTGGGAGAGCCCCCAGG - Intronic
1061954972 9:133956678-133956700 CGGCTGGTGGGCAGAGCACCAGG + Intronic
1062265539 9:135685117-135685139 CCCCTCCTGGGAAGACCCTCAGG + Intergenic
1062374677 9:136256587-136256609 CATCTGCTGGGAAGGGCCCTGGG + Intergenic
1062534594 9:137015898-137015920 CTGCTGCTATGCAGAGCCCCAGG + Intronic
1185456422 X:313043-313065 CCGCTGCTGGGGAAAGCAGCCGG - Intronic
1185871675 X:3669990-3670012 CCGCTGGTGGGTGGAGCCCAGGG + Intronic
1187226124 X:17376373-17376395 CCGCTGCTGGGGAGGGCGCGAGG - Intronic
1187942199 X:24392887-24392909 CTGCAGCTGGAAAAAGCCCCAGG + Intergenic
1188006518 X:25019827-25019849 CCGGTGCTGGGAAGAGCCGGAGG + Intergenic
1189952487 X:46246865-46246887 CCATTGCTGAGAGGAGCCCCTGG + Intergenic
1190265909 X:48827066-48827088 CCGCTCCCGGGAGGAGCCCGAGG - Intergenic
1197204781 X:123780408-123780430 CCTCTGGAGGGAAGAGGCCCTGG - Intergenic
1199605909 X:149579573-149579595 CCCCTCCTGGGAGGAGCCCAGGG + Intergenic
1199633212 X:149789795-149789817 CCCCTCCTGGGAGGAGCCCAGGG - Intergenic
1199754365 X:150850710-150850732 CCACTGATGGGTTGAGCCCCAGG + Intronic
1200792569 Y:7312719-7312741 CCCCTGCTGGGGGGAGCCCAAGG - Intergenic