ID: 1119227943

View in Genome Browser
Species Human (GRCh38)
Location 14:72958412-72958434
Sequence CAATGACAAGATGCCCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119227943_1119227948 2 Left 1119227943 14:72958412-72958434 CCAACCAGGGCATCTTGTCATTG 0: 1
1: 0
2: 1
3: 12
4: 114
Right 1119227948 14:72958437-72958459 CTAGCACAACAGGGCGACTTGGG 0: 1
1: 0
2: 6
3: 28
4: 117
1119227943_1119227945 -8 Left 1119227943 14:72958412-72958434 CCAACCAGGGCATCTTGTCATTG 0: 1
1: 0
2: 1
3: 12
4: 114
Right 1119227945 14:72958427-72958449 TGTCATTGTTCTAGCACAACAGG 0: 1
1: 0
2: 0
3: 8
4: 101
1119227943_1119227947 1 Left 1119227943 14:72958412-72958434 CCAACCAGGGCATCTTGTCATTG 0: 1
1: 0
2: 1
3: 12
4: 114
Right 1119227947 14:72958436-72958458 TCTAGCACAACAGGGCGACTTGG 0: 1
1: 0
2: 1
3: 1
4: 34
1119227943_1119227946 -7 Left 1119227943 14:72958412-72958434 CCAACCAGGGCATCTTGTCATTG 0: 1
1: 0
2: 1
3: 12
4: 114
Right 1119227946 14:72958428-72958450 GTCATTGTTCTAGCACAACAGGG 0: 1
1: 0
2: 0
3: 9
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119227943 Original CRISPR CAATGACAAGATGCCCTGGT TGG (reversed) Intronic
900770272 1:4536070-4536092 CTATGGCAAGATTCCATGGTTGG - Intergenic
911687818 1:100797429-100797451 CACTGACAAGATGCTATGGATGG + Intergenic
916824459 1:168430577-168430599 GAGTGAGAAGATGCCCTGCTGGG - Intergenic
920173836 1:204088037-204088059 CAATGGCAAGATGCCAGGGCAGG - Intronic
1067241246 10:44496816-44496838 CTATGAAAAGATGACCTGCTCGG + Intergenic
1068572921 10:58650874-58650896 AAATGAAAAGATGTCTTGGTAGG + Intronic
1068923877 10:62514504-62514526 CAATGGCAACATGCCCAGGCTGG + Intronic
1070319484 10:75343854-75343876 CTGTTACATGATGCCCTGGTGGG + Intergenic
1077154080 11:1083765-1083787 CCATGACAAGCTGGACTGGTTGG + Intergenic
1083420378 11:62549156-62549178 GAATGTCAAGATTACCTGGTCGG + Intronic
1083488158 11:62996385-62996407 CAATAACAAGTGGCCCAGGTCGG - Intronic
1084570164 11:69954805-69954827 AAATGACAGGATGGCCTGCTTGG + Intergenic
1089749057 11:120637320-120637342 CAATGTCAGGGTGCCCTGGTGGG + Intronic
1091219211 11:133920434-133920456 CAGAGACAGGATGCCCGGGTAGG + Exonic
1097354222 12:58583675-58583697 AAATGAGAAGATTCACTGGTAGG + Intronic
1100827316 12:98487025-98487047 CAATAATAAGATGCCTTGGAAGG + Exonic
1103705836 12:122871726-122871748 CAATGACAGGCTACCCTGGTAGG + Intronic
1103827624 12:123752832-123752854 CAATTCCAAGAGGCCTTGGTTGG + Intronic
1112580142 13:100671525-100671547 CATCAACGAGATGCCCTGGTAGG + Intronic
1119227943 14:72958412-72958434 CAATGACAAGATGCCCTGGTTGG - Intronic
1119960848 14:78854872-78854894 CAGTGACAATATTCCCTGGATGG - Intronic
1120332894 14:83116084-83116106 GCATAACATGATGCCCTGGTTGG - Intergenic
1121719390 14:96098654-96098676 CACTGCCCAGATGCCCTGGGAGG + Intergenic
1121740194 14:96246442-96246464 CAATGAGAAGAAGTCCAGGTGGG + Intronic
1124353635 15:28978722-28978744 CAATGACTCCATGCCCTGGGAGG - Intronic
1124992856 15:34692974-34692996 CAAGGACAAGATGGTCTGATAGG + Intergenic
1126467823 15:48976584-48976606 CAATGCGAACTTGCCCTGGTTGG + Intergenic
1128417302 15:67458498-67458520 CATTGACAAGAGGCCCTGAGGGG - Intronic
1129676909 15:77636673-77636695 CAATGAGAGGTTGCCCTGGGGGG + Intronic
1133124692 16:3638889-3638911 AAATGAAAAGATGCACTGGATGG - Intronic
1133496064 16:6318839-6318861 CAATGGCAAGATGCCTTATTGGG + Intronic
1135191765 16:20360275-20360297 CACTGACCAGATGTCTTGGTGGG - Intronic
1137785795 16:51136791-51136813 CAATTGCAAGTTGCCCTGCTAGG - Exonic
1138655500 16:58488840-58488862 CACGGATAAGCTGCCCTGGTGGG + Intronic
1141392874 16:83679229-83679251 CAAATAAAAGATGCCCTCGTTGG + Intronic
1141704517 16:85657373-85657395 CAGAGAGAAGATGCCATGGTTGG - Exonic
1155372099 18:25112566-25112588 GAATGGCAAGATGCGCTGGATGG - Intronic
1156089038 18:33442608-33442630 AAATGAAAATATGTCCTGGTTGG + Intergenic
1156349262 18:36289039-36289061 CCATGATGAGGTGCCCTGGTGGG - Intergenic
1156806984 18:41196649-41196671 CAATAACAAGTTTCCCTGCTAGG + Intergenic
1156988066 18:43372763-43372785 AACTGACATGATGCACTGGTGGG - Intergenic
1158441385 18:57477346-57477368 CAATGAAAAGATGTCTGGGTTGG - Exonic
1158942462 18:62418184-62418206 CAATGACAACACACCCTGGTTGG - Intergenic
1159501811 18:69281074-69281096 CAATGACAGGATGGCATGGCAGG - Intergenic
1160202045 18:76804051-76804073 CAATGACAACATGCTGTGGGTGG - Intronic
1165955688 19:39500607-39500629 GAAAGAGAAGGTGCCCTGGTTGG - Exonic
1166331380 19:42079881-42079903 CAATGACAGGTTCCTCTGGTGGG - Exonic
925358162 2:3257294-3257316 CCATGGCAACATGGCCTGGTAGG - Exonic
925841825 2:7999318-7999340 CAGTGACAATGTGGCCTGGTTGG + Intergenic
928676081 2:33653246-33653268 CAGTGAGAAGATACCCTGCTGGG + Intergenic
933213027 2:79593582-79593604 CAAGGACAGGATGACATGGTGGG - Intronic
935628233 2:105189187-105189209 CCATGAGAACATGCCCTGGGTGG + Intergenic
936004573 2:108872238-108872260 CAATGGCAGGATGCTATGGTGGG - Intronic
937201975 2:120209723-120209745 CAGTGACAGGACTCCCTGGTTGG - Intergenic
939692391 2:145280329-145280351 CAATGACAAGATTCCATCCTAGG + Intergenic
945144535 2:206723592-206723614 CAATCACAATTTGCCCTGGTTGG + Intergenic
946351643 2:219159205-219159227 CAATGACAACATGCCCAGCCTGG + Intronic
1170952777 20:20951794-20951816 CAATGCCAAGCAGCACTGGTAGG - Intergenic
1171962383 20:31504074-31504096 CATGGACAGGGTGCCCTGGTGGG - Intergenic
1172146307 20:32760815-32760837 CATTCACAAGAGGCCCTGCTGGG + Intergenic
1173231495 20:41202390-41202412 CAATGACCAGTAGCCCTGGTGGG + Exonic
1174291360 20:49511080-49511102 GAATTACAACATGCCCTGGGGGG - Exonic
1174341208 20:49897004-49897026 CAAAGAAAAGATACCCTGGTTGG + Intergenic
1175307969 20:57991018-57991040 CAAGGACAGGCTGCCCTGGTGGG - Intergenic
1176179990 20:63745298-63745320 CAATGACAGGGTGCCCTGGCTGG - Exonic
1179570685 21:42277011-42277033 CAATGCCAAAATGCCCCGGCAGG - Intronic
1179906503 21:44425806-44425828 CAACGAGAAGGTGCCCTGGGAGG + Exonic
1182697190 22:32205548-32205570 CAATGCCCTGATGCCCTTGTTGG + Intergenic
950038071 3:9901681-9901703 CAATCTCAAGATGCCTTGGCTGG + Intergenic
950417783 3:12878181-12878203 CAATGACAAGTAGCTCTAGTGGG - Intergenic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
952031046 3:29143187-29143209 CAATGACTAGATGCCCAGGTTGG - Intergenic
952617944 3:35297938-35297960 TAATGACAAGATGTCCTCCTTGG - Intergenic
952879827 3:37976860-37976882 CAGTCACCAGAGGCCCTGGTTGG - Intronic
952956426 3:38560584-38560606 CCATGGCTAGAAGCCCTGGTGGG + Intronic
953960256 3:47260938-47260960 CAATGACAGGGTGCTCTGGGAGG + Intronic
959245544 3:103863050-103863072 CAATGAGACAGTGCCCTGGTAGG - Intergenic
962869800 3:139477996-139478018 TAATGAGAAGCTGGCCTGGTAGG + Intronic
963706939 3:148699028-148699050 CAAAGAGAAGAGGCCCAGGTGGG - Intronic
967352723 3:188531923-188531945 CAATCACAAGCTGCGGTGGTGGG - Intronic
967473800 3:189892398-189892420 CATTGTCATGATGCCCTGGATGG - Intronic
967969552 3:194988869-194988891 CAATGACAAATTTCTCTGGTGGG - Intergenic
970507572 4:16746905-16746927 CAATTAAAAGGTGCCCTGGTTGG + Intronic
972578954 4:40378295-40378317 CAATGAAAAGATGCAGTGTTAGG + Intergenic
973325336 4:48854792-48854814 AAAGAATAAGATGCCCTGGTAGG - Intronic
973833145 4:54781993-54782015 CAGTGATAAGATGCCCTGGAGGG - Intergenic
975850642 4:78568358-78568380 CAATGTCAAGATGCTATGTTGGG - Intronic
987072894 5:14354454-14354476 CAGTGACAAGCTGCCCTTCTGGG - Intronic
991345326 5:65659786-65659808 AAATGCCAAGTTGCCCAGGTTGG - Intronic
995379787 5:111518947-111518969 CAATGACCAGATGACCCAGTTGG + Intergenic
995604275 5:113834535-113834557 CAATGACAAGATTCCTTTCTAGG + Intergenic
996106609 5:119511759-119511781 CAATAACAACAAGCCCTGGAAGG + Intronic
999423632 5:151466920-151466942 CAAGGACGAGATGCCCTGGCAGG - Intronic
1002596027 5:180323956-180323978 CAAAGGCCAGATGCACTGGTGGG - Intronic
1006766657 6:36512424-36512446 CAAAGTTCAGATGCCCTGGTTGG - Intronic
1006867320 6:37219335-37219357 CAATCACAACATTCTCTGGTTGG + Intronic
1008989429 6:57585789-57585811 AACTGACAAGATGCCCTCCTTGG - Intronic
1009178016 6:60484346-60484368 AACTGACAAGATGCCCTCCTTGG - Intergenic
1010889658 6:81291009-81291031 CTATGATAAGATGCCCTAGAGGG - Intergenic
1014809889 6:125873240-125873262 AAATGACAAGAAGCCCGGCTTGG - Intronic
1019514876 7:1435183-1435205 CAATGGCAAGGTGCCCTGGAGGG + Intronic
1021448559 7:20759542-20759564 TACTGAAAAGATGACCTGGTGGG + Intronic
1023882661 7:44329341-44329363 CACTGACAAAATGCCCTTGCTGG - Intronic
1023945516 7:44799910-44799932 AAATGAAAAGTTGCCCTGGGGGG + Intronic
1027606111 7:80300894-80300916 CAATGATAAGCTGACCTGGAGGG + Intergenic
1031081350 7:117260071-117260093 GAATGACAATATGTCTTGGTGGG - Intergenic
1036693165 8:10957492-10957514 CAATGACAAGATGCAGTGACTGG + Intronic
1036732273 8:11276441-11276463 AAATGACATGGTGCACTGGTGGG - Intergenic
1038486556 8:27939446-27939468 CAAGGACAAGAGTCCATGGTGGG - Intronic
1038781473 8:30571909-30571931 CAATGTCATGATTACCTGGTTGG + Intronic
1039718158 8:40133260-40133282 TGATGAAAAGATGCCCAGGTGGG + Intergenic
1043418577 8:80076411-80076433 AAGTGACAAGGTGCCCTGTTTGG - Intronic
1046366963 8:113246715-113246737 CAGTGACAAGAAGCCCTTGGGGG - Intronic
1048439053 8:134446380-134446402 CAAAGAAGAGATGCCCTGTTTGG + Intergenic
1048444765 8:134485161-134485183 GGATGACAAGCTGCCCTGGGGGG + Intronic
1055368660 9:75573410-75573432 CAATGACAAGATAGACAGGTGGG + Intergenic
1055430724 9:76240761-76240783 CAATGACAAGAGTGCCTGCTGGG - Intronic
1055462239 9:76529945-76529967 CACTGCCAAGAAGCCCTGTTAGG - Intergenic
1062323220 9:136000712-136000734 CACTAACAAGATGCCCGGGGCGG + Intergenic
1188060193 X:25591255-25591277 CAATGGCAAGATGGTCTGGGTGG + Intergenic
1188635229 X:32421688-32421710 CGATGAGAAGATGCCATTGTGGG - Intronic
1189590430 X:42505303-42505325 CAAGGACAAGAAGGCCTGGGGGG + Intergenic
1190246043 X:48691071-48691093 GAAAGATAAGATGCCCTGGGAGG - Intronic
1190362702 X:49664531-49664553 CAATTGCAAGTTGCCCTGCTAGG - Intergenic
1192093487 X:68185458-68185480 CATTTACAAAATGCCCAGGTGGG - Intronic
1200700687 Y:6399863-6399885 CAAGCACAAGAAACCCTGGTTGG + Intergenic
1201033425 Y:9764835-9764857 CAAGCACAAGAAACCCTGGTTGG - Intergenic
1201320408 Y:12692458-12692480 CAAGGATGAGATACCCTGGTCGG + Intergenic