ID: 1119228025

View in Genome Browser
Species Human (GRCh38)
Location 14:72958916-72958938
Sequence CTCTCCTAGCAGCCAGAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 276}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119228025_1119228027 -1 Left 1119228025 14:72958916-72958938 CCATCCTCTGGCTGCTAGGAGAG 0: 1
1: 0
2: 4
3: 27
4: 276
Right 1119228027 14:72958938-72958960 GAAGTGCTGAATGTTCCGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 106
1119228025_1119228028 10 Left 1119228025 14:72958916-72958938 CCATCCTCTGGCTGCTAGGAGAG 0: 1
1: 0
2: 4
3: 27
4: 276
Right 1119228028 14:72958949-72958971 TGTTCCGTGTGGAGATGCTCAGG 0: 1
1: 0
2: 1
3: 6
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119228025 Original CRISPR CTCTCCTAGCAGCCAGAGGA TGG (reversed) Exonic
900132015 1:1091273-1091295 CTCACCCAGCAGGCAGCGGAGGG + Intronic
900646448 1:3710931-3710953 GTAACCGAGCAGCCAGAGGAAGG + Intronic
901493625 1:9609121-9609143 CTCTCCCAGCATCCATAGAATGG + Intronic
901527936 1:9835840-9835862 CTCCCCTGACAGCCAGTGGATGG + Intergenic
902890691 1:19441247-19441269 CTCTCCCTGCAGTCAGAGGATGG + Intronic
903227784 1:21903670-21903692 CTCTCCCAGTAGCCCCAGGAAGG - Intronic
903377382 1:22875474-22875496 CTTCCCAAGCAGCCAGCGGAAGG - Intronic
904475145 1:30760042-30760064 TCCTCCTAGCAGCCTGAGTACGG - Intergenic
904741564 1:32680699-32680721 CTCTTCTAGAAGCCAGAGACTGG - Exonic
904983151 1:34523621-34523643 CTTTTCTGGCAGCCAGAGGCAGG + Intergenic
905629028 1:39508574-39508596 CTCTCTTAGCAGCTAAAGCAGGG + Intronic
905665628 1:39761445-39761467 CTCCCCCAGCAGCCAGAGAGAGG + Intronic
906721872 1:48012245-48012267 CTCTCCTATCACCAAGGGGATGG - Intergenic
907339116 1:53721358-53721380 TTCTCCCAGCAGCCCTAGGAAGG - Intronic
908617330 1:65936795-65936817 CTCTCCTTTCAGCCAAAGGCAGG + Intronic
910340774 1:86184462-86184484 CTCTCCTCCCAGCCAGAAGATGG - Intergenic
910397415 1:86806470-86806492 CTCTCTTAGCCGCTCGAGGAAGG + Intergenic
910654412 1:89605411-89605433 CTCTCCTACCATGAAGAGGAGGG + Intergenic
911228392 1:95333137-95333159 CTCTTCTGGCAGCCAGTGCAGGG + Intergenic
912179953 1:107207890-107207912 ATGTCCTAGCAGCCACAGCATGG + Intronic
912383471 1:109260013-109260035 CTCTGCCAGCAGCCATAGGCAGG + Intronic
912758480 1:112345126-112345148 CTCTCCTAGCAGCCAGCTCCAGG + Intergenic
913519416 1:119631440-119631462 CCCTTCTAGGAGCCAGCGGAGGG - Intronic
915093333 1:153441720-153441742 CTTGGCTAGGAGCCAGAGGAGGG - Intergenic
916362750 1:163989622-163989644 CTGTCCTAGCAGGCAAAGGAAGG + Intergenic
916746955 1:167691918-167691940 CCCTCCTAGCATCCAGCTGAGGG + Intronic
919490208 1:198197573-198197595 CTATCCAAGCAGCAAGAAGATGG + Intronic
920445222 1:206011278-206011300 GTTTCCTAGAAGCCAGGGGAGGG - Intronic
1063429415 10:5976632-5976654 TTGTCCCGGCAGCCAGAGGAAGG - Intronic
1064125529 10:12656717-12656739 CTCTCTTTGCTGCCAGAAGATGG - Intronic
1065598010 10:27336164-27336186 ATGTCCTAGCTGCCAGAGCAGGG + Intergenic
1066103431 10:32137409-32137431 CTGTCCTAGACACCAGAGGAAGG - Intergenic
1069137301 10:64782131-64782153 CTCTCGTAGCCGCTCGAGGAAGG + Intergenic
1070388176 10:75945999-75946021 CTATTCTAGCAGACAGAGAAAGG - Intronic
1070428068 10:76308651-76308673 CTCTCCTCCCAGCCTGGGGATGG + Intronic
1073134931 10:101215213-101215235 TTCTCCTAGCAGCCTCAGAACGG - Intergenic
1073600609 10:104842679-104842701 ATCTCCTATCACCCAGAGGAGGG - Intronic
1074206119 10:111284367-111284389 CTCTCTGAGCAGGCTGAGGAAGG - Intergenic
1074476091 10:113775839-113775861 CTCTCACAGAAGCCACAGGACGG + Exonic
1074496347 10:113983205-113983227 CACTCCTAGCAGCCACGGAAGGG - Intergenic
1075316665 10:121458823-121458845 CTCACCCCACAGCCAGAGGATGG + Intergenic
1076456842 10:130606006-130606028 CTCTCCTTCCTGCCTGAGGAAGG - Intergenic
1076763255 10:132616137-132616159 CTGTCCTTGCAGCCACTGGAGGG + Intronic
1077413328 11:2413520-2413542 GGCTCCTAGCAGCCGCAGGATGG + Exonic
1077485124 11:2835025-2835047 CTGTCCTAGGAGCCAGAAGCGGG + Intronic
1078528272 11:12117228-12117250 TTCTGCTGGCAGCAAGAGGAGGG + Intronic
1080619624 11:33976418-33976440 CTCACCTAGAAGGCAGTGGAAGG - Intergenic
1080657737 11:34270992-34271014 ATTTACTAGCAGCCAGAGGTGGG + Intronic
1080804123 11:35636318-35636340 CTCTTCCAGCAGAGAGAGGAGGG + Intergenic
1081421466 11:42877648-42877670 CTCTCATAGCCGCTCGAGGAAGG - Intergenic
1081526301 11:43930086-43930108 CTGTCCCAGCAGTCAGAGGCAGG + Intronic
1081583621 11:44369412-44369434 CTCCCCTACCAGTCAAAGGATGG - Intergenic
1083421674 11:62556740-62556762 CTCTTCCTGCAGGCAGAGGAAGG + Intergenic
1083465471 11:62842662-62842684 CTCTCCTCGAAGGCAGAGGCAGG + Intergenic
1084211051 11:67622710-67622732 CTCTCATAGCCGCTCGAGGAAGG - Intergenic
1084319698 11:68366401-68366423 CTCTCCTGGCATCCGGTGGATGG + Intronic
1085054913 11:73397901-73397923 GTGTCCTGGCAGCCAGGGGAGGG + Intergenic
1085511885 11:77092516-77092538 CTCTCTTGGCAGGCAGAGCAAGG + Intronic
1086459607 11:86993400-86993422 TTCTGCTACCAGCCTGAGGATGG - Intergenic
1086952562 11:92905843-92905865 CTCTCCTAGTAGCCTGAGGCTGG + Intergenic
1087013977 11:93538590-93538612 CTCTGCTAACAGCTAGAGAAAGG - Intronic
1089275892 11:117335993-117336015 CTATCCAAGCAGCAAGAAGATGG + Intronic
1089517814 11:119044894-119044916 CACCCCTAGTGGCCAGAGGAGGG - Exonic
1089601066 11:119615574-119615596 GTCTCCTAGCAGGCAGAGGAAGG - Intergenic
1089609282 11:119660550-119660572 TTCTCCAAACAGCCACAGGAGGG + Intronic
1089808269 11:121111315-121111337 ATCTCCTAGGAGACAGAGCAGGG + Intronic
1090079797 11:123604388-123604410 CTATCCTGGCAGCCACGGGAAGG + Intronic
1090518142 11:127450448-127450470 GTCTCCTGGCAGCAATAGGAAGG + Intergenic
1091318859 11:134635596-134635618 CTGGCCTGGAAGCCAGAGGACGG + Intergenic
1091482206 12:844697-844719 CTTTACTAGAAGCCAGAAGATGG - Intronic
1091661721 12:2389191-2389213 CTCTCCTATCAGCAAGAACAGGG - Intronic
1093186657 12:16028045-16028067 CTCTCCTAGCTGACTGAGCAGGG - Intronic
1093580540 12:20780617-20780639 CTCTCGTAGCTGCTCGAGGAAGG + Intergenic
1095988589 12:48017510-48017532 CTCACCTACCAGCGACAGGAGGG - Intergenic
1097242750 12:57587196-57587218 CTCTCCTATCTCCCAGAGCAAGG + Intergenic
1098445055 12:70557920-70557942 CTCTTCCAGCAGCCAATGGAGGG - Intronic
1101335341 12:103791612-103791634 CTCTCCTGTCTGCCAGAGCAGGG + Intronic
1101550637 12:105758297-105758319 CTCAGCTAGGAGCCAAAGGAGGG + Intergenic
1103532943 12:121615043-121615065 CTGTCATAGCACCAAGAGGATGG + Intergenic
1104339706 12:127936841-127936863 CTCTCCAGGCACCCAGAGAAGGG + Intergenic
1106188403 13:27428355-27428377 CTGTCATTCCAGCCAGAGGAAGG - Intronic
1106312229 13:28564146-28564168 CCCTCCTGGCACCCAGAGCAGGG - Intergenic
1107042147 13:35960194-35960216 TTGCCCTTGCAGCCAGAGGATGG - Intronic
1109061964 13:57631755-57631777 CTTTCCGAGCAGCCAAAGGGAGG - Intergenic
1111821000 13:93215002-93215024 CTCCCCTAGAAGCCAGAGGTTGG + Intergenic
1112244936 13:97724258-97724280 CTCTTCCACCAGCCTGAGGATGG + Intergenic
1114191168 14:20440408-20440430 AGCTCCTAGAAGCCAGAGGTAGG - Intergenic
1119228025 14:72958916-72958938 CTCTCCTAGCAGCCAGAGGATGG - Exonic
1119911500 14:78353662-78353684 CTCTTCAAGCCACCAGAGGAAGG - Intronic
1122706484 14:103625169-103625191 CACCCCTCCCAGCCAGAGGATGG + Intronic
1123988062 15:25662425-25662447 ATCTCATAGCAGACAGTGGATGG + Intergenic
1124377361 15:29136562-29136584 CTCTCAAAGCCGCCAGAGCAGGG + Intronic
1126063681 15:44808584-44808606 CTCTCCTATCAGGCAGAGGCTGG - Intergenic
1126678917 15:51185537-51185559 CTGTCCTAGGAGGAAGAGGAAGG + Intergenic
1128614786 15:69100681-69100703 CTATCCTAGCTGCCAGAGGGAGG + Intergenic
1129748523 15:78042630-78042652 ATCTCCCAGCACCCAGGGGATGG - Intronic
1131365339 15:91834390-91834412 ATTTCCCAGCAGCTAGAGGAAGG - Intergenic
1131604748 15:93889669-93889691 TTCTGCCAACAGCCAGAGGAGGG + Intergenic
1132336908 15:101053552-101053574 CTGGCCTCGCAGCCAGGGGATGG - Intronic
1132671323 16:1103253-1103275 CTCTCCTGGCAGGCGGTGGACGG + Intergenic
1132854490 16:2038722-2038744 CTCTCCGAGGGGCCTGAGGATGG + Exonic
1133414516 16:5595967-5595989 CACTCCTAGGAGACAGAAGATGG - Intergenic
1135572750 16:23561748-23561770 CTCTCCTAGCAGACAAAAAATGG - Intronic
1136129810 16:28212375-28212397 CTGTCCTAGCATCCACAGCAGGG - Intergenic
1137780702 16:51095661-51095683 CTCTCCTGGAAGCCACAGCAGGG + Intergenic
1138342967 16:56302728-56302750 AGCTCCTAGCAGCCAGGGGCTGG - Intronic
1140094001 16:71859901-71859923 CTGTCCTTGCTGCCAGAGGCAGG - Exonic
1140809772 16:78566122-78566144 CTCTCATGGCAGAGAGAGGAAGG + Intronic
1140812677 16:78593474-78593496 CATTCCTACCAGCCAGAGGTGGG + Intronic
1141520324 16:84574437-84574459 CTCTCATAGCTGCCAGACGGGGG + Intronic
1143531082 17:7503742-7503764 CTCCCCAAGCAGCCAGTCGAAGG - Exonic
1144145083 17:12389524-12389546 CACTCTCAGCAGCCAGAGAAAGG - Intergenic
1144666287 17:17104597-17104619 CTCTGCTAGCAGCCAGGGGAAGG - Intronic
1146298819 17:31672345-31672367 CTTTCTGAGCAGGCAGAGGAGGG - Intergenic
1146587746 17:34097055-34097077 CTCTCTAAGCACACAGAGGAAGG + Intronic
1146904283 17:36608256-36608278 CTCCATTTGCAGCCAGAGGAAGG + Exonic
1146952003 17:36913317-36913339 CTTTTCAATCAGCCAGAGGAGGG + Intergenic
1147040360 17:37713684-37713706 CTCATCTATAAGCCAGAGGACGG + Intronic
1147179818 17:38677243-38677265 CCCTCATAGCAGGCTGAGGATGG - Intergenic
1147914706 17:43879445-43879467 CTGTCCTAGGAACCAGAGAAAGG + Intronic
1148160001 17:45444299-45444321 CTCTCCCAGCACCCTCAGGAGGG - Intronic
1148918101 17:51001593-51001615 CTCTCCTAGTAAACAGAGAAAGG + Intronic
1150391293 17:64791178-64791200 CTCTCCCAGCACCCTCAGGAGGG - Intergenic
1150410075 17:64935221-64935243 CTCTCCTGGCACCCTCAGGAGGG - Intergenic
1150805658 17:68316813-68316835 CTCACCCTCCAGCCAGAGGAGGG - Intronic
1151141306 17:71994902-71994924 CTCTGCTAGCTGCCAGCGCATGG - Intergenic
1151178953 17:72311986-72312008 CTCTGCTAACAGACAGGGGAGGG + Intergenic
1151549495 17:74813936-74813958 GTCTCCTTCCAGCCAGAGGAAGG + Intronic
1151654754 17:75490624-75490646 CTCTCCAAGCTGGCAGAGGGGGG - Intronic
1152075835 17:78159020-78159042 CTCTCCCAGATGCCTGAGGAGGG - Intronic
1152508481 17:80769594-80769616 CTCTTCTTGGAGACAGAGGAGGG + Intronic
1153759514 18:8317108-8317130 CCCTCCCAGCAGCCAGATCACGG - Intronic
1154350641 18:13580421-13580443 CTGTCTCTGCAGCCAGAGGATGG + Intronic
1156221564 18:35057771-35057793 CTCTCATTTCAGCCAGAGAATGG - Intronic
1157664079 18:49470410-49470432 CTATCCAAGCAGCAAGAAGATGG - Intergenic
1160015093 18:75134134-75134156 CTCTCCCAAGACCCAGAGGAAGG + Intergenic
1160608053 18:80066969-80066991 CCCTCCAGGCAGGCAGAGGAGGG + Intronic
1160739404 19:679102-679124 TTCTCCCAGAAGCCAGAGGGGGG - Intronic
1165155560 19:33785071-33785093 TTCTCCTAGCTGCAAGAGGAAGG + Intergenic
1165390691 19:35537038-35537060 CCCAGTTAGCAGCCAGAGGAGGG - Intronic
1166011015 19:39943028-39943050 CTCTCCAAGCAGCAACAAGATGG + Intergenic
1166234456 19:41445690-41445712 CACGCCTAGCAGCCAGGGAAGGG + Intergenic
1166309891 19:41957013-41957035 CTCACCCAGCACCCAGAAGACGG + Exonic
1167869501 19:52355970-52355992 CTCTCCTAGAAGCTAGTGGGTGG + Intronic
925349662 2:3191960-3191982 CCCTGCTACCAGCCAGTGGAAGG + Intronic
927679621 2:25131282-25131304 CTCTCCTGGCACCCAAAGGCGGG - Intronic
928732914 2:34253438-34253460 CACTCCAAATAGCCAGAGGAAGG - Intergenic
929625970 2:43407056-43407078 CTTTCCTTGCAGGCAGTGGATGG + Intronic
930038565 2:47103263-47103285 CTCTCGTAGCTGCTCGAGGAAGG - Intronic
930766888 2:55093742-55093764 CTCTGATTACAGCCAGAGGAAGG + Intronic
931071217 2:58652437-58652459 CTCTTCTAGCAGCTGGGGGATGG + Intergenic
931837482 2:66114068-66114090 TTCTCCTAAGAGCCACAGGAAGG - Intergenic
933988530 2:87615250-87615272 CACTCACACCAGCCAGAGGATGG - Intergenic
934900812 2:98158619-98158641 GTGTCCTGGCAGCAAGAGGATGG + Intronic
936305310 2:111335561-111335583 CACTCACACCAGCCAGAGGATGG + Intergenic
936518700 2:113198653-113198675 CTGTGCAAGCAGCCACAGGAGGG + Intronic
937201325 2:120206218-120206240 TTGTCCTAGCAGCCAGGGGTTGG + Intergenic
937428495 2:121818745-121818767 CTCTTCTAGAACCCACAGGAAGG + Intergenic
938728043 2:134123912-134123934 CACTCTTAGTAGCCAGAAGATGG + Intronic
941026734 2:160464059-160464081 CTCTCCTATATGCCAGTGGAAGG + Intronic
944729035 2:202499581-202499603 CTCTCGTAGCCGCTCGAGGAAGG - Intronic
945161083 2:206891196-206891218 ATCTCCTAGCGACCATAGGAAGG + Intergenic
946469203 2:219940662-219940684 CTCACCTAGGAGAAAGAGGAAGG - Intergenic
946959901 2:224973553-224973575 CTCCCCTAGCACCCCGAGAAAGG + Intronic
948056026 2:235009907-235009929 CTTTCCCAGGAGCAAGAGGAAGG - Intronic
948056213 2:235010890-235010912 CTCTCCTAGGAGAGGGAGGAAGG - Intronic
948056293 2:235011211-235011233 TTCTCCTAGGAGAGAGAGGAAGG - Intronic
948388511 2:237596446-237596468 CTCACCTAGAAGCCAGAGCATGG - Intronic
1169017144 20:2301227-2301249 GTGTCCTTGGAGCCAGAGGAGGG + Intronic
1169259748 20:4127731-4127753 CACTCACAGCAGCCAGAGGATGG + Intronic
1169491048 20:6071696-6071718 CTCCCCTACCAGCCAGGGGCTGG + Intergenic
1170398138 20:15950360-15950382 CTCTCATAGCAGGATGAGGAAGG + Intronic
1170680479 20:18521361-18521383 CTGTCCTAGACCCCAGAGGAAGG - Intronic
1170882221 20:20306729-20306751 CTTTCCAGGCAGGCAGAGGAAGG + Intronic
1172340681 20:34155098-34155120 CTCTCATAGCCGCTTGAGGAAGG - Intergenic
1172768576 20:37363943-37363965 CTCTCCCATCAGGGAGAGGATGG + Intronic
1172881566 20:38203182-38203204 CCCTTCTAGCAGCCACAGGAAGG - Intergenic
1174124069 20:48289768-48289790 CTGTCCTTGAAGACAGAGGAGGG + Intergenic
1174872105 20:54192509-54192531 CACTGCCAGCAGCCAGAGGGTGG - Intergenic
1179895164 21:44357740-44357762 CACTCCTAGCAGTCAGGGGACGG + Intronic
1179998934 21:44986474-44986496 CTCCCCTAGCTTACAGAGGAGGG - Intergenic
1180858002 22:19060170-19060192 CTGGCCTAGCAGCCACTGGAAGG - Intronic
1181805709 22:25373462-25373484 CTCTCCTGGCATCCAGTGGGTGG - Intronic
1181952058 22:26561756-26561778 CTATCCCAGCAGGCACAGGAAGG + Intronic
1182366240 22:29781287-29781309 CTCTCCTGACTGCCAGTGGAGGG - Intergenic
1183010296 22:34941014-34941036 CACTCCTAGCCCCCAGATGATGG + Intergenic
1185119693 22:48958581-48958603 CCTGCCCAGCAGCCAGAGGAGGG - Intergenic
950272889 3:11633366-11633388 CCCTCCAAGAAGGCAGAGGAGGG + Intronic
950497395 3:13341968-13341990 TTCTCCTAGGGGTCAGAGGAGGG - Intronic
952416159 3:33093067-33093089 CTCTCTTGGCAGCCAGGGGCTGG + Exonic
952453057 3:33449312-33449334 CTCTCGTAGCCGCTTGAGGAAGG - Intergenic
952523683 3:34187322-34187344 CTCTCCTATCAAGCAGAGGCTGG + Intergenic
952591082 3:34954632-34954654 GTCTCCTAACAGACAAAGGAAGG + Intergenic
953345510 3:42172149-42172171 CCCTCCTAGGAGCTGGAGGAGGG - Intronic
956655232 3:71543419-71543441 CACTGCTAACAGCCAGAGGTTGG - Intronic
958601413 3:96300453-96300475 CTCTCGTAGCCGCTCGAGGAAGG - Intergenic
960063715 3:113349194-113349216 CTCCCATAGCAGCTTGAGGAAGG - Intronic
960891978 3:122458703-122458725 CTCTCCAAGAAGGCAGAGGAAGG + Intronic
961459700 3:127042639-127042661 CACTCCAGGCAGCCAGTGGAGGG - Intergenic
963034254 3:141011723-141011745 CTCTCCTATCAGCCTGAAGGCGG - Intergenic
963122698 3:141789538-141789560 CTGTCCCAGGAGCCAGAGGAAGG + Intronic
963785978 3:149534829-149534851 CTTTCCTAGCAGCTGGAGGACGG + Intronic
965519173 3:169655903-169655925 CTCTCACAGCAGCCCAAGGAGGG + Intronic
968219917 3:196929266-196929288 CCATCCTAGCATCCAGAGGCTGG + Intronic
969611473 4:8229742-8229764 GTCTCCTTGCAGTCAGAGAATGG - Intronic
969953030 4:10858800-10858822 CTCTCATAGCAGAAAGTGGAAGG - Intergenic
971252282 4:24983371-24983393 CTTTCCAAGCAGCAAAAGGAGGG - Intergenic
971281181 4:25243706-25243728 CTCTCGTAGCCGCTCGAGGAAGG + Intronic
972635331 4:40878870-40878892 CGGTCATGGCAGCCAGAGGACGG - Intronic
972774066 4:42225294-42225316 CTCACCTAGCAGACAGGAGATGG + Intergenic
974630450 4:64481032-64481054 CACTCCTGGCAGCCACAGGGTGG - Intergenic
975152087 4:71033492-71033514 CTGTCCTAGACCCCAGAGGAAGG + Intergenic
977014346 4:91674093-91674115 CTCTCTCAGCTGACAGAGGAAGG + Intergenic
977097120 4:92760344-92760366 TCTTCCCAGCAGCCAGAGGAAGG - Intronic
977263391 4:94825169-94825191 TGCTGCTAACAGCCAGAGGATGG - Intronic
977594167 4:98859848-98859870 CTAACCTAGCAGCCAGAGTGAGG + Intergenic
983457764 4:167986007-167986029 CCCTCCTAGGGGCCTGAGGATGG - Intergenic
986184625 5:5423717-5423739 CTCTCCTAGCTGCCTGATGTCGG + Intronic
988641660 5:33047342-33047364 CTCTCCTGGAAGACACAGGAAGG + Intergenic
989197992 5:38734497-38734519 CTCTACTGGCAGCCAGGGAAGGG - Intergenic
991610271 5:68442585-68442607 ATGTCTTAGCAGCCAGACGATGG + Intergenic
991943886 5:71881505-71881527 CTCTGCTAGCAGGCTGGGGAGGG - Intergenic
993902400 5:93593539-93593561 CTGCCCAAGCAGCCACAGGAGGG - Intronic
994041250 5:95262096-95262118 ATGTCCCAGCAGCCAGAGTATGG + Intronic
994720579 5:103375452-103375474 GTCACCTAGCGGCCAGAGGCTGG + Intergenic
995769342 5:115652484-115652506 CTGTCCTAGACCCCAGAGGAAGG + Intergenic
996475072 5:123908597-123908619 CTCTCCTAAAAGGCAGAGGTTGG + Intergenic
998033671 5:138894717-138894739 CTTACCTAGAAGCCACAGGATGG - Intronic
998589310 5:143460621-143460643 CTCTCCCAGCTGACAGAGCAAGG + Intergenic
998777670 5:145620295-145620317 ATCTACAAGCAGCCAGAGAATGG + Intronic
999122560 5:149220428-149220450 CTCTCCCAGGAGCCAGGAGAGGG - Intronic
1002456920 5:179350541-179350563 CGCTCCTACCAGCGAGAGGAGGG - Intergenic
1004262327 6:14118638-14118660 CTCTCAAGGCTGCCAGAGGAAGG - Intronic
1005896890 6:30186120-30186142 CTCTCCCTGCGGCCAGAGGATGG - Exonic
1005987872 6:30885296-30885318 CGCTTCCAGCAGCCAGAGGCAGG + Intronic
1006084944 6:31588964-31588986 CTCCCCTAACAGCCAGAAGAGGG + Exonic
1006475397 6:34249371-34249393 CTCTCGTTGCAGCCAGAATAGGG + Exonic
1007752458 6:44078660-44078682 CTCTGCTGGTAGGCAGAGGAGGG - Intergenic
1008492662 6:52102528-52102550 CACTCATAGCAGCCAGAGGGTGG - Intergenic
1010853526 6:80808416-80808438 CTGTCTTAGCAGACAGAGCAAGG - Intergenic
1018147648 6:160907984-160908006 CATTTCTAGAAGCCAGAGGAAGG + Intergenic
1019971964 7:4548652-4548674 CTTTCCCAGGAGCGAGAGGATGG - Intergenic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1020438415 7:8190353-8190375 CTCTCTGAGGAGGCAGAGGAAGG - Intronic
1021898490 7:25259770-25259792 CTGCCCTAGAAGCGAGAGGAAGG + Intergenic
1021919205 7:25466725-25466747 CTCTGCTATCAGCCAGAGGAGGG + Intergenic
1022334442 7:29408947-29408969 CTCTCCTTTCAGCCACAAGATGG - Intronic
1023024030 7:36035193-36035215 CACTCCTAGCTCCCAGAGGGTGG - Intergenic
1023865619 7:44236873-44236895 TCCTCCTAGGAGCCTGAGGAAGG + Intronic
1025107116 7:56180730-56180752 CTCTCCCTGCACCCAGAGGGTGG + Intergenic
1025796276 7:64740271-64740293 CTCTGCGAGCAGGCAGAAGAAGG - Intergenic
1026311142 7:69185486-69185508 CTCTCCCTGCACCCAGAGGGAGG - Intergenic
1029258476 7:99285364-99285386 CGGTCCTAGCAGACAGAGGAGGG - Intergenic
1029466340 7:100727610-100727632 CTCTCCTAACGCCAAGAGGAAGG + Intergenic
1029541477 7:101185197-101185219 CTCCTCTTGCAGACAGAGGAAGG + Intergenic
1030099656 7:105934179-105934201 CTCTTCTACCTGACAGAGGAGGG + Intronic
1031919034 7:127588288-127588310 CTCCCCTAGGAGCCAGAGCCGGG + Intronic
1032782964 7:135178823-135178845 CACTACTAGTAGCCAAAGGAAGG + Intergenic
1033040977 7:137917945-137917967 CTCTGATGGCGGCCAGAGGAGGG + Intronic
1033477689 7:141706566-141706588 CTCTCCAGGCAGCTAGAGGCTGG - Intergenic
1033759242 7:144422244-144422266 CTCTCATAGCCGCTCGAGGAAGG + Intergenic
1034258203 7:149735991-149736013 CTCTCCTCACAGCCAGAGTCAGG - Intergenic
1034630400 7:152526087-152526109 CTCCCCTGGCAGCCAGGGGAGGG - Intergenic
1038409690 8:27348591-27348613 TTCTCTTTGCAGCTAGAGGAAGG + Intronic
1038638795 8:29307661-29307683 CTCTCATAGCTGCTCGAGGAAGG - Intergenic
1039409520 8:37340949-37340971 CTCTCCTAGAGGCCAGCTGAGGG - Intergenic
1041348080 8:56922019-56922041 CTCTCCATGCAGCCAAAGTAGGG + Intergenic
1042100497 8:65271110-65271132 CCCTCCTAGCAGGCAGAGCGAGG + Intergenic
1043121670 8:76332982-76333004 CTTTTCTAGTAACCAGAGGAAGG + Intergenic
1043204556 8:77420626-77420648 CATTCCTAGCAGCTGGAGGATGG + Intergenic
1044413323 8:91909527-91909549 CTATCCAAGCAGCAAGAAGATGG + Intergenic
1045294479 8:100861559-100861581 GGCTCCTATCAGCCAGAGGGAGG + Intergenic
1045294490 8:100861627-100861649 CTCTCCTATCAGCCAGAGGGAGG + Intergenic
1048016269 8:130500265-130500287 CCCTCGAAGCAGCCAGAGGATGG - Intergenic
1049121217 8:140739808-140739830 CTCCTGTCGCAGCCAGAGGAGGG - Intronic
1049147826 8:141014652-141014674 CTCTCCTGGCAGCCAGGGCGTGG - Intergenic
1049553964 8:143273231-143273253 CTCCCCTGGCTGCCAGGGGATGG + Intronic
1049659499 8:143813431-143813453 TTCTCCTAACAGCCAGGGCAGGG - Intronic
1051580072 9:18662238-18662260 CTCGCATAGCAGCCAGAGCAAGG - Intronic
1051995435 9:23210261-23210283 CTCTTCTAGCAGATAGAGAAGGG - Intergenic
1055083751 9:72293061-72293083 GTCTCCTACCAGCAAGAGGATGG - Intergenic
1056798783 9:89676940-89676962 CTCTGATAGCAGCCTGAGCATGG - Intergenic
1057095248 9:92301322-92301344 CTCTACTAGCTGCCATATGAAGG - Intronic
1057506464 9:95637767-95637789 CTTTCCCAGCAGCCACAGAAGGG - Intergenic
1058441765 9:105015310-105015332 CTCTCCTAGCTGACAGAGCTAGG + Intergenic
1060797296 9:126521664-126521686 CTCTGCGAGCAGCCAGTGGCGGG + Intergenic
1062289218 9:135787065-135787087 CCCTCCCAGCAGCCAGGGTAGGG + Intronic
1062367536 9:136218396-136218418 CTCTCCAGGCAGCCAGAGCTGGG + Intronic
1062447277 9:136600229-136600251 CTCTCAGAGCAGACAGAGGCTGG - Intergenic
1187759041 X:22559434-22559456 ACCTCCCACCAGCCAGAGGAGGG + Intergenic
1188228920 X:27636945-27636967 GTCTCCTAGTGGCCAGAGCATGG - Intronic
1188694813 X:33177250-33177272 CACTCCCAGCAGCTAGGGGATGG + Intronic
1190714099 X:53089429-53089451 TTCTCCTGGCAGCCAGCAGAGGG - Intergenic
1191825512 X:65361674-65361696 CTGTCCTAGACCCCAGAGGAAGG + Intergenic
1192870011 X:75176071-75176093 CTCTCGTAGCCGCTCGAGGAAGG + Intergenic
1193968151 X:88015541-88015563 CTCTTCTAGTAGACAGAGAAAGG + Intergenic
1194531627 X:95056022-95056044 CCCTCCTAGAAGCCAAAGCAGGG + Intergenic
1196458062 X:115903684-115903706 CTCCCCAAGCAACCACAGGAAGG + Intergenic
1198800334 X:140441051-140441073 CTCTCCTAGCAGGAAGAGGCAGG + Intergenic
1198935523 X:141899546-141899568 CACTCCTCCCAGCCTGAGGAAGG + Intergenic
1198962842 X:142201115-142201137 CTCTCTTCCCAGCCTGAGGAAGG - Intergenic
1200713819 Y:6514747-6514769 GTTTTCTAGCAGCCAGGGGAAGG - Intergenic
1201496397 Y:14594718-14594740 CTCTCGTAGCCGCTCGAGGAAGG + Intronic
1201555734 Y:15263400-15263422 CTCTCATAGCCGCTTGAGGAAGG - Intergenic
1202272057 Y:23082247-23082269 CTCTCGTAGCTGCTCGAGGAAGG + Intergenic
1202293969 Y:23338435-23338457 CTCTCGTAGCTGCTCGAGGAAGG - Intergenic
1202425054 Y:24715991-24716013 CTCTCGTAGCTGCTCGAGGAAGG + Intergenic
1202445735 Y:24954094-24954116 CTCTCGTAGCTGCTCGAGGAAGG - Intergenic