ID: 1119246157

View in Genome Browser
Species Human (GRCh38)
Location 14:73110263-73110285
Sequence CCACTTGCCCAGGAGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 515
Summary {0: 1, 1: 0, 2: 6, 3: 41, 4: 467}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119246157_1119246164 7 Left 1119246157 14:73110263-73110285 CCCTCTGCCTCCTGGGCAAGTGG 0: 1
1: 0
2: 6
3: 41
4: 467
Right 1119246164 14:73110293-73110315 GCCTCTACCTCGTGAGTATCTGG 0: 1
1: 0
2: 80
3: 4715
4: 105808
1119246157_1119246166 8 Left 1119246157 14:73110263-73110285 CCCTCTGCCTCCTGGGCAAGTGG 0: 1
1: 0
2: 6
3: 41
4: 467
Right 1119246166 14:73110294-73110316 CCTCTACCTCGTGAGTATCTGGG 0: 1
1: 1
2: 126
3: 6015
4: 121824
1119246157_1119246168 19 Left 1119246157 14:73110263-73110285 CCCTCTGCCTCCTGGGCAAGTGG 0: 1
1: 0
2: 6
3: 41
4: 467
Right 1119246168 14:73110305-73110327 TGAGTATCTGGGACACTTACAGG 0: 1
1: 0
2: 1
3: 17
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119246157 Original CRISPR CCACTTGCCCAGGAGGCAGA GGG (reversed) Intronic
900148297 1:1167689-1167711 CCCCTTGCCCTGGAGGAAGCAGG + Intergenic
900231473 1:1560989-1561011 CCACATGGCAAGTAGGCAGATGG + Intronic
901186063 1:7374119-7374141 CAAATTGCCCAGGAAGCAGCCGG + Intronic
901763657 1:11486790-11486812 CCAATTACTCAGGAGGCTGACGG - Intronic
901826180 1:11863058-11863080 GCACTGACCCAGGAGGCAGGAGG + Intergenic
902109343 1:14064974-14064996 CCTCTTGACCAGGAGGCTAAAGG - Intergenic
902426564 1:16328187-16328209 CCACTTACTCAGGAGGCTGGGGG + Intronic
904451974 1:30619096-30619118 CCACATGCCAAGGAGGAACAGGG + Intergenic
904619400 1:31766303-31766325 CTCCTTCCCCAGGAGGCAGCTGG + Intergenic
905340376 1:37273807-37273829 CCACTTGCAGAGGAGGTAGGTGG - Intergenic
905356692 1:37389818-37389840 ACCCTGGCCCAGGATGCAGAAGG - Intergenic
905395106 1:37661712-37661734 CCACCTGGCCAGGAACCAGAGGG + Intergenic
905706989 1:40067908-40067930 TCACTTTCCCATGGGGCAGATGG - Intronic
905815665 1:40948929-40948951 CAACTCGCCCACCAGGCAGATGG + Intergenic
906035903 1:42750333-42750355 CCAGCTGCCAAGGAGACAGATGG + Exonic
906659872 1:47574627-47574649 CCACTTCCTGAGGAGGCAGCAGG + Intergenic
907004576 1:50898189-50898211 CCAGCTACCCAGGAGGCTGATGG + Intronic
907406115 1:54254473-54254495 CCTCTAGCCAGGGAGGCAGATGG + Intronic
908014110 1:59814479-59814501 CCAGTGGCCGAAGAGGCAGAGGG - Intergenic
908129088 1:61056911-61056933 CCACTTGTCCAGGCTGCAAAAGG + Intronic
909850972 1:80463656-80463678 CCAATTTCGGAGGAGGCAGAAGG + Intergenic
910004093 1:82373659-82373681 CCAGTTACTCAGGAAGCAGAAGG - Intergenic
911388512 1:97208397-97208419 CCAGCTACCCAGGAGGCTGAAGG - Intronic
912409772 1:109472724-109472746 CCAGTTACTCAGGAGGCTGATGG - Intronic
913566811 1:120080670-120080692 CCACTTACCCAGGAGGCTGAGGG - Intergenic
913584813 1:120263953-120263975 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
913623370 1:120634406-120634428 CCAGTTACTCAGGAGGCTGAGGG - Intergenic
913631318 1:120712879-120712901 CCACTTACCCAGGAGGCTGAGGG + Intergenic
914287568 1:146241377-146241399 CCACTTACCCAGGAGGCTGAGGG - Intergenic
914548599 1:148692120-148692142 CCACTTACCCAGGAGGCTGAGGG - Intergenic
914566811 1:148875809-148875831 CCAGTTACTCAGGAGGCTGAGGG + Intronic
914606009 1:149254432-149254454 CCAGTTACTCAGGAGGCTGAGGG - Intergenic
914618081 1:149379591-149379613 CCACTTACCCAGGAGGCTGAGGG + Intergenic
915180957 1:154059221-154059243 CCAGTTACTCAGGAGGCTGAGGG + Intronic
915289305 1:154872193-154872215 CCAGCTACCCAGGAGGCTGAGGG + Intergenic
915524935 1:156469973-156469995 CCTCATGCCCAAGGGGCAGAGGG + Intronic
915727127 1:158025847-158025869 CCTCCTGCCCAGGAGGATGAAGG - Intronic
915917846 1:159951811-159951833 TCCCTTGGCCAGGAGGCAGAAGG + Exonic
918449489 1:184644930-184644952 CCACTGGCCCCGGGGGCTGAGGG + Intergenic
918449805 1:184647285-184647307 CCACCTGCCCAGGTGTCAGCTGG - Intergenic
918780740 1:188697070-188697092 CCACCTACTCAGGAGGCTGAGGG + Intergenic
919731744 1:200917107-200917129 CAATTTGGCCTGGAGGCAGAGGG + Intergenic
919981691 1:202645951-202645973 CAACTTTCCCAGGAGGCAGCAGG + Intronic
920557744 1:206916383-206916405 CCACTTTCCCAAGAGCAAGATGG + Intronic
922619320 1:226980521-226980543 CCACAGGCCTAGGGGGCAGAGGG + Intronic
923652115 1:235883708-235883730 CCACCTGCCAAAGAGCCAGAGGG - Intergenic
923713903 1:236408866-236408888 CCAGCTACCCAGGAGGCTGAGGG - Intronic
923715532 1:236421949-236421971 GCACTTGACCAGGAGGGAGAGGG + Intronic
924260730 1:242228114-242228136 ACACTTGCACACGAGGAAGATGG + Intronic
1063612052 10:7570942-7570964 CCATGTGCACAGAAGGCAGAGGG - Intronic
1063675550 10:8138309-8138331 CCACCTACTCAGGAGGCTGAGGG - Intergenic
1064057861 10:12112983-12113005 CCACTTGCTTAGGAGACAGATGG + Exonic
1065974289 10:30829057-30829079 TGACTAGCCCAGGAGACAGACGG - Intronic
1066763390 10:38780078-38780100 CCGGTTACCCAGGAGGCTGAGGG - Intergenic
1067091099 10:43266280-43266302 ACCCTTGCCCAGCAGGGAGAGGG + Intronic
1067304413 10:45047530-45047552 CCAGCTGCTCAGGAGGCTGAGGG + Intergenic
1067564640 10:47327684-47327706 CCCCTTCCTAAGGAGGCAGAGGG + Intergenic
1068023015 10:51607661-51607683 CCCGCTGCCCAGGAGGTAGAAGG + Intronic
1068585217 10:58790708-58790730 CCAGTTACTCAGGAGGCTGAGGG + Intronic
1069036237 10:63648713-63648735 CCAGCTGCTCAGGAGGCTGAGGG + Intergenic
1069468591 10:68664887-68664909 CCAGTTGCTCAGAAGGCTGAGGG - Intronic
1071594432 10:86908945-86908967 CTACATCCCCAAGAGGCAGAGGG + Intronic
1072930059 10:99654545-99654567 CCAGTTACTCAGGAGGCAGGAGG + Intergenic
1073985996 10:109209842-109209864 CCAGCTGCTCAGGAGGCTGAGGG - Intergenic
1074207630 10:111297709-111297731 CAACTCTCCCAGGAGGCAGCTGG + Intergenic
1075015737 10:118908927-118908949 CCACCTGCCCGGGAGCCAGACGG - Intergenic
1075119165 10:119651690-119651712 CCACTCGCCCATGATGCAGGTGG + Exonic
1075450329 10:122546890-122546912 ACTCTTGCTCAGGAGGCTGAGGG + Intergenic
1075565554 10:123501418-123501440 CCACCTCCCTAGGAGACAGAAGG - Intergenic
1075572432 10:123556068-123556090 GCACCTGCGCAGGAGGCAGGTGG - Intergenic
1075811176 10:125226316-125226338 TCACTGGCCAAGCAGGCAGAAGG - Intergenic
1076298081 10:129403060-129403082 CCTCAAGCCCAGGAGGCAGGAGG - Intergenic
1079985538 11:27196857-27196879 CCACTTCCCCAGCAGGAAAACGG - Intergenic
1080295324 11:30720629-30720651 CCACTTGCACAGGAGGCCGTGGG + Intergenic
1081596478 11:44462893-44462915 CCCCTTGCCAAGGAGACAGAGGG - Intergenic
1081874316 11:46398189-46398211 GCACTGGCCCAGAAGGCAGCAGG + Intronic
1081983086 11:47282218-47282240 CCACGTGCTCAGGATGAAGAGGG + Intronic
1082048741 11:47752697-47752719 CCAGTTACTCAGGAGGCTGAGGG + Intronic
1082258788 11:50061836-50061858 CCACCTCCTCAGGAGGCTGAGGG - Intergenic
1083319825 11:61838789-61838811 CCACTTGCGAAGGAGGCAGGAGG - Intronic
1083576154 11:63793290-63793312 CCACTGGCCCATAAAGCAGAAGG + Intergenic
1083668930 11:64289796-64289818 TCCCTTGACCAGGAGACAGAAGG - Intergenic
1083789377 11:64974607-64974629 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
1083993537 11:66260942-66260964 CCAGTTACTCAGGAGGCTGAGGG + Intronic
1084568186 11:69943527-69943549 CAGCTTCCCCAGGAGGCAGGAGG - Intergenic
1084889101 11:72228048-72228070 CCACCTGCCCAGGCTGCACAGGG - Intronic
1084965386 11:72741771-72741793 CCACGTGCCCTGGGGGCCGAGGG + Intronic
1085391205 11:76183216-76183238 CCCCTTACACAGGAGGGAGATGG + Intergenic
1085507721 11:77069656-77069678 CCAGCTGCCCAGGAGGCTGCTGG - Intronic
1085856987 11:80186297-80186319 AAACTTGCCCCAGAGGCAGAGGG + Intergenic
1086357848 11:86024015-86024037 CCAGCTGCTCAGGAGGCTGAAGG + Intronic
1086373156 11:86174761-86174783 CAACATGCCCAGGAGGGTGAGGG + Intergenic
1086496665 11:87410956-87410978 TCCATGGCCCAGGAGGCAGATGG - Intergenic
1087323850 11:96697313-96697335 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
1087819647 11:102697614-102697636 CCAGCTGCACAGGAGGCTGAGGG - Intronic
1087891891 11:103545003-103545025 CCACATGCCCAGCCGGCAAATGG + Intergenic
1088091875 11:106050597-106050619 CCATTTTCCCATAAGGCAGATGG + Intergenic
1088544532 11:110946220-110946242 CCAGGGTCCCAGGAGGCAGAGGG + Intergenic
1089167684 11:116489634-116489656 ACACTGGACCGGGAGGCAGATGG + Intergenic
1089561143 11:119343812-119343834 GTACCTGCCCAGGAGGCTGAAGG + Exonic
1091215681 11:133899975-133899997 CCACTTTCCGAGGACGCTGATGG - Intergenic
1091228353 11:133971762-133971784 CCCCTTGCCCAAGAAGCATATGG + Intergenic
1091477363 12:788770-788792 CCAGCTACCCAGGAGGCTGAGGG + Intronic
1091661812 12:2389847-2389869 GAACTTGCCCAGGGGACAGAGGG - Intronic
1092204216 12:6606076-6606098 CTCCGTGCCCAGGAGGCACATGG + Intronic
1094461685 12:30703158-30703180 GCACAAACCCAGGAGGCAGAGGG + Intergenic
1095295802 12:40526279-40526301 CAACTTTCTCAGGAGGCAGCGGG + Intronic
1095296308 12:40531215-40531237 CAACTTTCCCAGGAGGCAGTGGG + Intronic
1095296778 12:40535912-40535934 CAACTTTCTCAGGAGGCAGCGGG + Intronic
1095599141 12:43995154-43995176 CCAGTTACTCAGGAGGCTGAGGG + Intronic
1096339322 12:50784046-50784068 CCAACTACTCAGGAGGCAGAAGG + Intronic
1096341021 12:50799268-50799290 CCAGTTACTCAGGAGGCTGAGGG + Intronic
1096409658 12:51367985-51368007 TCACTTCCCCTGGAGGGAGAAGG - Intronic
1096989880 12:55792008-55792030 CCAGTTACTCAGGAGGCTGAGGG + Intronic
1097246374 12:57609912-57609934 CCAGGTCCTCAGGAGGCAGAGGG - Intergenic
1097860319 12:64512366-64512388 CTAACTACCCAGGAGGCAGAAGG + Intergenic
1098507753 12:71274150-71274172 CCACTTCCCCAGGAGGCTTAAGG + Intronic
1098882567 12:75931177-75931199 CCACTCACCCATGAGGCAGGGGG + Intergenic
1100362191 12:93889251-93889273 CCACTAGCCCTGGAGACATAGGG - Intronic
1101144308 12:101827067-101827089 CCAGCTGCTCAGGAGGCAGGAGG - Intronic
1101271884 12:103156106-103156128 TGACCTGCCCAGAAGGCAGAAGG - Exonic
1101669466 12:106854674-106854696 CCAGCTGCTCAGGAGGCTGAGGG + Intronic
1101729982 12:107418958-107418980 CTACTTGCCCAGGTAGCAGATGG + Intronic
1102331584 12:112036731-112036753 CCACCTACTCAGGAGGCCGAGGG + Intronic
1102894342 12:116586698-116586720 CCCCTTTCCCGGGAGGCATAAGG + Intergenic
1103346760 12:120256293-120256315 CCAGCTGCTCAGGAGGCTGAGGG + Intronic
1104426282 12:128681093-128681115 CCAGCTACTCAGGAGGCAGAGGG - Intronic
1104455264 12:128905945-128905967 CCAGCTACCCAGGAGGCTGAGGG - Intronic
1105285071 13:18996737-18996759 CCACATGGCCAGAAAGCAGAAGG + Intergenic
1105304775 13:19160753-19160775 CCACTCACTCAGAAGGCAGAAGG + Intergenic
1105406990 13:20141610-20141632 CCAATTGCCCAGGAGCTAAAGGG + Exonic
1105597095 13:21849109-21849131 CAACTTACCCAGGAATCAGATGG - Intergenic
1107708154 13:43127299-43127321 CCAGTTGCCCTGTGGGCAGAGGG - Intergenic
1108098431 13:46929394-46929416 GCACTTCCCCAGGAGGAAAAGGG + Intergenic
1108130274 13:47291831-47291853 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
1108314141 13:49221224-49221246 CCACTTACGCAGGACGCGGACGG - Exonic
1109298361 13:60563111-60563133 CCAGTTGCTCAGGAGGCTGAGGG + Intronic
1109605181 13:64685038-64685060 CAACTTGCTCAAAAGGCAGACGG - Intergenic
1109795297 13:67304090-67304112 GCACTTGTGCAGGAGCCAGATGG - Intergenic
1111293242 13:86195257-86195279 CCAGCTGCTCAGGAGGCTGAGGG + Intergenic
1111327620 13:86719822-86719844 CCAGCTACTCAGGAGGCAGAGGG + Intergenic
1113246389 13:108401677-108401699 CCAGCTGCCCAGGAGCCAGGAGG + Intergenic
1113655826 13:112067407-112067429 CCACTTGCCAAAGAGGCCGACGG - Intergenic
1114591262 14:23866906-23866928 CCACAGGCTCTGGAGGCAGACGG - Intergenic
1114857346 14:26465287-26465309 CCAGCTGCTCAGGAGGCTGAGGG - Intronic
1114955902 14:27818828-27818850 CCAGTTACCAAGGAGGCTGAGGG + Intergenic
1117703168 14:58435820-58435842 CCAGTTACTCAGGAGGCTGAGGG - Intronic
1119246157 14:73110263-73110285 CCACTTGCCCAGGAGGCAGAGGG - Intronic
1119262004 14:73243412-73243434 CAATTTTCCCAGGAGGCATATGG - Intronic
1119679868 14:76584360-76584382 CCACTGGCCCAGCAGGCAGGAGG + Intergenic
1119732202 14:76958008-76958030 CCAGTTACTCAGGAGGCTGAAGG - Intergenic
1119801639 14:77450623-77450645 CCAGCTGCTCAGGAGGCTGAGGG - Intronic
1119906029 14:78302802-78302824 CCAATTGCCTAGGAGGAGGAAGG - Intronic
1120258656 14:82153968-82153990 CCAGTTGACCAGGAGACAGAAGG + Intergenic
1121290679 14:92772382-92772404 CCAGCTACTCAGGAGGCAGAAGG + Intergenic
1121653274 14:95575706-95575728 CCATCTGCCCAGGAGAAAGAGGG - Intergenic
1121660125 14:95628719-95628741 GCACTTGCTCTGGAGGAAGATGG + Intergenic
1122084422 14:99289892-99289914 TCCCAGGCCCAGGAGGCAGAAGG + Intergenic
1122735143 14:103834703-103834725 CCAGTTACTCAGGAGGCTGAGGG - Intronic
1123501871 15:20893665-20893687 CAGCATGCCCAGGAGGCAGGTGG + Intergenic
1123559124 15:21467364-21467386 CAGCATGCCCAGGAGGCAGGTGG + Intergenic
1123595355 15:21904645-21904667 CAGCATGCCCAGGAGGCAGGTGG + Intergenic
1124840801 15:33240523-33240545 CCCCTTTCCCAGGATGCAGTGGG - Intergenic
1125456892 15:39869097-39869119 CCACTTGAACAGAATGCAGAGGG - Intronic
1125509928 15:40287399-40287421 GCACTGGCTTAGGAGGCAGAGGG - Intronic
1126806506 15:52354737-52354759 CCATCTACTCAGGAGGCAGAGGG + Intronic
1127851880 15:62920494-62920516 CGACTTGCCCAGGGGTCAGGGGG + Intergenic
1128264402 15:66254173-66254195 CCACTCCCCCAGGAGGGAAAGGG - Intergenic
1129297366 15:74607172-74607194 ACACTTGCCCAGGAGACTAAGGG + Intronic
1129350099 15:74951026-74951048 CCACTTACACAGGTGTCAGAGGG + Intergenic
1130062754 15:80581341-80581363 CCACTTGGCGAGGAGGTAGCTGG - Exonic
1130415757 15:83693338-83693360 CCACTGGTCCAGGAGGCAGGAGG + Intronic
1130544045 15:84841700-84841722 CCACTCCCCAAAGAGGCAGATGG + Intronic
1131091082 15:89625359-89625381 AGACTGGCCCAGGAGGAAGAGGG + Exonic
1131666082 15:94572442-94572464 CCAATTGCCCAGGCAGAAGAAGG + Intergenic
1132081075 15:98865955-98865977 CCACTTGCCTCGCAGGCAGGAGG + Intronic
1132357936 15:101186687-101186709 CCAGTTACTCAGGAGGCTGAGGG + Intronic
1132950749 16:2560905-2560927 CCACCTGCCCGGGATGCAGCAGG - Intronic
1132963601 16:2639265-2639287 CCACCTGCCCGGGATGCAGCAGG + Intergenic
1133076911 16:3286965-3286987 CCAGTTACTCAGGAGGCTGAGGG + Intronic
1133456237 16:5944842-5944864 CCAGCTACTCAGGAGGCAGAAGG + Intergenic
1134090114 16:11387047-11387069 CCCTGTGCCCAGGAGGCAGGGGG + Intronic
1135149899 16:19996283-19996305 CCAGTTGACAAGGAGGGAGAGGG - Intergenic
1135393907 16:22116569-22116591 CCATCTGCAGAGGAGGCAGAGGG + Intronic
1135458952 16:22624361-22624383 CCAATTACCCAGGTGGCAGCCGG - Intergenic
1136118150 16:28108799-28108821 AGACATGCTCAGGAGGCAGATGG + Intronic
1138093067 16:54192431-54192453 TCACTTGCTCTGGAGGCAGCTGG + Intergenic
1138262393 16:55634455-55634477 CCACATGCCCAGGTGGCTGGTGG - Intergenic
1138310603 16:56020368-56020390 CCATTTGCCCAAGTGGCAGAGGG + Intergenic
1139446557 16:67001777-67001799 AGCCTTGCCCAGGGGGCAGATGG - Intronic
1139910361 16:70393878-70393900 CAGGTTTCCCAGGAGGCAGAAGG - Intronic
1139948445 16:70657381-70657403 TGACTTGCCCAGGATCCAGAGGG - Intronic
1139962283 16:70724909-70724931 CCACCTACCCAGAATGCAGATGG - Intronic
1141100693 16:81195750-81195772 CCCCTTCCCCATGAGGGAGAAGG - Intergenic
1141408585 16:83816283-83816305 CCAGTTGCTCGGGAGGCTGAGGG + Exonic
1141416612 16:83880369-83880391 CCAGTTACTCAGGAGGCTGAGGG - Intergenic
1142399469 16:89851789-89851811 CCTCTTGCCTCGGTGGCAGAAGG + Intronic
1142663883 17:1450390-1450412 CCAGCTGCTCAGGAGGCTGAGGG + Intronic
1142903187 17:3026178-3026200 TCAGCTGGCCAGGAGGCAGAGGG - Intronic
1143278216 17:5730537-5730559 CCACTTGCCCATGAGGGAGCAGG - Intergenic
1143294994 17:5864359-5864381 GTATTTGCCAAGGAGGCAGAGGG + Intronic
1143349326 17:6275922-6275944 CCATTTGCCCAGGACCCAGCAGG + Intergenic
1143769429 17:9158589-9158611 CCAGTGGACCAGGAGCCAGAAGG + Intronic
1143917027 17:10301700-10301722 CCTCCTGCACAGGAGACAGAGGG + Exonic
1145278471 17:21451588-21451610 CCAGTTACACAGGAGGCTGAAGG + Intergenic
1145743563 17:27295950-27295972 CCACCTACTCAGGAGGCTGAGGG - Intronic
1146342909 17:32037378-32037400 CCAGTTACTCAGGAGGCTGAGGG - Intronic
1147309712 17:39588020-39588042 CCACCTTCCCTGGGGGCAGAAGG + Intergenic
1147927620 17:43955188-43955210 CCACCTGCCCAGGAGGAGAAAGG + Intronic
1148260948 17:46183176-46183198 CCAGTTACTCAGGAGGCAGGAGG + Intronic
1148597861 17:48871371-48871393 CCAGTTACTCAGGAGGCTGAGGG - Intergenic
1148735293 17:49861682-49861704 TCACTTGCCCAGGAAGCCCAGGG - Intergenic
1149475160 17:56954720-56954742 CCAGCTACTCAGGAGGCAGAGGG + Intronic
1149912254 17:60577324-60577346 GCACTTACCCAGGAGAGAGATGG - Exonic
1150170980 17:62994254-62994276 CCAGGAACCCAGGAGGCAGAGGG - Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150783042 17:68138523-68138545 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
1151608059 17:75153087-75153109 CCACTTGGCCAGGACCCCGAGGG + Intronic
1151729929 17:75905033-75905055 CCACCTGCGCCCGAGGCAGACGG - Exonic
1152123544 17:78433156-78433178 CCCCTCGCCCAGAAGGCAGAGGG - Intronic
1152220158 17:79059553-79059575 CCAGCTGCTCAGGAGGCTGAAGG + Intergenic
1152271755 17:79329038-79329060 CCACGTGGCCAGGAGGGACAGGG + Intronic
1152436345 17:80278588-80278610 CCATGGGCCCTGGAGGCAGACGG + Intronic
1152467963 17:80476384-80476406 CCCGGCGCCCAGGAGGCAGAGGG + Exonic
1152604439 17:81282068-81282090 ACACATTCCCAGGAGGCAGCAGG + Intronic
1152624722 17:81383013-81383035 TCACCTGCACAGGAGGCTGAGGG - Intergenic
1152925768 17:83087110-83087132 CCACAGGCCCAGGAGGCACACGG - Intronic
1154477522 18:14777826-14777848 CCAGCTACTCAGGAGGCAGAAGG + Intronic
1155438350 18:25835873-25835895 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
1156285950 18:35696048-35696070 CGACTTGCCCAGAAGCCAGCTGG - Intronic
1156473730 18:37393204-37393226 CCCCTTGACCAGGAGGTAGCAGG - Intronic
1157104592 18:44761911-44761933 CCACTGGAGCAGGAGTCAGAAGG - Intronic
1159000618 18:62971632-62971654 ACACTTCCCCAGGAGGAAGCTGG + Intronic
1160537850 18:79604459-79604481 CTGCGTGCCCAGGGGGCAGAGGG - Intergenic
1160973597 19:1781210-1781232 CCACTGGCCCAGGAAGAAGACGG - Intergenic
1161445430 19:4316173-4316195 CCAGTTACTCAGGAGGCTGAGGG - Intronic
1161582988 19:5090864-5090886 CCACTGGCCCAGGAGACACCTGG - Intronic
1161767569 19:6215910-6215932 CCTTTTCCCCAGGAGGCACAGGG - Intronic
1162040018 19:7965166-7965188 CCAGCTGCTCAGGAGGCAGGAGG - Intronic
1162042751 19:7980368-7980390 CCACGAACCCAGGAGCCAGAAGG + Intronic
1162088451 19:8262279-8262301 CCAGTTGCCCAGAGGGAAGAAGG - Exonic
1162149339 19:8633733-8633755 TCCCTTGACCAGGAGGCAGGGGG - Intergenic
1162681214 19:12343344-12343366 CCAGCTGCTCAGGAGGCTGAGGG + Intergenic
1163012755 19:14435338-14435360 CCCCATCCCCAGCAGGCAGAGGG - Intronic
1163042278 19:14611458-14611480 ACTCGAGCCCAGGAGGCAGAGGG - Intergenic
1163359188 19:16835039-16835061 CCAGTTACTCAGGAGGCTGAGGG - Intronic
1163512264 19:17742400-17742422 CCTTGAGCCCAGGAGGCAGAGGG - Intergenic
1164763264 19:30743946-30743968 CCACTGGCCCTGGGGGCAGCCGG - Intergenic
1165074729 19:33274568-33274590 ACACTTGCCGAGGAGGGAGGTGG - Intergenic
1166512998 19:43423271-43423293 CCAGCTACTCAGGAGGCAGAGGG - Intergenic
1167058367 19:47127816-47127838 CCAGCTACCCAGGAGGCTGAAGG - Intronic
1167118017 19:47499362-47499384 CCAGTTTCCCAGGGAGCAGAAGG + Intronic
1167233259 19:48298166-48298188 CTACATGCCCAGGTGGGAGACGG - Exonic
1167241931 19:48349075-48349097 CCAGTTACTCAGGAGGCTGAGGG + Intronic
1168023065 19:53623833-53623855 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
1168220979 19:54960268-54960290 CCAGCTACCCAGGAGGCTGAGGG - Intronic
1168237945 19:55075450-55075472 CCACTGGCCCTGGAGACAGAAGG + Intronic
1168411768 19:56144708-56144730 CCCCTTGACCACAAGGCAGAGGG - Intronic
1168495491 19:56844720-56844742 CCAGCTACCCAGGAGGCTGAGGG - Intergenic
1202638299 1_KI270706v1_random:60588-60610 CCACTTGGCCAGGCTGCAAATGG + Intergenic
925486562 2:4339314-4339336 GCACCTGCCCATGAGGCACATGG - Intergenic
927925538 2:27010878-27010900 TCACTTGCCCAGGAGGAAGCTGG - Intronic
928274621 2:29888869-29888891 CGAGTTCCCCAGGAGTCAGAAGG - Intronic
928908567 2:36395127-36395149 CCAGTTACTCAGGAGGCTGAAGG - Intronic
929283356 2:40107436-40107458 ACACTTTCCCAAAAGGCAGAGGG + Intronic
930182673 2:48379679-48379701 CCATCTACCCAGGAGGCTGAGGG + Intergenic
931056938 2:58482896-58482918 CCAGCTACTCAGGAGGCAGAGGG - Intergenic
931973706 2:67619285-67619307 CCATCTGCCCAGGAGAGAGATGG + Intergenic
932197602 2:69797793-69797815 CCACTTGCAGAGGGGGCATAAGG + Intronic
932460575 2:71879492-71879514 CCACCTGCCCAGGAGCCCAAAGG - Intergenic
932561922 2:72880649-72880671 CCACTGGCCATGGAGGCAGGAGG - Intergenic
932619349 2:73256672-73256694 CCACCTGCACTAGAGGCAGAGGG - Exonic
933064736 2:77779309-77779331 CAATTTGCCCATGAGGCAAATGG + Intergenic
933833908 2:86231068-86231090 GCACTGGCCCCGGAGTCAGAAGG + Intronic
935083224 2:99819868-99819890 CCTCTTCCCCAGGAGGGGGAAGG - Intronic
935295026 2:101641374-101641396 CCAGCTGCTCAGGAGGCTGATGG + Intergenic
935657136 2:105433293-105433315 CCAGTTACTCAGGAGGCTGAGGG - Intronic
937144198 2:119628145-119628167 CCATTTGCCCAGGCAGCAGAAGG - Intronic
937989478 2:127654323-127654345 CCACTTGCTGAGGGCGCAGAAGG - Intronic
938153860 2:128910892-128910914 CCAGTTACTCAGGAGGCTGAGGG - Intergenic
938293580 2:130163072-130163094 CCACTCCCTCAGAAGGCAGAAGG + Intronic
938378858 2:130825582-130825604 CCTCTCACCCAGGAGGGAGAAGG + Intergenic
939410562 2:141819121-141819143 CCAGCTACTCAGGAGGCAGAGGG + Intronic
939490649 2:142872254-142872276 CCAGCTGCTCAGGAGGCTGAGGG + Intergenic
939830934 2:147069857-147069879 CCTCTTCACCATGAGGCAGATGG - Intergenic
940204496 2:151188053-151188075 CCACTTACTCGGGAGGCTGAGGG - Intergenic
940297184 2:152139440-152139462 CCAGCTACCCAGGAGGCTGAGGG + Intronic
940706760 2:157115035-157115057 CCACTTACTCAGGAGGCTGTAGG + Intergenic
940807629 2:158205823-158205845 CCACTTGTCCTTGATGCAGAGGG + Intronic
941878334 2:170457867-170457889 CCAACTGCTCAGGAGGCTGAGGG - Intronic
942381516 2:175396304-175396326 CCACATCCTTAGGAGGCAGATGG + Intergenic
944933725 2:204545817-204545839 CCACCTGGCCAGGCGGCAGGTGG - Intronic
945814599 2:214589028-214589050 CCACTTGGCCAGGAGGATCAGGG - Intergenic
947072009 2:226299033-226299055 CCAGCTACCCAGGAGGCTGAGGG + Intergenic
947430568 2:230024197-230024219 CCAGCTACCCAGGAGGCTGAGGG - Intergenic
947823823 2:233090840-233090862 CCAGCTACCCAGGAGGCTGAGGG + Intronic
949006229 2:241650168-241650190 CCACTTTCTAAGGAGGCAGCTGG - Intronic
1168807997 20:684131-684153 CCAGCTGCTCAGGAGGCTGAGGG - Intergenic
1168853537 20:993077-993099 CCACTTTCCCTGGAGCCCGATGG - Intronic
1170150742 20:13222831-13222853 GGATTTTCCCAGGAGGCAGAGGG + Intronic
1170454047 20:16516240-16516262 ACATTTGCCCAGGATGGAGAGGG + Intronic
1170601277 20:17843367-17843389 CCAGTTGCCAATGAGGCAGCTGG + Intergenic
1170745965 20:19099168-19099190 CCACCTGCCCCGAAGGCAGCAGG - Intergenic
1170953173 20:20955195-20955217 CCTCCTGTCCAGGAGTCAGATGG - Intergenic
1171334585 20:24371599-24371621 TCCATTGCCCATGAGGCAGAAGG - Intergenic
1172184973 20:33025876-33025898 CTCCTTGCCCAGAAGGAAGATGG + Intergenic
1173753344 20:45493749-45493771 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
1174599503 20:51712938-51712960 CCTGTGGCCCAGGAGCCAGAAGG + Intronic
1174754287 20:53142372-53142394 CCAAATGCCCAGGAGGAAAAAGG + Intronic
1175688770 20:61050611-61050633 TCACTGGCCCAGGAGGCAGGGGG + Intergenic
1175772006 20:61629875-61629897 CCAGCTGAACAGGAGGCAGAGGG + Intronic
1176135223 20:63519601-63519623 CCACGTGCTCAGGGGGCACAAGG + Intergenic
1176457939 21:6929224-6929246 CCACATGCCCTGGAGCCAGGAGG - Intergenic
1176836111 21:13794308-13794330 CCACATGCCCTGGAGCCAGGAGG - Intergenic
1177326155 21:19591827-19591849 CCACCTGCTCAGGAGGCAGAGGG - Intergenic
1177500365 21:21947200-21947222 CCACCTGCTCAGAAGGCTGAGGG + Intergenic
1177902148 21:26930002-26930024 ACACTTCCCCCGGACGCAGACGG + Exonic
1179633520 21:42692963-42692985 CCACATGTCCAGGAGGGAGCCGG + Intronic
1179718500 21:43302354-43302376 CCACCTGCCCCTGAGGCTGAGGG + Intergenic
1179996817 21:44977954-44977976 CCACATGCCCTGGAGCCAGGAGG - Intergenic
1180033515 21:45229050-45229072 CTGCTTGGCCAGAAGGCAGAAGG - Intergenic
1180363666 22:11921291-11921313 CCACTTGGCCAGGCTGCAAATGG - Intergenic
1181183749 22:21086582-21086604 CCAGCTGCCCAGGAGGATGAAGG - Intergenic
1181423502 22:22818064-22818086 CAGCTTTCCCAGGAGACAGATGG - Intronic
1182413996 22:30209417-30209439 GCACATGCCGAGGAGTCAGAGGG + Intergenic
1182644795 22:31799614-31799636 CCAGCTGCTCAGGAGGCTGAGGG - Intronic
1183468280 22:37991228-37991250 CCACCTACTCAGGAGGCTGAGGG - Intronic
1183491753 22:38120607-38120629 CCCCTTCCCAGGGAGGCAGAGGG - Intronic
1183508331 22:38221377-38221399 CCACCAGGCCAGGAGGCAGCTGG - Exonic
1183887204 22:40894055-40894077 CCAACTACCCAGGAGGCTGAGGG + Intronic
1184134133 22:42536371-42536393 GCACCTGCCCAGGAGGCCCATGG - Intergenic
1184176306 22:42791520-42791542 CCACTTACCCAAGAGGCTGAGGG - Intergenic
1184286930 22:43477143-43477165 CCACAGGCAGAGGAGGCAGAGGG + Intronic
1185020172 22:48369886-48369908 CCACCTTCCCAAGAGGCAGAGGG - Intergenic
950258948 3:11529936-11529958 CCTCTTGCCCAGGAGACAGGAGG + Intronic
950272307 3:11627478-11627500 CCAGCTACCCAGGAGGCTGAGGG + Intronic
951161967 3:19434481-19434503 GCCCTTGCCTAGGAGGCTGAAGG + Intronic
952121387 3:30248996-30249018 CCACCTGCTCAGGAGGCTGAGGG + Intergenic
952265634 3:31783674-31783696 CCAGCTACTCAGGAGGCAGAGGG + Intronic
953454294 3:43029683-43029705 CCTCATGTCCAGGAGGCAGAAGG + Intronic
953668611 3:44944089-44944111 CCAGCTGCTCAGGAGGCTGAGGG - Intronic
955372322 3:58363435-58363457 CCAGCTACTCAGGAGGCAGAGGG - Intronic
956731651 3:72201976-72201998 CCACTTTCCCCGCAGGTAGATGG - Intergenic
957162219 3:76624681-76624703 CCAGCTGCTCAGGAGGCTGAGGG + Intronic
960529417 3:118746259-118746281 CCACTTGCCTAGTATGTAGAAGG - Intergenic
961081398 3:124032320-124032342 CCAGTTGGCCAGGAGGAAGGAGG - Intergenic
961529805 3:127533530-127533552 ACACTGGCCCAGGTGGCAGTTGG - Intergenic
962274572 3:134002291-134002313 CCCCTGGGCCAGGAGGCAGGAGG - Intronic
964009107 3:151868392-151868414 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
965569805 3:170160790-170160812 CCAGTTACTCAGGAGGCTGAGGG + Intronic
966027967 3:175309298-175309320 CCAGTTACTCAGGAGGCTGAGGG - Intronic
966496785 3:180590355-180590377 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
967972015 3:195006094-195006116 CATCTTTCCCAGGAGGAAGAGGG + Intergenic
968131823 3:196196647-196196669 CCACTTCCCCAGGACGCGGCAGG + Intergenic
968187156 3:196640664-196640686 CCACGTACCCAGGAGCTAGACGG + Intronic
968465771 4:749898-749920 GCAGGAGCCCAGGAGGCAGAGGG - Intronic
968795809 4:2703638-2703660 GCACTTTCCCAGAAGGGAGAGGG + Intronic
968829515 4:2925651-2925673 CCACCTGCTCAGCAGGGAGAAGG + Intronic
969179528 4:5426590-5426612 CCACTTACTCAGGAGTCTGAAGG + Intronic
969398643 4:6939111-6939133 CGACTTGCCCCAGATGCAGAGGG - Intronic
969513309 4:7631934-7631956 GCACCTGCCCAGAAGGCAGCTGG - Intronic
969576453 4:8038816-8038838 CCAATTTCCCAGAAGGCAGAGGG - Intronic
969640279 4:8394099-8394121 ACTCTTGCTCAGGAGGCAGCAGG + Intronic
969846608 4:9924659-9924681 CCACTTGCCCAGCTGGGAAATGG - Intronic
970815486 4:20151296-20151318 CCACTTGCCCAGGCTGCCTAAGG + Intergenic
971102743 4:23485895-23485917 CCACTTGGCCAGAAGGAAGCAGG - Intergenic
972490364 4:39581657-39581679 CCAGCTGCTCAGGAGGCTGAGGG - Intronic
972603199 4:40590915-40590937 CCAGCTGCTCAGGAGGCTGAGGG - Intronic
973962842 4:56129188-56129210 CCAGTTACTCAGGAGGCTGAGGG - Intergenic
975658327 4:76663642-76663664 CCAGCTACCCAGGAGGCTGAGGG - Intronic
976298251 4:83493534-83493556 CCAACTGCTCAGGAGGCTGAAGG - Intronic
976756037 4:88498683-88498705 CCAGTTACTCAGGAGGCTGAGGG - Intronic
977189466 4:93981601-93981623 CCACTTGCCCAGTAGCCTCAGGG - Intergenic
977192710 4:94020863-94020885 CCAGCTACCCAGGAGGCTGAGGG + Intergenic
978198892 4:106001763-106001785 CTACTTGCCAAGGAAACAGAAGG - Intronic
979093836 4:116519657-116519679 CGACTTGCCCCTGAGGCAGATGG + Intergenic
982624899 4:157754325-157754347 GCTCTTGCACAGGAGGAAGATGG - Intergenic
985005208 4:185527937-185527959 CCAGCTGCTCAGGAGGCTGAGGG + Intronic
985305815 4:188538360-188538382 CCACATGACAAGGAGGCAGGGGG + Intergenic
1202765637 4_GL000008v2_random:146446-146468 CCACTTGGCCAGGCTGCAAATGG + Intergenic
985901326 5:2797269-2797291 GCACTTGCCCAGGAAGCTGCAGG + Intergenic
986148547 5:5104720-5104742 CAGCTTAGCCAGGAGGCAGAGGG - Intergenic
986402175 5:7393557-7393579 CCACTTCCCCACTAGGAAGAAGG + Intergenic
986502915 5:8418929-8418951 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
987355240 5:17058013-17058035 CCACAGGCCTAGGAGCCAGAAGG - Intergenic
988306428 5:29499456-29499478 CCCCTTCCCCAGGAGACATACGG + Intergenic
988492421 5:31716398-31716420 ACACTGGGTCAGGAGGCAGAAGG + Intronic
990362298 5:55032615-55032637 CCACCTACTCAGGAGGCTGAGGG + Intronic
990457523 5:56002308-56002330 CCAGCTACCCAGGAGGCTGAGGG + Intergenic
990543265 5:56795900-56795922 CCAGTTGCTCAGGAGGCTGAGGG + Intergenic
992081635 5:73239143-73239165 TCACAGGCCCATGAGGCAGAAGG - Intergenic
992332915 5:75736221-75736243 CCACTTCCCCAGGTTGCAGCAGG + Intergenic
993977741 5:94502992-94503014 CCAGTTACTCAGGAGGCTGAGGG + Intronic
997680895 5:135749955-135749977 CTGCTTGCCCAGGAGGAAGTGGG - Intergenic
998864038 5:146476868-146476890 CCACCTACCCAGGAGGCAGGAGG - Intronic
999760843 5:154699868-154699890 CCACTTGCATAGGAGGGACAGGG - Intergenic
1000877939 5:166664250-166664272 CCAGTTACTCAGGAGGCGGAGGG - Intergenic
1001384922 5:171330875-171330897 CCAGCTGCTCGGGAGGCAGAGGG - Intergenic
1002127989 5:177060995-177061017 CCAGTTACTCAGGAGGCTGAGGG + Intronic
1002414045 5:179109217-179109239 CCCTTGACCCAGGAGGCAGAGGG + Intergenic
1002607574 5:180392134-180392156 CCAGTTACTCAGGAGGCTGAGGG - Intergenic
1004442231 6:15664334-15664356 CCAAGTGCCCAGGAGGCAATTGG - Intergenic
1004679044 6:17874549-17874571 CCAGCTACCCAGGAGGCTGAAGG - Intronic
1004898545 6:20172312-20172334 CCAGCTACCCAGGAGGCTGAGGG + Intronic
1005318203 6:24624948-24624970 CCACCTACTCAGGAGGCTGAGGG + Intronic
1006382362 6:33707001-33707023 CCACCTGCCCAGGAGGCAATGGG + Intronic
1006541499 6:34743794-34743816 CCAGGTACCCAGGAGGCTGAGGG + Intergenic
1006931671 6:37692527-37692549 CCAGCTGCCCAGGAGGCATGGGG - Intronic
1007303575 6:40887148-40887170 ACACTTGCTCAGGAAGCTGAAGG + Intergenic
1007423480 6:41733574-41733596 CCCCGCGGCCAGGAGGCAGACGG + Intronic
1007496015 6:42260791-42260813 TCACATGGCCTGGAGGCAGATGG - Intronic
1008602926 6:53113106-53113128 CCACTCCCCCAGGAGGATGAGGG - Intergenic
1009025389 6:57993070-57993092 CCAGCTGCCCAGGAGGCTGAGGG + Intergenic
1009620253 6:66065672-66065694 CCACTGGGCCAGGAAGCTGAAGG + Intergenic
1010571044 6:77475033-77475055 CCACAGGCACACGAGGCAGATGG + Intergenic
1010982324 6:82382217-82382239 CCAGCTACTCAGGAGGCAGAGGG - Intergenic
1011433618 6:87314628-87314650 CCACTTGCCCAGAATGAAGGTGG - Intronic
1014256839 6:119169104-119169126 CCAGCTACCCAGGAGGCGGAGGG + Intergenic
1015047512 6:128794139-128794161 CCAGCTACCCAGGAGGCTGAGGG + Intergenic
1015532798 6:134237560-134237582 CCAGCTACTCAGGAGGCAGAGGG + Intronic
1016351306 6:143171868-143171890 CCACCTTCACAGGAGTCAGATGG + Intronic
1016416498 6:143839788-143839810 GCTCGTACCCAGGAGGCAGAGGG - Intronic
1016480458 6:144475722-144475744 CCAGCTACCCAGGAGGCAGGAGG - Intronic
1016665087 6:146630120-146630142 CCAGATGCTCAGGAGGCTGAAGG + Intronic
1017349678 6:153425722-153425744 CTACATGCCCAGGAGGAAGGAGG - Intergenic
1018835481 6:167480226-167480248 CGCCTTGCCCAGGTGGGAGAAGG - Intergenic
1019280011 7:194869-194891 CCTCCAGCCCAGCAGGCAGACGG + Intronic
1020007639 7:4790913-4790935 TCTCTTCCCCAGGAGCCAGAAGG - Intronic
1021559868 7:21958846-21958868 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
1021930689 7:25578359-25578381 CCACTTCCTCAGGAGGCCCAGGG + Intergenic
1022117057 7:27270442-27270464 TCACTAGCCCAGGAGGTGGAGGG - Intergenic
1022514937 7:30969488-30969510 CCAACTGCCCAGGATGGAGAGGG + Intronic
1022721562 7:32945890-32945912 CCAGTTACTCAGGAGGCAGGAGG - Intergenic
1023274036 7:38498933-38498955 CAACTGGGCCAGGAAGCAGAAGG - Intronic
1023395916 7:39751884-39751906 CCAGCTACTCAGGAGGCAGAGGG + Intergenic
1023959088 7:44912069-44912091 TCACAAGGCCAGGAGGCAGATGG + Intergenic
1024005149 7:45219848-45219870 CCTCAGGCACAGGAGGCAGATGG - Intergenic
1024054007 7:45648140-45648162 GCACACTCCCAGGAGGCAGAAGG - Intronic
1024655788 7:51450477-51450499 CCACTTTCCCAGTTGGCATAGGG - Intergenic
1025055856 7:55764333-55764355 CCAGCTACCCAGGAGGCTGAGGG + Intergenic
1025946160 7:66106512-66106534 CCACCTACTCAGGAGGCCGAGGG - Intronic
1026349405 7:69502781-69502803 ACAGTGGCCCAAGAGGCAGATGG - Intergenic
1027541069 7:79466379-79466401 CCAGTTGCTCGGGAGGCTGAGGG - Intergenic
1029508287 7:100976161-100976183 CCAGCTGCTCAGGAGGCTGAGGG + Intronic
1030090882 7:105857465-105857487 CCAGTTGTCCAGGAGGTGGAAGG - Intronic
1030717549 7:112827832-112827854 CCAGCTGCTCAGGAGACAGATGG - Intronic
1031018627 7:116602717-116602739 CCATTTACTCAGGAGGCTGAAGG - Intergenic
1032291835 7:130596078-130596100 CCTCTTGCCCAGGAGGCCCATGG - Intronic
1033429223 7:141273833-141273855 CCACATGCCCAACAGGCAGTGGG - Intronic
1034446512 7:151116626-151116648 CTAGTTCCCCAGGAGGCAGTGGG - Intronic
1035759647 8:2060246-2060268 ACGCTTGTCCAGGAGCCAGAAGG + Intronic
1036645105 8:10607823-10607845 GTAGATGCCCAGGAGGCAGAAGG - Exonic
1036804822 8:11823682-11823704 CCAGTTACTCAGGAGGCTGAGGG - Intronic
1037368052 8:18143916-18143938 CCACTTACCCAGGAGTCATTTGG + Intergenic
1037532659 8:19792652-19792674 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
1038112867 8:24518704-24518726 CCAGTTACTCAGGAGGCAGGAGG + Intronic
1039148229 8:34473963-34473985 CCAGCTGCTCAGGAGGCTGAGGG + Intergenic
1040905478 8:52465444-52465466 CCAGCTGCTCAGGAGGCTGATGG + Intergenic
1041302646 8:56429289-56429311 CACCTTGCCCAGGAAGCACAAGG + Intergenic
1041373926 8:57193364-57193386 GCGCTTGTCCAGGAGGAAGAAGG + Intergenic
1042390546 8:68228827-68228849 CCACCTACTCAGGAGACAGATGG + Intronic
1044011009 8:86994402-86994424 CCACCTGGCCAGGAGACAGTGGG - Intronic
1045355311 8:101382967-101382989 CCAGCTGCTCAGGAGGCTGAGGG - Intergenic
1045836707 8:106530404-106530426 CCAGCTACCCTGGAGGCAGAAGG - Intronic
1047390500 8:124446857-124446879 CCAATTACTCAGGAGGCTGAGGG - Intergenic
1047441756 8:124885012-124885034 CCACTTGCCCAGGCTGCATTTGG - Intergenic
1048442417 8:134469738-134469760 CCACTTCCCCAGGCAGTAGATGG - Intergenic
1048990816 8:139759173-139759195 CAACTTGCCCAGGCTGCATAGGG + Intronic
1049145238 8:140995692-140995714 CCAGCTACTCAGGAGGCAGAAGG + Intronic
1049480343 8:142819586-142819608 CTCCTGGCCCAGGAGGCAGCTGG - Intergenic
1050732462 9:8724853-8724875 ACCCGAGCCCAGGAGGCAGAAGG + Intronic
1051131455 9:13865574-13865596 CCAGTTACTCAGGAGGCTGAGGG + Intergenic
1051270214 9:15348197-15348219 CCAGCTGCTCAGGAGGCTGAGGG + Intergenic
1052745507 9:32436376-32436398 CGATTTCCCCAGAAGGCAGATGG - Exonic
1053324270 9:37128661-37128683 GCAGTTTCCCAGGAGGCTGAAGG + Intronic
1055612579 9:78038226-78038248 CCAACTCCCCAGGAGGCTGAGGG + Intergenic
1055729075 9:79262291-79262313 CCTTTGGCCAAGGAGGCAGAAGG + Intergenic
1055931274 9:81561979-81562001 CCAGTTACTCAGGAGGCTGAAGG + Intergenic
1056407933 9:86293858-86293880 CCAGCTGCTCAGGAGGCTGAGGG - Intronic
1056446852 9:86674686-86674708 ACACTTGAGCAGGAGGCAGAAGG + Intergenic
1057228454 9:93304666-93304688 TCACTTGCCCACCATGCAGATGG - Intronic
1057322933 9:94030907-94030929 CGACGCGCCCTGGAGGCAGAGGG - Intronic
1057602473 9:96470780-96470802 CCAGTTACTCAGGAGGCTGAGGG + Intronic
1057989702 9:99755782-99755804 CCATGGGCCCAGGAGGCAGTTGG + Intergenic
1060474819 9:123978803-123978825 CCACTTGTCCAATTGGCAGATGG + Intergenic
1060476543 9:123991320-123991342 CCACTTGTCCAATTGGCAGATGG - Intergenic
1061043880 9:128154039-128154061 CCAATTCCCCAGGACTCAGAGGG + Intergenic
1061117465 9:128623568-128623590 CCAGTGACCCAGGAGGCTGAGGG - Intronic
1061397058 9:130349031-130349053 CCACTTCCCCAGGATCCAGGAGG + Intronic
1061533892 9:131235742-131235764 CCACCTGCCCAGGGAGGAGATGG + Intergenic
1061698072 9:132393028-132393050 CCACAGGCCCAGGAGGCTGCTGG + Intronic
1062410589 9:136422185-136422207 TCACCTGCCAAGGAGGCAGCAGG - Intronic
1062516751 9:136940696-136940718 CAAGTTGCCCAGGAGGCCGAGGG + Exonic
1203782856 EBV:110517-110539 GCACTTGCTCAAAAGGCAGAGGG + Intergenic
1203546381 Un_KI270743v1:131336-131358 CCACTTGGCCAGGCTGCAAATGG + Intergenic
1185494026 X:540695-540717 CCACGAGCCAGGGAGGCAGAGGG - Intergenic
1186212517 X:7264429-7264451 CGCCATGCCCAGGAGGCAGGTGG - Intronic
1186326479 X:8482651-8482673 GTTCTTTCCCAGGAGGCAGATGG - Intergenic
1187459213 X:19470650-19470672 CAACATGCCCCGGAGGCAGAAGG + Intronic
1189498573 X:41532048-41532070 CCAGCTGCTCAGGAGGCTGAGGG - Intronic
1190245549 X:48688281-48688303 TCACCTGCCCAGGAGGAAAAAGG - Exonic
1191861433 X:65668705-65668727 CCGGATGCCCAGGAGGGAGAGGG + Intronic
1192175921 X:68885388-68885410 CTACCTGCCCAGGAGTCAGCAGG + Intergenic
1192635180 X:72808852-72808874 CCACCTACTCAGGAGGCTGAGGG + Intronic
1192646535 X:72911951-72911973 CCACCTACTCAGGAGGCTGAGGG - Intronic
1193559255 X:82997443-82997465 CCAGTTGCTCGGGAGGCTGAGGG - Intergenic
1193884058 X:86963243-86963265 CCCCTTCCCCAGGAGGCATGGGG - Intergenic
1194413345 X:93580861-93580883 GCACTTGCCCCTGAGGCAGATGG + Intergenic
1194846363 X:98814331-98814353 CCAGCTACCCAGGAGGCTGAGGG - Intergenic
1195371392 X:104178247-104178269 GCATGAGCCCAGGAGGCAGAGGG - Intronic
1198497789 X:137210650-137210672 CCTCTTGTCCAGGATGCACAGGG + Intergenic
1199426097 X:147702800-147702822 CCTATTGCCCAGGCTGCAGAGGG - Intergenic
1199947800 X:152681803-152681825 CCGCTGGACCAGAAGGCAGATGG + Intergenic
1199961879 X:152786651-152786673 CCGCTGGACCAGAAGGCAGATGG - Intergenic
1201910087 Y:19125146-19125168 CCAGTTACTCAGGAGGCTGAAGG - Intergenic