ID: 1119246718

View in Genome Browser
Species Human (GRCh38)
Location 14:73115974-73115996
Sequence AGAGCACTCATTTAAGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119246710_1119246718 25 Left 1119246710 14:73115926-73115948 CCTGGGTATTGGGAGTCAGATTG 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1119246718 14:73115974-73115996 AGAGCACTCATTTAAGTGGGGGG 0: 1
1: 0
2: 0
3: 13
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119246718 Original CRISPR AGAGCACTCATTTAAGTGGG GGG Intronic
902242882 1:15100445-15100467 AGAGCGCTGGTCTAAGTGGGAGG - Intronic
906754744 1:48300046-48300068 AGAGCACGCATGTAAGTGAGAGG + Intronic
906787603 1:48629619-48629641 AGAGAGCTAATTTCAGTGGGGGG + Intronic
906927867 1:50138446-50138468 AAAGCACTCATTCAAGCAGGAGG - Intronic
909984995 1:82150603-82150625 AGAGCAGTCAATTAAGTGAAAGG - Intergenic
912146631 1:106802233-106802255 AGAGCTCTCATTCAAGTGAAAGG + Intergenic
912584270 1:110747977-110747999 AGAGCACTTATATAACTGGGAGG - Intergenic
915033129 1:152901288-152901310 AGAGCTTTCATTCCAGTGGGGGG - Intergenic
915941059 1:160118475-160118497 AGAGGATTCATTTAATTGAGTGG - Intronic
916327947 1:163584166-163584188 AGAGCAATTACTGAAGTGGGAGG - Intergenic
919197812 1:194311517-194311539 AAAGCAATAGTTTAAGTGGGAGG - Intergenic
924049294 1:240064145-240064167 AGAGCAATTATGAAAGTGGGAGG + Intronic
1063853683 10:10222544-10222566 TGAGCTCTCATTAAAGTGTGTGG - Intergenic
1064930738 10:20623352-20623374 AGAGCCCACATTTAAGAGTGAGG - Intergenic
1069239015 10:66115272-66115294 AGAGCAAACATTAAAGGGGGTGG + Intronic
1072993362 10:100220114-100220136 AGATGACTCATTTAAATTGGGGG + Intronic
1074128762 10:110554040-110554062 GGAGCACACATTCCAGTGGGGGG + Intergenic
1074134890 10:110617730-110617752 TGAGCACACACTGAAGTGGGAGG + Intergenic
1079265790 11:18931477-18931499 AGGACACTCTGTTAAGTGGGAGG + Intergenic
1081403182 11:42666237-42666259 TGAGATCTCATTTGAGTGGGGGG - Intergenic
1082214671 11:49554500-49554522 AGAGCACTCATCCAAGGGTGAGG - Intergenic
1088926342 11:114307096-114307118 AGAGCACCTATTTAAGAGAGAGG - Intronic
1089435205 11:118459444-118459466 ACAGCACTTAATTAAGTGGTAGG - Intronic
1090742967 11:129682873-129682895 AGTGCACTCTTTTAAGTAGATGG + Intergenic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1095189799 12:39244430-39244452 ATAGAACTCATTTAAGTTTGAGG - Intergenic
1095286670 12:40420061-40420083 AAAGCACTGATTTAAGGTGGTGG + Intronic
1096468057 12:51858921-51858943 AGAGCACTTTTTTTGGTGGGGGG - Intergenic
1100007114 12:89907912-89907934 AAAGCACTAAGTAAAGTGGGAGG + Intergenic
1106420089 13:29578805-29578827 AGAGGACTCATTAAAGTCTGTGG - Intronic
1106584871 13:31048325-31048347 AGAGCTCTCATTTTTGTGTGGGG + Intergenic
1107852372 13:44583460-44583482 AGAACAATGATTTAAGTGGGAGG + Intergenic
1108394800 13:49981743-49981765 AGAGCTCACATTCTAGTGGGAGG + Intergenic
1114202167 14:20531876-20531898 AGAGAACTAACTTAAGTGTGTGG + Intergenic
1118663772 14:68044118-68044140 AGAGCAGTCATTTGAGTTGCTGG - Intronic
1118920188 14:70143077-70143099 ACAGCGCTCATTTAAGGGGTGGG - Intronic
1119246718 14:73115974-73115996 AGAGCACTCATTTAAGTGGGGGG + Intronic
1132220892 15:100104332-100104354 ACAGCACTCATAAAATTGGGAGG - Intronic
1137475164 16:48801550-48801572 AGAGCACACATTTAAATGGCAGG - Intergenic
1139230931 16:65281632-65281654 ATAAGACTCATTAAAGTGGGTGG - Intergenic
1140513811 16:75528117-75528139 AGATCTCTCATTTAATGGGGAGG - Intergenic
1141087662 16:81108444-81108466 AGAGCCCTCATTTAACAGGAGGG - Intergenic
1141611398 16:85183077-85183099 AGAGCACGCATGTGAGTGTGTGG - Intronic
1142236476 16:88924875-88924897 AGAGCACTCAGTGAGGTGGGAGG - Intronic
1145848747 17:28069709-28069731 AAACCAATCATTTAAATGGGTGG - Intronic
1152881122 17:82815931-82815953 AATGCACTCATTTAAGTGTACGG + Intronic
1153276191 18:3370002-3370024 AGAACAATCATTCAATTGGGAGG + Intergenic
1156407105 18:36793128-36793150 AGAGCACTAAACTAAGTGTGAGG - Intronic
1156738802 18:40298751-40298773 AGGACAATCATTTAAATGGGAGG - Intergenic
1156951847 18:42910323-42910345 ACAGCCCACATATAAGTGGGTGG - Intronic
927091296 2:19714805-19714827 AGAGTACTCATTCAAGTTGGTGG - Intergenic
928697595 2:33865474-33865496 AGAGCTCACATTTCAGTGGGGGG + Intergenic
934513492 2:94967990-94968012 AGAGAACTCCATAAAGTGGGTGG + Intergenic
934715414 2:96540142-96540164 AGGGCACTGATTTGAGTCGGTGG + Intronic
937236072 2:120432588-120432610 AGAGCACACATTTGGGTGTGGGG - Intergenic
937855411 2:126669028-126669050 AAAGCACCCATTTACGTTGGGGG - Intronic
939340642 2:140892011-140892033 AGAGCACTCACTCAGGTGAGAGG + Intronic
941062943 2:160868758-160868780 AGAGCACTCAGGAAAGTTGGAGG - Intergenic
942188269 2:173445415-173445437 AGAGCACTCAGTTAAGAGCAAGG + Intergenic
946823256 2:223651193-223651215 AGAACCCTGAATTAAGTGGGTGG + Intergenic
1169269252 20:4186846-4186868 AAAGCACTCAATAAAGTCGGTGG - Intronic
1171220419 20:23392171-23392193 AGAGCCCACATTTTAGAGGGAGG + Intronic
1172676114 20:36673655-36673677 AAAGTATTCATTAAAGTGGGCGG - Intronic
1173457073 20:43211487-43211509 AGAGCAATTAGTTAATTGGGAGG - Intergenic
1177380725 21:20340390-20340412 AAAGCACTCATTTTAGTGTAAGG - Intergenic
1178152651 21:29813386-29813408 AGAGGACTCATCTAATTAGGTGG - Intronic
1179047824 21:37861960-37861982 TCAGCACTCAGTCAAGTGGGTGG + Intronic
954137347 3:48588126-48588148 AGATCAATCAATGAAGTGGGTGG - Intronic
954879112 3:53822034-53822056 AAAGCAGGCATTCAAGTGGGTGG + Intronic
957368336 3:79256168-79256190 AAAGCCATTATTTAAGTGGGTGG - Intronic
970614299 4:17753478-17753500 GGAGAACTGATTTAAGTGTGTGG - Intronic
975921925 4:79401389-79401411 AGAGCTGTCATTTCAGTGGGAGG + Intergenic
981019865 4:140014350-140014372 AGAAGACTCATCAAAGTGGGAGG + Intronic
984180713 4:176479414-176479436 AGAGCATTCTTTCCAGTGGGAGG + Intergenic
987792225 5:22582420-22582442 ACAGCATTATTTTAAGTGGGAGG - Intronic
990736017 5:58863244-58863266 AAAGCAGTCAGTTAAGTGGCTGG + Intergenic
998937817 5:147249579-147249601 AGAGAACTCATTTAAGTTGCTGG + Intronic
1000414888 5:160974049-160974071 AAATCACTGACTTAAGTGGGTGG - Intergenic
1002494636 5:179603436-179603458 AGGGCACTCAGCTGAGTGGGTGG - Intronic
1004205499 6:13588076-13588098 AGATCACACATTTGTGTGGGAGG + Intronic
1004740139 6:18451953-18451975 AGAGCCCTAATTGAGGTGGGTGG + Intronic
1010813019 6:80322023-80322045 GGAGCATTCATTTAAGAGGAGGG + Intronic
1012889624 6:104883523-104883545 AGATCATACATTTCAGTGGGAGG - Intergenic
1015646311 6:135392758-135392780 AGAGCCCTCATTTATTTGGAGGG + Intronic
1021781400 7:24110151-24110173 AGAACATTCATGCAAGTGGGAGG - Intergenic
1029039480 7:97557753-97557775 AGAACACTCCTTTAAGAGGTGGG - Intergenic
1029404659 7:100367257-100367279 AGAGATCAGATTTAAGTGGGAGG - Intronic
1030952726 7:115811989-115812011 ATAGCACTCATTTATTTGGTTGG + Intergenic
1031884253 7:127229595-127229617 TGAGCTCTCATTTAAATAGGTGG + Intronic
1032651503 7:133883713-133883735 TGAACACTCATTTCTGTGGGAGG + Intronic
1034503724 7:151468685-151468707 GGAGCCCACATTCAAGTGGGTGG - Intronic
1034633863 7:152551899-152551921 AGAGGACTCAGTGCAGTGGGTGG + Intergenic
1040112354 8:43572110-43572132 AAAGCACTGATCTCAGTGGGGGG + Intergenic
1040715073 8:50241529-50241551 AGAGCAGTTATTTAGGTGGGTGG + Intronic
1042313264 8:67399441-67399463 AAAGCACTAATTTAAGTAGTAGG - Intergenic
1042436411 8:68771479-68771501 ACAGCACACATTTCAGTGCGTGG + Intronic
1045179089 8:99760488-99760510 AGAGCAGTGATTTAAGTGGTAGG + Intronic
1048502728 8:134993593-134993615 AGAGCTTTCATTCAAGTGGGTGG + Intergenic
1054806747 9:69403044-69403066 AGAGCTCACATTTGAATGGGAGG + Intergenic
1057558723 9:96110472-96110494 AGAGCACTCATTTTACTGTCAGG - Intronic
1057558728 9:96110531-96110553 AGAGCACTCATTTCACTGTCAGG - Intronic
1057748323 9:97770177-97770199 AGAGCACTCATTAAGGTGCCTGG - Intergenic
1058875428 9:109240027-109240049 TGAGCATTCAGTTAGGTGGGTGG - Intronic
1061636613 9:131914571-131914593 AGAGCTCTCATTCTAGTGGGTGG + Intronic
1185648555 X:1632229-1632251 AGAACACACAGTTAAGTGCGTGG + Intronic
1187211958 X:17240783-17240805 AGGGCACTAATATAAGTTGGTGG + Intergenic
1192592472 X:72371864-72371886 GGAGCTCACATTTTAGTGGGAGG + Intronic
1200840889 Y:7780736-7780758 ACAGGAGTCATTTAAGTGGAAGG + Intergenic