ID: 1119252187

View in Genome Browser
Species Human (GRCh38)
Location 14:73165912-73165934
Sequence ATCGGCATCCACCACTGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 182}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119252187_1119252191 -3 Left 1119252187 14:73165912-73165934 CCGGCGCAGTGGTGGATGCCGAT 0: 1
1: 0
2: 2
3: 21
4: 182
Right 1119252191 14:73165932-73165954 GATAATCCCAGCTCCTCGGGAGG 0: 1
1: 63
2: 4838
3: 69990
4: 284953
1119252187_1119252194 6 Left 1119252187 14:73165912-73165934 CCGGCGCAGTGGTGGATGCCGAT 0: 1
1: 0
2: 2
3: 21
4: 182
Right 1119252194 14:73165941-73165963 AGCTCCTCGGGAGGCTGACGCGG 0: 2
1: 153
2: 7957
3: 45954
4: 123629
1119252187_1119252189 -6 Left 1119252187 14:73165912-73165934 CCGGCGCAGTGGTGGATGCCGAT 0: 1
1: 0
2: 2
3: 21
4: 182
Right 1119252189 14:73165929-73165951 GCCGATAATCCCAGCTCCTCGGG 0: 1
1: 70
2: 8188
3: 98974
4: 263333
1119252187_1119252188 -7 Left 1119252187 14:73165912-73165934 CCGGCGCAGTGGTGGATGCCGAT 0: 1
1: 0
2: 2
3: 21
4: 182
Right 1119252188 14:73165928-73165950 TGCCGATAATCCCAGCTCCTCGG 0: 1
1: 50
2: 6233
3: 81003
4: 238543
1119252187_1119252197 29 Left 1119252187 14:73165912-73165934 CCGGCGCAGTGGTGGATGCCGAT 0: 1
1: 0
2: 2
3: 21
4: 182
Right 1119252197 14:73165964-73165986 GAGAATTGCTTGAACCTGAGAGG 0: 775
1: 22928
2: 67981
3: 138804
4: 183789
1119252187_1119252195 7 Left 1119252187 14:73165912-73165934 CCGGCGCAGTGGTGGATGCCGAT 0: 1
1: 0
2: 2
3: 21
4: 182
Right 1119252195 14:73165942-73165964 GCTCCTCGGGAGGCTGACGCGGG 0: 3
1: 1101
2: 97426
3: 257071
4: 275596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119252187 Original CRISPR ATCGGCATCCACCACTGCGC CGG (reversed) Intronic
901158480 1:7156328-7156350 ATCTGCTTCCACCACTAGGCTGG - Intronic
901432951 1:9229026-9229048 ATAGGCATGAGCCACTGCGCTGG - Intergenic
903227253 1:21900741-21900763 ATAGGCATGCACCACCGCGCTGG - Intronic
903603919 1:24561054-24561076 ATAGGCATGAGCCACTGCGCCGG - Intronic
904259107 1:29277958-29277980 ATAGGCACCTACCACTACGCCGG + Intronic
905799988 1:40837367-40837389 ATAGGCATGCGCCACTGCGCTGG + Intronic
908595602 1:65685861-65685883 ATGGGCATCCACCATTGCTGAGG - Intergenic
910186435 1:84546175-84546197 ACAGGCATGAACCACTGCGCTGG - Intergenic
910229671 1:84973334-84973356 ATAGGCATCCACCACCACACTGG - Intronic
912590337 1:110812435-110812457 ATAGGCACCCACCACCGCACCGG + Intergenic
914370621 1:147021550-147021572 CTCTGCATCCACAACTGCTCGGG + Intergenic
914484069 1:148091860-148091882 CTCTGCATCCACAACTGCTCGGG - Intergenic
915606658 1:156956256-156956278 ATAGGCATGCACCACTATGCTGG + Intronic
916359838 1:163956195-163956217 ACAGGCATGCACCACTGTGCTGG - Intergenic
917893828 1:179466399-179466421 ATAGGCATGAGCCACTGCGCTGG + Intronic
920767437 1:208846960-208846982 ATCCGGATCCACCACTGCTGTGG + Intergenic
921068205 1:211637883-211637905 ACAGGCATGCACCACTGCGTCGG + Intergenic
924066646 1:240230037-240230059 ATAGGCATGAACCACTGCGCCGG - Intronic
1063969961 10:11374693-11374715 ATAGGCATGCACCACTGCGCAGG + Intergenic
1064143856 10:12812083-12812105 ATCGCCAGCCATCGCTGCGCAGG - Intronic
1064799999 10:19059666-19059688 ATAGGCATGAGCCACTGCGCTGG + Intronic
1065510734 10:26475949-26475971 ATAGGCATGAACCACTGCACTGG - Intronic
1065627588 10:27647740-27647762 ACAGGCATGAACCACTGCGCCGG + Intergenic
1066272631 10:33838231-33838253 ATAGGCATGAACCACTGCACTGG - Intergenic
1068694458 10:59951005-59951027 ATAGGCATGAGCCACTGCGCCGG + Intergenic
1069517224 10:69087386-69087408 ACAGGCGTACACCACTGCGCTGG - Intergenic
1072108979 10:92300017-92300039 ATAGGCATGCACCACTACACTGG - Intronic
1073015166 10:100393084-100393106 ATAGGCATGCACTACTACGCTGG + Intergenic
1073412173 10:103351125-103351147 CTCGGACGCCACCACTGCGCAGG + Exonic
1073675555 10:105643304-105643326 ATAGGCATGCACCACCACGCCGG + Intergenic
1077302525 11:1853913-1853935 ATGGGCATCCAGCCCTGTGCTGG + Intronic
1079468899 11:20759600-20759622 AGCTTCATCCACCACTGGGCAGG + Intronic
1081705759 11:45181147-45181169 ACCGCCCTCCACCACCGCGCCGG - Intronic
1081935123 11:46898945-46898967 CTCGACATCTACCACTGCGATGG - Exonic
1082151938 11:48750256-48750278 AGGGGCACCCACCACTGCCCAGG - Intergenic
1082280130 11:50262633-50262655 ACAGGCATAAACCACTGCGCCGG - Intergenic
1083023838 11:59533234-59533256 ATAGGCATGAACCACTGTGCTGG - Intergenic
1085361081 11:75887721-75887743 ATAGGCATGAGCCACTGCGCCGG + Intronic
1086812024 11:91321994-91322016 AGGGGCATCCACCACTGCTGAGG - Intergenic
1087042603 11:93816472-93816494 ATGGGCATGAGCCACTGCGCCGG - Intergenic
1087484871 11:98748331-98748353 AGGGGCATCCACCACTGCTGAGG + Intergenic
1088633666 11:111798457-111798479 ATAGGCACCCACCACTGAGCTGG + Intronic
1092740175 12:11620602-11620624 ACCGGCATGAGCCACTGCGCTGG + Intergenic
1092825257 12:12393092-12393114 ACAGGCATGCACCACTGTGCTGG - Intronic
1093053009 12:14525118-14525140 ATAGGCATGCACCACTACACTGG - Intronic
1101140805 12:101793983-101794005 ATAGGCAACCACCACCGCCCTGG + Intronic
1101636924 12:106551610-106551632 AGGGGCATCCACCACTGCTGAGG - Intronic
1102304913 12:111797457-111797479 ATAGGCATGCACCCCTACGCTGG - Intronic
1102367742 12:112353930-112353952 ACAGGCATGCACCACTGTGCTGG - Intronic
1102438103 12:112941044-112941066 ATAGGCATGCACCACCGTGCTGG - Intronic
1105896881 13:24724026-24724048 ATGGGCCTCCACCACAGGGCGGG - Intergenic
1106035314 13:26038901-26038923 ATAGGCATGAACCACTGAGCCGG - Intergenic
1106520135 13:30490000-30490022 ACAGGCATCAGCCACTGCGCTGG + Intronic
1106974125 13:35186025-35186047 ATAGGCATGCACCACCGAGCTGG - Intronic
1108549247 13:51526813-51526835 ATCGGCATCCACCATTGCTGAGG + Intergenic
1109722170 13:66288989-66289011 AGCAGCATCCACCACAGCTCTGG + Intergenic
1110317699 13:74130390-74130412 ATAGGCATCAGCGACTGCGCTGG - Intronic
1116102498 14:40458883-40458905 ACAGGCATCCACCACAACGCTGG + Intergenic
1116482795 14:45411828-45411850 AGGGGCATCCACCATTGCTCAGG + Intergenic
1119252187 14:73165912-73165934 ATCGGCATCCACCACTGCGCCGG - Intronic
1121205029 14:92157363-92157385 ATAGGCATGCACCACCACGCAGG - Intronic
1124060056 15:26282987-26283009 ACAGGCATCCACCACTACGCCGG + Intergenic
1124937295 15:34185244-34185266 ACAGGCATGCACCACTGTGCTGG + Intronic
1125689836 15:41586999-41587021 ATAGGCATGAGCCACTGCGCCGG + Intergenic
1126669273 15:51101477-51101499 ATAGGCATGCACCACCACGCTGG - Intronic
1129868213 15:78924829-78924851 ATAGGCATGCACCACCACGCTGG + Intronic
1131736578 15:95339081-95339103 AACAGCATCCACCACTTAGCAGG - Intergenic
1132781137 16:1626283-1626305 ATCAGCCTCCGCCACTGCGGGGG - Intronic
1133001914 16:2856133-2856155 AATGGGACCCACCACTGCGCAGG - Exonic
1133485955 16:6218584-6218606 ACAGGCATGCACCACTGCGCCGG + Intronic
1133524509 16:6591310-6591332 ACAGGCATGCACCACTGCACCGG - Intronic
1134587177 16:15421849-15421871 AGAGGCATGAACCACTGCGCTGG + Intronic
1134752005 16:16632613-16632635 ATAGGCATGAGCCACTGCGCTGG + Intergenic
1138397702 16:56718452-56718474 ACAGGCACCCGCCACTGCGCTGG - Intronic
1139517920 16:67462684-67462706 ACAGGCATGTACCACTGCGCTGG - Intronic
1139583998 16:67889616-67889638 ACAGGCATGGACCACTGCGCTGG - Intergenic
1140126044 16:72119850-72119872 ATCGGGATGCCCCACTGCCCGGG - Exonic
1141446980 16:84066596-84066618 TCCGGCATCCACCACTGCCTGGG + Exonic
1142371252 16:89683955-89683977 ATAGGCATGAGCCACTGCGCCGG + Intronic
1143932450 17:10443769-10443791 ACAGGCATCCACCACTACGCTGG - Intronic
1144163703 17:12586695-12586717 ATAGGCATGAACCACTGTGCCGG - Intergenic
1144561158 17:16321212-16321234 ACAGGCATGAACCACTGCGCCGG + Intronic
1144609272 17:16695309-16695331 ACAGGCATGCACCACTGTGCTGG - Intronic
1144903492 17:18620214-18620236 ACAGGCATGCACCACTGTGCTGG + Intergenic
1144927571 17:18825771-18825793 ACAGGCATGCACCACTGTGCTGG - Intergenic
1145129078 17:20326511-20326533 ACAGGCATGCACCACTGTGCTGG - Intergenic
1145195586 17:20891112-20891134 ACAGGCATACACCACTGTGCTGG + Intronic
1146031262 17:29367820-29367842 ACAGGCACCCACCACTACGCCGG - Intergenic
1147998023 17:44371969-44371991 ATAGGCGTGAACCACTGCGCCGG + Intergenic
1148824229 17:50380455-50380477 ATAGGCATTCACAACTGCACTGG - Exonic
1149212221 17:54316792-54316814 AGGGGCATCCACCATTGCTCAGG + Intergenic
1153810314 18:8746750-8746772 ATCCACATCCATCACTGCCCAGG - Intronic
1154009485 18:10563027-10563049 ATTGGCAACCACAACTGCACTGG + Intergenic
1155665177 18:28299349-28299371 AGAGGCATCCACCATTGCGGAGG - Intergenic
1155974137 18:32109742-32109764 ACAGGCATGCACCACTGCGACGG - Intronic
1156717210 18:40025800-40025822 ATAGGCATGAGCCACTGCGCCGG - Intergenic
1158439552 18:57462528-57462550 ATAGGCATGCACCACCACGCTGG + Intronic
1160809850 19:1008627-1008649 ATGAGCATCTACCACTTCGCGGG + Exonic
1161224238 19:3135685-3135707 ACAGGCATCCACCACCACGCCGG - Intergenic
1161503252 19:4629392-4629414 ATAGGCATGAGCCACTGCGCCGG + Intergenic
1162134027 19:8544301-8544323 TTCGTCATCCACCACTACGCTGG - Exonic
1163079000 19:14922957-14922979 ATAGGCATGAGCCACTGCGCCGG - Intergenic
1163137521 19:15323374-15323396 ACTGGCATCCACCACTGGGCTGG + Intronic
1163285902 19:16347500-16347522 ATAGGCACCCACCACCACGCCGG - Intergenic
1165880702 19:39040849-39040871 ATAGGCACCCACCACCGTGCTGG + Intergenic
1166140225 19:40801356-40801378 GCCGTCATCCGCCACTGCGCAGG + Exonic
1168324842 19:55533052-55533074 ATAGGCATCAGCCACTGCGCTGG - Intronic
1168645885 19:58059259-58059281 ACCGGCAGCCGACACTGCGCCGG - Exonic
926092706 2:10060951-10060973 ATAGGCATGAGCCACTGCGCCGG - Intronic
926187619 2:10703518-10703540 ATGGGCATGAGCCACTGCGCCGG - Intergenic
929159460 2:38817206-38817228 ATAGGCATGAGCCACTGCGCAGG + Intronic
935359088 2:102232590-102232612 ACAGCCATGCACCACTGCGCTGG + Intronic
935676403 2:105598229-105598251 ATTGGAAGCCACCAATGCGCAGG + Intergenic
939631242 2:144528734-144528756 ATAGGCATGCACCACCACGCCGG - Intergenic
940227143 2:151411542-151411564 ATAGGCATCCGCCACCGCCCCGG + Intronic
940920250 2:159297871-159297893 ATAGGCATGCACCACTGCGCTGG + Intergenic
940954013 2:159708714-159708736 ATAGGCATGCACCAATGCACAGG + Intergenic
942065790 2:172270429-172270451 AGGGGCATCCACCACTGCTGAGG - Intergenic
945958262 2:216106264-216106286 ATAGGCACCCACCACTGTGCCGG - Intergenic
1172136773 20:32691800-32691822 ATAGGCATGAGCCACTGCGCCGG + Intergenic
1172313953 20:33939149-33939171 ACAGGCATGAACCACTGCGCCGG + Intergenic
1172594031 20:36137350-36137372 ATAGGCATGAGCCACTGCGCTGG + Intronic
1172607091 20:36221376-36221398 ATCTGCATTCAGCACTGCCCTGG + Intronic
1173893419 20:46531109-46531131 ATAGGCATGCACCACTACACGGG + Intergenic
1176181409 20:63751550-63751572 ATGGGTATCCACCACTGCACTGG + Intronic
1176968621 21:15239901-15239923 ATGGGCATGCACCACTGCACTGG + Intergenic
1177103442 21:16923747-16923769 ATCGGAATCAACCACTGCCTTGG + Intergenic
1180890361 22:19283555-19283577 ACAGGCATGCACCACTGCACTGG + Intronic
1181692050 22:24568696-24568718 ACAGGCACCCGCCACTGCGCCGG + Intronic
1182302456 22:29344918-29344940 ATGGGCCTGCACCACTGCACCGG - Intronic
1183743458 22:39680488-39680510 ATCTGCAGCCACCACAGGGCAGG - Intronic
1184550699 22:45202868-45202890 ATCCCCAACCACCAGTGCGCAGG - Intronic
1185185268 22:49395528-49395550 ACCTGCATTCACCACTGTGCTGG - Intergenic
950232619 3:11289834-11289856 ATGGGCATGGACCACTGCACTGG + Intronic
954727231 3:52623144-52623166 ATAGGCATGCATCACTGTGCCGG - Intronic
962795977 3:138850056-138850078 ACAGGCATGAACCACTGCGCCGG - Intergenic
964124654 3:153223542-153223564 ATAGGCATGCACCACTACGCTGG + Intergenic
965634717 3:170769453-170769475 ATAGGCATGAGCCACTGCGCTGG + Intronic
965938555 3:174146707-174146729 ACAGGCACCCGCCACTGCGCCGG + Intronic
966384816 3:179385045-179385067 ACAGGCATCCACCACCTCGCTGG + Intronic
966606669 3:181827927-181827949 ATAGGCATGAGCCACTGCGCCGG - Intergenic
968238707 3:197055225-197055247 ATAGGCATGAGCCACTGCGCTGG + Intronic
968570311 4:1336873-1336895 ATCAGCATCCGCCACCGTGCAGG - Exonic
974000886 4:56509674-56509696 ACAGGCACCCACCACTGCACTGG + Intronic
974689453 4:65277570-65277592 ACAGGCATCAACCACTGCACAGG - Intergenic
975656930 4:76650817-76650839 ATAGGCATGAGCCACTGCGCTGG + Intronic
977167702 4:93722058-93722080 ACAGGCATCCACCACCACGCCGG + Intronic
977500277 4:97828710-97828732 AGGGGCATCCACCACTGCTGAGG + Intronic
977612297 4:99048509-99048531 ATAGGCATGCACCACTATGCGGG + Intronic
981919561 4:150072699-150072721 ATAGGCACGCACCACTGCGCCGG + Intergenic
982263404 4:153516369-153516391 AGAGGCATGCACCACTGTGCCGG + Intronic
984770319 4:183431766-183431788 ATAGGCATGAGCCACTGCGCCGG + Intergenic
986323059 5:6649431-6649453 AGGGGCATCCACCACTGCTGAGG - Intronic
987966386 5:24881666-24881688 ACAGGCATCCACCACCGAGCTGG + Intergenic
988637937 5:33007771-33007793 ATAGGCATCCACCACCATGCTGG + Intergenic
996889800 5:128405027-128405049 ACAGGCACCCACCACTACGCTGG - Intronic
998347430 5:141476963-141476985 TTCGGCAGCCACAACCGCGCCGG + Exonic
998500623 5:142629438-142629460 ATAGGCATGAGCCACTGCGCTGG + Intronic
999444628 5:151629326-151629348 ATAGGCATGAACCACTGTGCCGG - Intergenic
1001045730 5:168370173-168370195 ATAGGCATGAATCACTGCGCTGG + Intronic
1003528567 6:6918620-6918642 AGAGGTATCCTCCACTGCGCTGG + Intergenic
1004844992 6:19631548-19631570 ATAGGCACCCACCACTGTGCCGG - Intergenic
1005296395 6:24431674-24431696 ATAGGCATGCACCACCACGCCGG + Intronic
1008790731 6:55229303-55229325 ATAGGCATGAACCACTGTGCTGG + Intronic
1009936103 6:70235969-70235991 ACAGGCATCCACCACTACGCCGG - Intronic
1012191257 6:96282568-96282590 AAAGGCATACACCACTGCACTGG - Intergenic
1015843039 6:137493464-137493486 AGCGGCTTCCAGCACTGGGCTGG - Exonic
1017190735 6:151649943-151649965 ATAGGCATGAACCACTGCACCGG + Intergenic
1019835374 7:3378053-3378075 ACAGGCATGAACCACTGCGCCGG + Intronic
1021287370 7:18797549-18797571 ACAGGCATGAACCACTGCGCAGG - Intronic
1023708237 7:42964752-42964774 ATAGGCATGAACCACTGCACTGG + Intergenic
1024116304 7:46197130-46197152 ATAGGCATGCACCACCACGCTGG + Intergenic
1024683234 7:51716658-51716680 ATGTGCACCCACCACTGCCCCGG - Intergenic
1026285793 7:68961854-68961876 ATAGGCATAAACCACTGCACTGG - Intergenic
1026341443 7:69437501-69437523 ATAGGCATGCACCACCGCTCTGG - Intergenic
1027125348 7:75553077-75553099 ATAGGCATGCACCACTATGCTGG + Intronic
1029083652 7:97994482-97994504 ACAGGCATGCACCACTACGCCGG - Intergenic
1031685335 7:124726939-124726961 ATAGGCATCAGCCACTGCACTGG - Intergenic
1032823313 7:135544693-135544715 ATAGGCATGAGCCACTGCGCCGG + Intergenic
1033195627 7:139324827-139324849 ACAGGCGTCCACCACTGCACCGG - Intergenic
1033634748 7:143201610-143201632 ACAGGCATGCACCACTACGCCGG + Intergenic
1034330605 7:150279026-150279048 ATAGGCGTGAACCACTGCGCCGG - Intronic
1034667437 7:152830823-152830845 ATAGGCGTGAACCACTGCGCCGG + Intronic
1034866954 7:154650041-154650063 ATAGGCATGAATCACTGCGCAGG - Intronic
1039491146 8:37948392-37948414 ATAGGCATGCACCACCACGCTGG + Intergenic
1039525960 8:38216685-38216707 ATGGGGACCCACCACTACGCTGG + Intergenic
1039663539 8:39494937-39494959 ACAGGCATGCACCACTACGCTGG + Intergenic
1044556627 8:93569154-93569176 ATAGGCATGAACCACTGTGCTGG - Intergenic
1045130511 8:99146844-99146866 ATAGGCATGAACCACTGTGCTGG + Intronic
1052760394 9:32584510-32584532 ATGGGCATACACCACCACGCTGG - Intergenic
1053482146 9:38423867-38423889 AGCGCCGTCCACCACTGGGCAGG + Intronic
1055295171 9:74826587-74826609 ATCAGCATGCACCACTGGGCAGG - Intronic
1059041187 9:110817133-110817155 ACAGGCACCCGCCACTGCGCCGG - Intergenic
1061137968 9:128746910-128746932 ATAGGCATGAGCCACTGCGCCGG + Intronic
1061433031 9:130543220-130543242 ATCCTCATCCACCTCTGCCCTGG - Intergenic
1062225583 9:135447881-135447903 ATGGGCATGAGCCACTGCGCCGG - Intergenic
1187496067 X:19796872-19796894 ATCTGCATCCATCACTGCTCTGG - Intronic
1190151641 X:47954870-47954892 GTAGGCATCCACCACTGTTCAGG + Intronic
1190211094 X:48448614-48448636 ACAGGCATGCACCACTGTGCCGG + Intergenic
1192465880 X:71355587-71355609 ACAGGCACCCACCACTGCGCCGG + Intergenic
1193100698 X:77608225-77608247 ACAGGCACCCACCACTGTGCTGG - Intronic
1195474412 X:105268483-105268505 ACAGGCATGAACCACTGCGCTGG - Intronic
1198572365 X:137971394-137971416 ATGGGCATCCACCATTGCTGAGG + Intergenic
1199004730 X:142682354-142682376 ACAGGCACCCACCACTACGCTGG + Intergenic
1199382875 X:147190996-147191018 ACCGGCGCCCACCACTACGCCGG - Intergenic
1201333473 Y:12853230-12853252 ATGGGCATCCACCATTGCTGAGG - Intronic