ID: 1119255254

View in Genome Browser
Species Human (GRCh38)
Location 14:73190064-73190086
Sequence CAGGCTGTGCAGAGGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 629
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 567}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119255250_1119255254 9 Left 1119255250 14:73190032-73190054 CCTTATGTACATTGTACTCAGAG 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1119255254 14:73190064-73190086 CAGGCTGTGCAGAGGAAGGCAGG 0: 1
1: 0
2: 4
3: 57
4: 567
1119255246_1119255254 27 Left 1119255246 14:73190014-73190036 CCAGCTCAGGTTACCCCTCCTTA 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1119255254 14:73190064-73190086 CAGGCTGTGCAGAGGAAGGCAGG 0: 1
1: 0
2: 4
3: 57
4: 567
1119255248_1119255254 13 Left 1119255248 14:73190028-73190050 CCCTCCTTATGTACATTGTACTC 0: 1
1: 0
2: 2
3: 12
4: 155
Right 1119255254 14:73190064-73190086 CAGGCTGTGCAGAGGAAGGCAGG 0: 1
1: 0
2: 4
3: 57
4: 567
1119255247_1119255254 14 Left 1119255247 14:73190027-73190049 CCCCTCCTTATGTACATTGTACT 0: 1
1: 0
2: 4
3: 25
4: 283
Right 1119255254 14:73190064-73190086 CAGGCTGTGCAGAGGAAGGCAGG 0: 1
1: 0
2: 4
3: 57
4: 567
1119255249_1119255254 12 Left 1119255249 14:73190029-73190051 CCTCCTTATGTACATTGTACTCA 0: 1
1: 0
2: 1
3: 22
4: 243
Right 1119255254 14:73190064-73190086 CAGGCTGTGCAGAGGAAGGCAGG 0: 1
1: 0
2: 4
3: 57
4: 567

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119255254 Original CRISPR CAGGCTGTGCAGAGGAAGGC AGG Intronic
900167135 1:1248302-1248324 GAGGCTGTACCGAGGGAGGCTGG + Intergenic
900185404 1:1331003-1331025 CAGGCTGTGGAGAGGAGAGGGGG - Intergenic
900404186 1:2485341-2485363 CAGGCAGCGGAGGGGAAGGCCGG + Intronic
900939186 1:5786906-5786928 GCTGGTGTGCAGAGGAAGGCAGG - Intergenic
901012583 1:6209957-6209979 CAGGCTGTGCAGAGGTGAGTTGG + Exonic
901115528 1:6840805-6840827 GAGGCAGTGCTGAGGCAGGCAGG + Intronic
901210329 1:7520858-7520880 CTGGCCATGCTGAGGAAGGCTGG - Intronic
901263626 1:7892390-7892412 CAAGCTTTGCAGATGGAGGCAGG - Intergenic
901652577 1:10751742-10751764 CTGGCTGTGCCGGGAAAGGCTGG + Intronic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902232418 1:15036359-15036381 CAGGCAGGGCAGGGGAGGGCTGG - Intronic
902482199 1:16717918-16717940 GAGGCTGTGGATATGAAGGCTGG - Intergenic
902658243 1:17884199-17884221 CAGGGGCTGCAGAGGTAGGCAGG + Intergenic
902736829 1:18406866-18406888 CAGGCTTTGCAGAGGAGGCCAGG + Intergenic
902757146 1:18556374-18556396 CAGGATGTGCAAAGGTAGCCCGG + Intergenic
902873523 1:19327865-19327887 TAGGCTGTGCAGACGAGAGCTGG + Intronic
902959871 1:19955706-19955728 CAACCGGTGCTGAGGAAGGCTGG - Intergenic
903437214 1:23359600-23359622 CGGGATGTGCAGAGGCAGCCAGG + Exonic
904081120 1:27873071-27873093 AAGGCAGTGTAGAGGAGGGCCGG - Intronic
904770183 1:32876788-32876810 CAGGCTGTGCAGAGCCACGAGGG - Intergenic
904929208 1:34073006-34073028 CAGGCTTTGGAGTGGGAGGCTGG - Intronic
904946664 1:34204056-34204078 CAGGCTGTGCTGGGCCAGGCTGG - Intronic
905297005 1:36960687-36960709 CAGGCTTAGCAGCGGAAGTCTGG - Intronic
906566003 1:46801540-46801562 CAGGTTGAGCAGACAAAGGCTGG + Intronic
907441573 1:54481754-54481776 CAGGCTGGGCAGAGACAGGGTGG + Intergenic
907477553 1:54715718-54715740 CAGGCACTGCCGAGGAGGGCGGG + Intronic
907801069 1:57766326-57766348 AAGGCTGGGCAGAGGAATGAAGG - Intronic
909501976 1:76344935-76344957 TAGTGTGTGCAGAGGAAGGCTGG - Intronic
910240010 1:85076118-85076140 CTGGCTGTGAAGAGGAAGGAAGG - Intronic
910723617 1:90314665-90314687 CAGGCTGTGCAGAGGAACATGGG + Intergenic
910944689 1:92577475-92577497 CAGGCTGTCTTGAGGAAAGCTGG + Intronic
911153114 1:94614312-94614334 CAGCCTGTGACGTGGAAGGCAGG - Intergenic
912812222 1:112803092-112803114 CAGGGAGTGGAGAGGAGGGCAGG - Intergenic
912856928 1:113177851-113177873 CTGGCTGTGCTGAGGAATGGGGG - Intergenic
913161177 1:116147333-116147355 CCTGCAGTGCACAGGAAGGCCGG - Intergenic
913283671 1:117208853-117208875 CTGGGTCTGCAGAGGATGGCAGG + Intronic
913461447 1:119090318-119090340 CAGCCAGTGCACAAGAAGGCTGG - Intronic
915030811 1:152879149-152879171 CAGGCTGTGCACAGCATGGTTGG + Intronic
915240990 1:154521578-154521600 CTGACTGTGGAGAAGAAGGCAGG + Intronic
915891954 1:159781261-159781283 CAGGCGGTGCAGGGTGAGGCCGG - Exonic
915953868 1:160207442-160207464 CAGGCAGAGCAGAGGAGGGCCGG - Intronic
917967817 1:180189457-180189479 GAAGCTATGCAGAAGAAGGCGGG - Intronic
918393880 1:184094469-184094491 GCGGCTGTGCAGAGGATGGAAGG + Intergenic
918925621 1:190782232-190782254 CAGTCTTTGCACAGGAAGGGCGG - Intergenic
919769518 1:201148331-201148353 CATGCTGATCTGAGGAAGGCTGG - Intronic
920927300 1:210354035-210354057 CAGGCTGTTCTCAGGAAGGCTGG + Intronic
921157520 1:212450026-212450048 GAGGCTGTGCAGAGGTCGCCTGG + Intergenic
921180947 1:212630719-212630741 GAGGCTTTGCAGAGGAGGGGAGG + Intergenic
921882467 1:220270983-220271005 TAGCATGTGCAGAGGAAGGGAGG - Intronic
922518475 1:226225387-226225409 AAGGCTCTGGAGAGGAAGCCAGG + Intronic
922911785 1:229224597-229224619 TAGCATGTGCAGTGGAAGGCTGG - Intergenic
922973306 1:229761244-229761266 CAGACTGAGCAGAGGAAGCAGGG - Intergenic
923087764 1:230714179-230714201 CAGCCTGTGCACAGGCAGCCTGG - Exonic
923262317 1:232279077-232279099 CAGGCTTTGGAGAGAAAGGAGGG + Intergenic
923458484 1:234187008-234187030 CTGGCTGTGCAAGGGAGGGCAGG - Intronic
923538185 1:234869222-234869244 TAGCCTGTGCAGAGGCAGCCTGG - Intergenic
923658124 1:235935888-235935910 CAGGATGCGCTGAGGAAGACAGG + Intergenic
924285103 1:242477687-242477709 CTGGTGGTGCAGAGGATGGCAGG + Intronic
1062785091 10:257973-257995 CAGGGTGAGCAGAGGCTGGCTGG + Intergenic
1063010898 10:2020497-2020519 CAGGGTGTGCAGAGCAGGCCAGG - Intergenic
1063195077 10:3734391-3734413 CAGGTCTTGCAGAGGATGGCTGG + Intergenic
1063241196 10:4170918-4170940 CAGGCAGTGCAGCTGAAGTCCGG + Intergenic
1063295487 10:4800897-4800919 CAGGCTGTGCAGGAGGAGGATGG - Intronic
1063497072 10:6520079-6520101 CAGGCTGTTCCGAACAAGGCAGG + Intronic
1064018912 10:11793904-11793926 CAGGATGAGAAGAGGAAGGCAGG + Intergenic
1065645196 10:27826687-27826709 GAGGATGTGGAGAGGGAGGCAGG - Intronic
1066984993 10:42456956-42456978 CAGGCTCTGCTGGGGAAGACTGG + Intergenic
1067147593 10:43704417-43704439 TTGGCTGGGCTGAGGAAGGCAGG - Intergenic
1067389594 10:45850735-45850757 CAGGCTCTGCTGGGGAAGACTGG + Intronic
1067444653 10:46333789-46333811 CAGGCTCTGCTGGGGAAGACTGG - Intergenic
1067466583 10:46503575-46503597 CAGGATGGGCAGAGGCTGGCAGG - Intergenic
1067478661 10:46581852-46581874 CTGGCAGGCCAGAGGAAGGCAGG - Intronic
1067501872 10:46813101-46813123 CAGGCTCTGCTGGGGAAGACTGG - Intergenic
1067592710 10:47526907-47526929 CAGGCTCTGCTGGGGAAGACTGG + Intronic
1067616076 10:47759949-47759971 CTGGCAGGCCAGAGGAAGGCAGG + Intergenic
1067620605 10:47881030-47881052 CAGGATGGGCAGAGGCTGGCAGG + Intergenic
1067639827 10:48034990-48035012 CAGGCTCTGCTGGGGAAGACTGG + Intergenic
1067794322 10:49309739-49309761 CAGGCTGTGCATAGACAGGGAGG + Intronic
1067804564 10:49384059-49384081 CGGGTTGGGCAGAGGCAGGCTGG - Intronic
1067847596 10:49736261-49736283 CAGGCAGGCCAGATGAAGGCCGG - Intronic
1067873671 10:49985320-49985342 CAGGCTCTGCTGGGGAAGACTGG - Intronic
1068064426 10:52110543-52110565 CATGTTGTGCAGAGGCAGGGAGG + Intronic
1069724918 10:70571394-70571416 CAGGCTGTGCCGTGTCAGGCGGG + Intergenic
1070136802 10:73701099-73701121 CAGGCTCTGCTGGGGAAGACTGG + Intergenic
1070248397 10:74752690-74752712 CAGGATGGGCAGTGGGAGGCTGG - Intergenic
1070311280 10:75275809-75275831 CAGGCCGTGCAAAGGAGTGCAGG + Intergenic
1070333252 10:75432591-75432613 CAGGGTGTGCAGGGAAAGGTGGG - Intronic
1070368091 10:75755769-75755791 CAGGCTGTGCAGTGGGGAGCAGG + Intronic
1070721002 10:78757066-78757088 CTGGCTGTCCCGAGGAAGCCTGG - Intergenic
1072209224 10:93231388-93231410 CAGGCTGGGGAGGAGAAGGCAGG + Intergenic
1072620165 10:97074464-97074486 CAGGCTCAGAAGGGGAAGGCAGG + Intronic
1072627398 10:97121708-97121730 GAGGTCCTGCAGAGGAAGGCAGG - Intronic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1073122890 10:101132897-101132919 CAGGGCCAGCAGAGGAAGGCGGG - Intronic
1073150465 10:101307836-101307858 CAGGAGGTGGACAGGAAGGCAGG + Intergenic
1073774128 10:106767172-106767194 CAGGCTTTGCTGATGAAGGCTGG + Intronic
1073959673 10:108912097-108912119 CCCGCTGTGCAAAGGAACGCAGG + Intergenic
1076046341 10:127297064-127297086 CACGGTGTGCAGAGGAGGGGTGG + Intronic
1076186136 10:128450912-128450934 CAGCCTGTGCATAGGACTGCAGG + Intergenic
1076826785 10:132973379-132973401 CAGGCTGGGCAGGGGCAGACTGG + Intergenic
1077056906 11:598205-598227 CTGGCAGGGGAGAGGAAGGCCGG + Intronic
1077250579 11:1558949-1558971 CACGCTGGGCACAGGCAGGCAGG + Exonic
1077281109 11:1746688-1746710 GAGGCTGGGCAGAGGCTGGCTGG - Intronic
1077403116 11:2368725-2368747 CAGGCTGTGCAGGTGCTGGCCGG + Intergenic
1077491637 11:2863335-2863357 CAGGCTGGGCAGAGTGAGGGAGG + Intergenic
1077551262 11:3201311-3201333 CTGGCGGAGCAGAGGATGGCAGG + Intergenic
1077555820 11:3225550-3225572 CAGGCTGGGCAGGGGCAGGTGGG + Intergenic
1078446602 11:11409492-11409514 CTGGCTGAGCACAGGAAGGCTGG - Intronic
1078545572 11:12244730-12244752 TAGCCTGTGCAAAGGCAGGCAGG + Intronic
1078861684 11:15253776-15253798 CAGGCTGTGCAGTTTAGGGCAGG + Intergenic
1079009167 11:16814401-16814423 CAGGCTGTACAGAGGTAGGCAGG - Intronic
1079317412 11:19420970-19420992 CAGGCTGTGGGGAGGAGGGCAGG - Intronic
1080427357 11:32168449-32168471 CAGGCTGAGCAAAGCCAGGCTGG + Intergenic
1081293975 11:41362814-41362836 CTGGCTGTGAAGATGAAGGAAGG - Intronic
1081862472 11:46341200-46341222 AAGGCTGGGCAGAGGGAGGGAGG - Intronic
1083102732 11:60326769-60326791 AATTCTGTGCAGAAGAAGGCAGG - Intergenic
1083366290 11:62143413-62143435 CAGGCTGTGTTGAGTTAGGCTGG + Intronic
1083421662 11:62556683-62556705 CACGCGGTGCAGAGTAAGGGTGG - Intergenic
1083423078 11:62567008-62567030 TAGCTGGTGCAGAGGAAGGCAGG + Exonic
1083682935 11:64359549-64359571 CAGGCTGTGCCGGGAAAGGGTGG - Intronic
1084147854 11:67274614-67274636 CAGGCTGTGCACTGGGAGACTGG - Intronic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084650575 11:70486973-70486995 AGGTCTGTGGAGAGGAAGGCCGG + Intronic
1085322892 11:75585467-75585489 CAGGCTGTGGGGAGGACGGCTGG - Intergenic
1085644294 11:78213210-78213232 CATGCTGTCCAGATGGAGGCAGG + Intronic
1086155267 11:83658631-83658653 CAGACTGTGAATAGGAAGGTGGG - Intronic
1086336918 11:85810091-85810113 AGGGATGTGCAGAGGAAGCCCGG - Intronic
1086341848 11:85855202-85855224 CAGGCTGTGGAGGGGATGTCAGG + Exonic
1088172770 11:107017618-107017640 TAGGCCGTGCAGGGTAAGGCCGG + Intronic
1088425431 11:109696670-109696692 CAATCTGTGCACAGGAAGGGTGG - Intergenic
1089255511 11:117192022-117192044 CAGGCTGAGCAGAGCAGGTCAGG - Intronic
1089678494 11:120106422-120106444 CAGGATGTGCAGAGGATGCAGGG - Intergenic
1090042165 11:123300744-123300766 CAGGCTGTGATGGGGCAGGCAGG - Intergenic
1090273803 11:125405728-125405750 CAGGAGGGGCAGAGCAAGGCAGG - Intronic
1090351374 11:126110617-126110639 CAGGCTTTGCTCAGGGAGGCTGG - Intergenic
1090901207 11:131033381-131033403 GATGCTCTGCAGAGGGAGGCAGG - Intergenic
1091344174 11:134841901-134841923 CAGGCTGTAAGGATGAAGGCTGG - Intergenic
1091555801 12:1572634-1572656 GGGGCAGTGGAGAGGAAGGCAGG + Intronic
1091644553 12:2263903-2263925 CAGGATGTGCAAAGGAAAGAGGG + Intronic
1091805122 12:3350429-3350451 GAAGCTGTTCAGAGGAAGGATGG + Intergenic
1092170398 12:6370636-6370658 CAGGCTGTGCTCAGCAGGGCTGG - Intronic
1094113111 12:26882349-26882371 CAGGGTGTGGAGAAGAAGGAAGG + Intergenic
1095626293 12:44318692-44318714 CAGTCTATGCACAGGAAGGGTGG + Intronic
1095867010 12:46983379-46983401 CAATCTATGCACAGGAAGGCTGG - Intergenic
1095908008 12:47397316-47397338 CAGTCTATGCACAGGAAGGGTGG - Intergenic
1096495802 12:52038496-52038518 CAGGCTGGGCAGAGGTTGGTAGG + Intronic
1096518211 12:52170020-52170042 GAAGCTGTGCAGTGGGAGGCTGG + Exonic
1096562616 12:52447570-52447592 CAGCCTGTGGAGAGGAACACAGG + Exonic
1096564787 12:52469442-52469464 CAGCCTGTGGAGAGGAACACAGG + Exonic
1096566705 12:52488100-52488122 CAGCCTGTGGAGAGGAACACAGG + Exonic
1096898265 12:54846983-54847005 CAGGCTGTGAAAGGGTAGGCAGG - Intronic
1097197049 12:57248678-57248700 TAGGCTGTGGAGAGCAAGGAGGG - Intronic
1098218639 12:68245580-68245602 CAGGCTGTGCAGTGGCTGGAAGG - Intergenic
1099504887 12:83461584-83461606 CAGGCTGCCCAGAGGAAGAAGGG + Intergenic
1100107486 12:91193668-91193690 CAGGCTATGCAGAGGGAAGTGGG - Intergenic
1100437427 12:94584388-94584410 CAGGCTGTGTACAGGAAGCATGG - Intronic
1101023992 12:100582894-100582916 CAGGCTGTGAAGACGGAGGAGGG - Intronic
1101427447 12:104599629-104599651 CAGGCTGTACAGAGAAACACTGG - Intronic
1101607153 12:106256184-106256206 CAAACTGTGAAGGGGAAGGCAGG + Intronic
1102451070 12:113042547-113042569 CTGGCTGTGAAGATGAAGGTGGG + Intergenic
1102513242 12:113429480-113429502 CAGGGTGGGCAGAGGAAAGTTGG - Intronic
1102880377 12:116480651-116480673 CAGGGTGGCAAGAGGAAGGCAGG - Intergenic
1103963544 12:124623975-124623997 CCGGGTGGGCAGAGGAAGACAGG - Intergenic
1104450317 12:128863698-128863720 CAGGTTTTACACAGGAAGGCAGG + Intronic
1104951446 12:132442415-132442437 CTGGGAGTGCAGAGGAACGCGGG - Intergenic
1104966883 12:132512343-132512365 CAGGCTGTGCAGAGGATGCTGGG - Intronic
1105701776 13:22939978-22940000 CAGGGTCCCCAGAGGAAGGCGGG + Intergenic
1105854399 13:24361766-24361788 CAGGGTGCCCAGAGGAAGGCGGG + Intergenic
1105968382 13:25405081-25405103 CGGGCTGGTCAGATGAAGGCTGG + Intronic
1106643853 13:31612361-31612383 CAGGCTGGGAAAAGGAAAGCAGG - Intergenic
1107932358 13:45316556-45316578 AAGGCTGGGCTGCGGAAGGCAGG + Intergenic
1110930658 13:81211948-81211970 TGTGCTGTGGAGAGGAAGGCTGG - Intergenic
1111856437 13:93643482-93643504 TAGGCTGAACAGAGGTAGGCAGG + Intronic
1112223322 13:97513573-97513595 CAGTCTCTGCACAGGAAGGATGG + Intergenic
1112496832 13:99911775-99911797 CAGGCTGGGCCGAGGAAGAGTGG - Intergenic
1113331848 13:109334932-109334954 TAAGCTGTCCAGAGGAAGTCTGG + Intergenic
1113583827 13:111449145-111449167 GAGGCTGCGCAGGGGAAGGGAGG - Intergenic
1113963790 13:114140264-114140286 CAGGTTGTGCAGGGCAGGGCAGG + Intergenic
1113970058 13:114181827-114181849 CAGGCTCTGAGGGGGAAGGCTGG - Intergenic
1114416452 14:22548043-22548065 CAGTCTGAGCAAAGGCAGGCAGG - Intergenic
1114443553 14:22770504-22770526 CAGGCTGGGCACAGGAAGGTTGG - Exonic
1114562352 14:23602596-23602618 CAGGCTGTGGACAGGAAGGATGG + Intergenic
1114634207 14:24178235-24178257 CAGGCTTTGCCGGGGAAGGGAGG + Intronic
1115143433 14:30199643-30199665 CAGGCTGTGGGGAAGAAGGCAGG - Intergenic
1117348636 14:54859143-54859165 CATCCAGTGCAGAGCAAGGCAGG + Intronic
1117670568 14:58101806-58101828 GAGGGTGTGGAGAGGAGGGCAGG + Intronic
1118611186 14:67541651-67541673 CACACTGAGCTGAGGAAGGCAGG + Intronic
1119109949 14:71962285-71962307 GTGGCTGGGCAGAGGGAGGCCGG + Intronic
1119255254 14:73190064-73190086 CAGGCTGTGCAGAGGAAGGCAGG + Intronic
1119266838 14:73267746-73267768 CAGGCTGATCAGGGGATGGCTGG - Intronic
1119419972 14:74502736-74502758 CCGGCTGTGTTGGGGAAGGCAGG + Exonic
1119965040 14:78905175-78905197 CAGGCTGGGCAAAGGAAAGGAGG - Intronic
1120708663 14:87771246-87771268 CAGGCTGTGCACAGGTGGCCTGG + Intergenic
1121299943 14:92862273-92862295 CAGGCTGTGTAGAGGAAGTCAGG - Intergenic
1121820208 14:96959700-96959722 GAGGCTGTGGTGAGGAGGGCAGG - Intergenic
1122092020 14:99347164-99347186 CTGGGTGTGGGGAGGAAGGCGGG - Intergenic
1122183708 14:99972755-99972777 CAGGATCTGGAGAGGAAGGGAGG - Intronic
1122296631 14:100709575-100709597 CGGGCTGTGCGGAGGCAGCCGGG + Intergenic
1122608747 14:102966461-102966483 CACTGTGTGCCGAGGAAGGCGGG - Intronic
1122624147 14:103075610-103075632 CCGGCTGTGCCGGGGGAGGCTGG + Intergenic
1122693184 14:103541128-103541150 CGGGCCCTGCAGAGGAATGCTGG + Intergenic
1122782217 14:104148577-104148599 CAGCCTGTGCAGAGGTTGGAAGG + Intronic
1122795896 14:104206066-104206088 CAGGCTGTGCAGTCGCAGTCGGG - Intergenic
1122843167 14:104476605-104476627 CAGGGTGCCCAGAGGAAGGTGGG + Intronic
1122880501 14:104688717-104688739 GAGGGAGGGCAGAGGAAGGCAGG - Intergenic
1122987815 14:105220667-105220689 CAGGCTGTGCAGATGCTGCCTGG - Intronic
1123062826 14:105601932-105601954 CAGGCTGGGCTCAGGAAGGGGGG + Intergenic
1124228338 15:27916999-27917021 CAGGGCGTGAAGATGAAGGCAGG + Intronic
1124232794 15:27960000-27960022 GAGGAGGTGCAGAGGAAGCCTGG - Intronic
1124342556 15:28899581-28899603 TGAGCTGTGCAGAGCAAGGCCGG - Intronic
1124465576 15:29936386-29936408 CAGGCTGGACCGGGGAAGGCAGG - Intronic
1124512667 15:30340308-30340330 AAAGGTGTTCAGAGGAAGGCGGG + Intergenic
1124730248 15:32190442-32190464 AAAGGTGTTCAGAGGAAGGCGGG - Intergenic
1125371649 15:38984043-38984065 CAATCTGTGCACAGGAAGGGTGG + Intergenic
1126389971 15:48137386-48137408 CAGTATGTGCATAGGAAGGAAGG + Exonic
1126583678 15:50262955-50262977 CAGGCTGTGCTCTGGAATGCAGG + Intronic
1127770154 15:62224352-62224374 CAGGCAGGGCAGGGGAGGGCAGG - Intergenic
1128152730 15:65373343-65373365 CCGGCAGTGCAGGGGAAGGCTGG - Intronic
1128245907 15:66132625-66132647 AATGCTGTGCTGAGGAAGGGGGG + Intronic
1128317684 15:66671348-66671370 CAGGCGGTGCGGTGGGAGGCGGG - Intronic
1128929466 15:71691104-71691126 CGGGCTTTGCAGATGAAGGAAGG + Intronic
1129105279 15:73302861-73302883 CAGGCTGACCAGGGGAAGGCAGG - Exonic
1129879425 15:78997020-78997042 CAGGCTGTTCAGTGGGTGGCGGG - Intronic
1130542233 15:84828492-84828514 CAGGCTCTCCAGAGGGAGCCTGG - Intronic
1130708882 15:86259936-86259958 CACGCTTTGCAGAGGATGGAGGG + Intronic
1131026063 15:89142679-89142701 GGGGCTGTGGAGGGGAAGGCTGG - Intronic
1131390167 15:92041306-92041328 CAGGCATTGCAGAGGCAGGGAGG + Intronic
1131462591 15:92629090-92629112 AAGGCTGTGCTGAGGAACACAGG + Intronic
1132018091 15:98336970-98336992 CAGGCTGTGGACTGGGAGGCAGG - Intergenic
1132542272 16:516062-516084 CCGGCAGTGCAGAGGCCGGCCGG + Intronic
1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG + Intronic
1132903009 16:2268486-2268508 CGGGCTGTGCTGAGGCCGGCGGG + Intergenic
1133046303 16:3090124-3090146 CACTCTGCGCACAGGAAGGCGGG + Exonic
1133096502 16:3450345-3450367 CAGGGTCTGCCTAGGAAGGCTGG + Intronic
1133346698 16:5075910-5075932 CAGGCAGATCAGAGGAAGGCAGG - Intronic
1133681327 16:8122886-8122908 CAGGCTTTGCACAGAAAGGGAGG - Intergenic
1134058072 16:11182593-11182615 CAGGCTGGGCCGAGGGAAGCAGG + Intergenic
1134307558 16:13046825-13046847 CAGGCCATGCAGAGGAAGAGTGG - Intronic
1134913258 16:18048317-18048339 CAGGCTTTGCAGAGAGAGGGCGG + Intergenic
1136250974 16:29004861-29004883 CAGGCTGGGGAAGGGAAGGCAGG - Intergenic
1136289753 16:29264495-29264517 CAGGCTGTGAAAAGGCAGGGAGG - Intergenic
1136453460 16:30367955-30367977 CAGGCTGTCCTGAGGAACTCGGG - Intronic
1137718840 16:50615468-50615490 CATGCTGCTCAGAGGAAGGGAGG + Intronic
1138096397 16:54215239-54215261 CAGGCTGGGCAGTTCAAGGCTGG - Intergenic
1139912000 16:70403241-70403263 CAGGGTGGGAAGAGGAAGACAGG + Intronic
1140026731 16:71297638-71297660 AAGGGTGGGGAGAGGAAGGCAGG - Intergenic
1140436559 16:74951611-74951633 AAGGCAGTGAAGAGGAAGCCAGG + Intronic
1141677143 16:85523892-85523914 CAGGCTGAGCAGAGGTGGGAGGG + Intergenic
1141717422 16:85734902-85734924 CAGGCTGTGGAGAGTGAGGGAGG - Intronic
1142095634 16:88237971-88237993 CAGGCTGTGAAAAGGCAGGGAGG - Intergenic
1142141886 16:88476222-88476244 GAGGCTGTGCAGAGGGATGGAGG - Intronic
1142289114 16:89184669-89184691 CAGGCTGGGCAGAGGACGCAGGG - Intronic
1142588337 17:988304-988326 CAGGCTGGGAAAGGGAAGGCAGG + Intergenic
1142968272 17:3594520-3594542 CAGGCTGTGAACAGGACGGACGG + Intronic
1143020102 17:3913050-3913072 CAGGCAGTGGGGAGGAAGCCAGG - Intronic
1144847766 17:18228930-18228952 CTGGATGGGCAGAGGCAGGCAGG + Intronic
1145004754 17:19331392-19331414 CAGGCTGTGCTGAGCCAGGCCGG - Intronic
1145241292 17:21242252-21242274 CAGGCTGCACCCAGGAAGGCTGG + Exonic
1147323583 17:39659797-39659819 CAGGCTTTGAAGGGGAAGCCAGG + Intronic
1147650732 17:42060432-42060454 CAGGGTGTGGAGAGGACAGCGGG - Intronic
1147986865 17:44311928-44311950 CAGGCAGTGCAGAGCTGGGCGGG - Intronic
1148050162 17:44766172-44766194 CAGGCTGTGCAGATGAGGGTGGG + Intronic
1148644182 17:49210027-49210049 CGCTCTGTGCAGATGAAGGCAGG - Intronic
1148745483 17:49915817-49915839 CAGGATGGACAGAGGAATGCTGG - Intergenic
1149493535 17:57102069-57102091 CAGCCTGTGCAGAGGTACGTGGG + Intronic
1149538579 17:57451776-57451798 AAGGATGTGAGGAGGAAGGCTGG - Intronic
1150267758 17:63842255-63842277 CAGGTTCTGCAGCGGAGGGCTGG - Intronic
1150433879 17:65139394-65139416 CAGGCTGCTCAGGGGAAGGTTGG - Intronic
1152367460 17:79864856-79864878 GAGGCAGGGCAGAGCAAGGCAGG - Intergenic
1152518264 17:80838714-80838736 CAGCCTGGGCAGAGGCAGGAGGG + Intronic
1152753427 17:82077175-82077197 CAGGCCCTGCAGGGCAAGGCGGG - Intergenic
1153347153 18:4039265-4039287 CAGGCTGTACAGAGGATAGTGGG - Intronic
1153623105 18:6998471-6998493 CAGGCTGTGGAAGGGAATGCTGG - Intronic
1153650388 18:7234238-7234260 CAGGTTCTGCGGAGGAAGCCTGG - Intergenic
1153810881 18:8750533-8750555 CTGGAGGTGCAGAGGAAGGAAGG + Intronic
1154024544 18:10695295-10695317 GAGGCTGGGGAGAAGAAGGCTGG + Intronic
1154073606 18:11178008-11178030 CAGGCTGCCCTCAGGAAGGCCGG + Intergenic
1154122778 18:11665067-11665089 GATGCTGTGCAGAGGGTGGCAGG - Intergenic
1154236388 18:12610058-12610080 CAGGCTGGGAAGAGGAGGGAGGG - Intronic
1155267318 18:24106502-24106524 AGGGATGTGCAGAGGAAGGGAGG - Intronic
1156290694 18:35747065-35747087 AAGGCTGGGCAGGGTAAGGCAGG - Intergenic
1157236815 18:45972468-45972490 CAGACTTTGAAGAGGAAGCCAGG + Intergenic
1157269851 18:46264686-46264708 CAGGCTGGGCAGGTGGAGGCAGG - Exonic
1157502107 18:48198572-48198594 CAGGCTTTGAAGATGAAGGAAGG - Intronic
1157547292 18:48555440-48555462 CCCACTTTGCAGAGGAAGGCTGG + Intronic
1157725439 18:49960143-49960165 GAAGCTGTGCAGTGGCAGGCAGG - Intronic
1158367032 18:56747724-56747746 CAGCCTGTGCAGATGCAGGTGGG + Intronic
1159151872 18:64532484-64532506 CAGGCTGTGGGAGGGAAGGCAGG + Intergenic
1159784006 18:72692720-72692742 CAGTCTGTCCCGAGAAAGGCAGG - Intergenic
1159988802 18:74877391-74877413 GAGGCTGGGCAGAGGTAGACTGG + Intronic
1160120150 18:76122722-76122744 CTGGATGTTCAGAGAAAGGCAGG - Intergenic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1160237484 18:77097566-77097588 CAGGCTGTGTAGAAGATGTCTGG - Intronic
1160251988 18:77210692-77210714 CAGGGTGTGAAGAAGAAGGCAGG - Intergenic
1160313660 18:77820960-77820982 CAGGCTGTGCAGGGAGAGCCGGG + Intergenic
1160662356 19:307037-307059 CAGGCTGAGCAGAGGAGGGTGGG - Intronic
1161099402 19:2413895-2413917 CAGGCTGTGCTGGGGGCGGCAGG - Exonic
1161393794 19:4034310-4034332 CGGACTGTGCAGGTGAAGGCAGG + Intronic
1161627360 19:5335118-5335140 CAGGCTGTGGGGAGAGAGGCTGG - Intronic
1161866229 19:6833863-6833885 CAGGCTGGGCATAGGTAGACAGG + Intronic
1161872074 19:6878020-6878042 CTGGCTTTGCATAGGAAGGAAGG + Intergenic
1163416707 19:17191259-17191281 CACGGTGTGCGGTGGAAGGCAGG - Intronic
1163526878 19:17826808-17826830 CATGCTGTGGAGCGGAAGCCGGG - Exonic
1163702130 19:18791231-18791253 CAGGGTGAGCAGAAGAACGCAGG + Exonic
1164670103 19:30067574-30067596 CAGGCTGGGCAGAGGGATCCTGG + Intergenic
1164756724 19:30695262-30695284 CAGGGTGTGCATAGCAAGGTGGG + Intronic
1164835392 19:31352141-31352163 CAGGCTGTGCCAAGCCAGGCCGG - Intergenic
1165044309 19:33092559-33092581 GTGGCGGTGCAGAGGAAGGCAGG + Intronic
1165058488 19:33194026-33194048 CCGGCTGTGCTGAGGAGGACCGG - Intronic
1165352688 19:35284754-35284776 AAGGGGGTGCAGAGGATGGCAGG - Intronic
1165480394 19:36060082-36060104 CAGGCTGTGTAGGGGAGGGGAGG - Intronic
1166042514 19:40212542-40212564 TAGGCTGTGAAGAGGAGGGGAGG + Intronic
1166313843 19:41977843-41977865 CAGGCAGTGCAGAGGGAGGTTGG + Intronic
1166373436 19:42314599-42314621 CAGGCAGTCCTGGGGAAGGCAGG - Exonic
1167141877 19:47657213-47657235 CATGCTGAGCAAAGGAAGCCTGG - Intronic
1167249699 19:48393459-48393481 CAGGCTGGGGACAGGCAGGCAGG - Intergenic
1167418985 19:49391914-49391936 CAGGCTGTGCCGTGGATGCCTGG - Intronic
1168148862 19:54434417-54434439 AGGGCTGTGCAGAGGAAGCTGGG - Intronic
925345400 2:3168576-3168598 CAGGCTGTGGTCAGGCAGGCAGG + Intergenic
925879088 2:8335891-8335913 CAGGAGGTGCAGAGGAAACCTGG + Intergenic
925886134 2:8394905-8394927 CATGCTATGTAGAGGTAGGCAGG - Intergenic
926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG + Intronic
926621043 2:15047645-15047667 GGGCCTGTGCAGATGAAGGCTGG + Intergenic
927642260 2:24852691-24852713 CTGGCCGTGGAGAGGCAGGCAGG - Intronic
927689526 2:25197971-25197993 CAGGCTGTGGAGAGGCAGCATGG + Intergenic
928221438 2:29406540-29406562 CAGGCTCTGCAAAGGAACACAGG - Intronic
928693117 2:33821000-33821022 TAGGCTGGGCTGAGGACGGCAGG - Intergenic
929984131 2:46709518-46709540 AAGGCTGTGCAGAGAAAAGTAGG + Intronic
932011176 2:67978712-67978734 CATGCTGTGTAGGGGAAGGAAGG - Intergenic
932354500 2:71058101-71058123 AAGGGTGGGGAGAGGAAGGCCGG + Intergenic
934169439 2:89327331-89327353 ATGGCAGTGCAGAGGCAGGCAGG - Intergenic
934197855 2:89855254-89855276 ATGGCAGTGCAGAGGCAGGCAGG + Intergenic
934759845 2:96848441-96848463 CAGCCTGTGGAGAGAAAGGCTGG + Exonic
936089335 2:109490821-109490843 GAGCCTCTGCACAGGAAGGCAGG + Exonic
936351076 2:111713060-111713082 GAGGCTGTGCAGGGGAAACCAGG + Intergenic
936444050 2:112582309-112582331 TAGGCTGAGGAGAGGAAGGGGGG + Intergenic
937262984 2:120598216-120598238 GAAGCAGTGCAGAGGGAGGCAGG - Intergenic
937318302 2:120946002-120946024 CAGTGTGTGCAAAGAAAGGCTGG - Intronic
937791586 2:125968133-125968155 CAGGCTGTGAAGAGAAAACCTGG + Intergenic
937917353 2:127105749-127105771 CAGGCCTGGCAGGGGAAGGCCGG + Intronic
938301778 2:130219793-130219815 GAGGCTGTGCAGAGGCAGTTTGG - Intergenic
938573364 2:132582713-132582735 TTGGCTGGGCAGAGGCAGGCAGG - Intronic
938821475 2:134964421-134964443 AAAGCAGAGCAGAGGAAGGCAGG - Intergenic
940020261 2:149148767-149148789 AGGGCAGTGCTGAGGAAGGCTGG + Intronic
940909955 2:159201878-159201900 CAGGCTGTTCAAAGGCAGGCAGG - Intronic
941648116 2:168063930-168063952 CCTGCAATGCAGAGGAAGGCGGG + Intronic
942490032 2:176480791-176480813 ATGGCTGTGCAGAGGAAGGTTGG + Intergenic
944671227 2:201996070-201996092 CAGGCTCTCCCGAGGGAGGCAGG + Intergenic
945968207 2:216210471-216210493 CAGGCTGTCCAGAGAGAGTCTGG + Intergenic
946405770 2:219491361-219491383 GAGGCTGTGGAGAGCCAGGCAGG + Intronic
946449290 2:219766051-219766073 GAGGCTGTTTAGAGGAAGACGGG - Intergenic
946540278 2:220676768-220676790 ACAGCTATGCAGAGGAAGGCTGG + Intergenic
946873631 2:224107221-224107243 CAGCCTGTGGAGAGGACAGCTGG - Intergenic
946880205 2:224170016-224170038 CAGCCTGTGCAATGGAAGGCTGG + Intergenic
947662066 2:231877219-231877241 CAGGCAGCTCAGAGGAAGTCCGG - Intergenic
947953960 2:234171643-234171665 ATGGCTGTGCCGAGGAAGGCTGG + Intergenic
948044282 2:234931205-234931227 CATGCTGCGCAGCCGAAGGCGGG + Intergenic
948270952 2:236672735-236672757 CAGGCAGGGCTGTGGAAGGCTGG + Intergenic
948288856 2:236809125-236809147 GAGGCTGTGGAGAGGCAGGGTGG + Intergenic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
948776812 2:240293454-240293476 CAGGCTGTGCTGAGCAGGTCTGG + Intergenic
948910410 2:240999611-240999633 CAGACTGCGGAGAGGACGGCAGG - Intronic
1169084243 20:2816900-2816922 GAGGCCGTGAAGAGGAGGGCAGG - Exonic
1169090746 20:2860126-2860148 CAGGCTGGCCAGAGGCATGCCGG - Exonic
1169367636 20:5003749-5003771 GAGGTTGGGCAGAGGAAGGCAGG - Intronic
1169743754 20:8922163-8922185 CAGGCTATGCAGATGTATGCAGG + Intronic
1170148305 20:13201385-13201407 TAGGCTGTGGAGGGGAAGGGAGG + Intergenic
1170443275 20:16399713-16399735 CAGGTTGTCAAGAGGAAGGGAGG - Intronic
1170594324 20:17793848-17793870 GAGGCTGAGCAGAGGCAGGATGG - Intergenic
1171227885 20:23456552-23456574 GAGGCTGGGCAGAGGCAGGAAGG - Intergenic
1171274579 20:23845237-23845259 CAATCTCTGCAGAGGAAGGTTGG - Intergenic
1171433952 20:25104769-25104791 CTGGCTGTGGAGGGGAAGGAGGG - Intergenic
1172776364 20:37409512-37409534 CAGCCTGTGCACAGGCAGGTGGG - Intergenic
1172844652 20:37922686-37922708 AGGGCTGTGCAGAGGGAGACAGG + Intronic
1172937893 20:38633714-38633736 CAGGCAGTGCTGAGCAAGCCTGG + Intronic
1173946494 20:46955040-46955062 ATGGGTGAGCAGAGGAAGGCAGG + Intronic
1174339287 20:49886072-49886094 CAGGGAGGGCAGAGGATGGCCGG - Intronic
1175218703 20:57404913-57404935 CTGGGTGTGCAGTGGAAGCCAGG + Intronic
1175329819 20:58155854-58155876 CAGGGTGTGGGCAGGAAGGCAGG + Intronic
1175408080 20:58747995-58748017 CATGCTCTGCAGATGAAAGCTGG + Intergenic
1175449601 20:59051837-59051859 CTGGCTGTGCAGAGCAGGTCTGG + Intergenic
1175807583 20:61838292-61838314 AAGGGTGTGGAGGGGAAGGCAGG + Intronic
1175857839 20:62132247-62132269 CAGGCTGCGCAGATGAGTGCGGG + Intronic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1176198034 20:63846579-63846601 CTGGCTGTCCAGCGGAGGGCGGG - Intergenic
1176380239 21:6108992-6109014 CTCGCTCTGCAGAGAAAGGCAGG - Intergenic
1178255753 21:31051005-31051027 CAGTCTCTGCAGAAGAAGCCAGG - Intergenic
1178354629 21:31900283-31900305 CCAGCTGGGCAGAGGAGGGCAGG - Intronic
1178916521 21:36708267-36708289 CGGACTGTGCAGGGGAAGCCTGG + Intronic
1179248244 21:39651450-39651472 CACAGTGTGAAGAGGAAGGCAGG - Intronic
1179489306 21:41729906-41729928 CAGGCAGTGCTGTTGAAGGCGGG + Intergenic
1179627453 21:42656722-42656744 GAGGTTGTGCAGAGGAAGCTGGG + Intronic
1179743235 21:43429246-43429268 CTCGCTCTGCAGAGAAAGGCAGG + Intergenic
1179951321 21:44710336-44710358 CGGGCTGTGCAGTGGGAGGTAGG - Intronic
1179980590 21:44893686-44893708 CAGGATGTGCTGAGGATGGCAGG + Intronic
1180080254 21:45483398-45483420 CAGGCTGCCCGAAGGAAGGCTGG - Intronic
1180732014 22:17989236-17989258 CAGGCTTAGCGGTGGAAGGCAGG - Intronic
1180963913 22:19775913-19775935 CAGGCTGTGCTGGAGAGGGCTGG + Intronic
1181516700 22:23418229-23418251 CAGGCTTAGCGGTGGAAGGCAGG - Intergenic
1182676351 22:32042637-32042659 CAGGCTGTGGAGGGGGAGTCAGG + Intergenic
1182936192 22:34223896-34223918 GGGGCTGTGCAGAGGAAGGTTGG - Intergenic
1183316888 22:37141837-37141859 CAGCCTGGGCAGAAGGAGGCGGG + Intronic
1183430715 22:37763957-37763979 CAGGCTTTGAAGATGAAGGAAGG - Intronic
1183499231 22:38168500-38168522 CAGGGTTTGCTTAGGAAGGCTGG - Intronic
1183579067 22:38712407-38712429 GAGGCTGGGCAGAGGAAGGCAGG + Intronic
1183645463 22:39123792-39123814 CAGGGGGTGCAGGGGCAGGCGGG + Intronic
1183689049 22:39377786-39377808 CATGCAGGGCAGTGGAAGGCTGG + Intronic
1183705214 22:39471598-39471620 CCATCTCTGCAGAGGAAGGCCGG - Intronic
1183767594 22:39893461-39893483 CCGGCAGTGGAGGGGAAGGCTGG + Intronic
1184471252 22:44697614-44697636 CAGGCAGTGCCTAGGAAAGCAGG + Intronic
1184602075 22:45549590-45549612 CAGGCTGTGGTGAGGGAGCCTGG - Intronic
1184979155 22:48084035-48084057 GAGGGTCTGCAGAGGCAGGCAGG - Intergenic
949961288 3:9314633-9314655 CAGGGTGGGGAGAGGAGGGCAGG - Intronic
950262788 3:11554498-11554520 CAGGATGAGCAGAGGCTGGCTGG + Intronic
950264310 3:11562969-11562991 CAGGCTGGGGAGAGGGAGACAGG + Intronic
950287460 3:11755987-11756009 CAGGGAGTGTAGAGGAAAGCTGG - Intergenic
950287465 3:11756020-11756042 AAGGGAGTGCAGAGGAAAGCTGG - Intergenic
950484819 3:13266888-13266910 CAGGCTATGAAGTGGACGGCAGG + Intergenic
950534810 3:13572600-13572622 AAGGCTGTGCAGAGGCTGGTAGG + Intronic
950573913 3:13819418-13819440 CAGGATCTGCAGGGGAGGGCGGG + Exonic
952377442 3:32779594-32779616 CAGGCTGTGGTGAGGAAGAAAGG - Intergenic
952858878 3:37795691-37795713 CAGGCTGAGCTGGGGAAGGCAGG - Intronic
953199874 3:40769116-40769138 CAGGCTGTTCAGGGAAAGGGCGG + Intergenic
953373099 3:42406645-42406667 CAGGCTGTGGGGAGTCAGGCAGG - Intronic
953563608 3:44013235-44013257 GAGTCTGTGCAGGGCAAGGCAGG - Intergenic
954130858 3:48560228-48560250 CAGCATGTGCAGAGACAGGCAGG + Intronic
954414823 3:50388154-50388176 CAGGCGGGGCAGACGCAGGCGGG - Intronic
954415409 3:50391036-50391058 CTGGCTTGGCAGAGGCAGGCAGG + Intronic
954434752 3:50490073-50490095 CAGGCTGTGGAGTGGGCGGCAGG + Intronic
954499275 3:50995554-50995576 CAGACTTTGCAGAGGAAGAAAGG + Intronic
954701980 3:52455385-52455407 CAGGCTGTGCAGGGTACCGCCGG + Intronic
954760521 3:52870576-52870598 CACCCTGGGCAGAGGATGGCAGG - Intronic
955029654 3:55203997-55204019 CAGGCTGGGGAGAGGAAGCTGGG - Intergenic
956176966 3:66482090-66482112 CAGCCTGGGCACAGGCAGGCTGG + Intronic
957188272 3:76971883-76971905 CAGGCAGTGCAGAGGTGAGCAGG + Intronic
959856613 3:111166168-111166190 CAGAATGGGCAAAGGAAGGCTGG + Intronic
960050774 3:113237408-113237430 GAGGCTGGGTAGAAGAAGGCAGG - Intronic
960947289 3:122975313-122975335 CAGCCTTGGCAGAGGAAGGAAGG + Intronic
960947313 3:122975428-122975450 CAGGCTGTGCCGAGGCAGGGGGG - Intronic
961372630 3:126440806-126440828 CAGCCTGGGCAGAGGTGGGCTGG - Intronic
961818397 3:129563012-129563034 AAGGCCCTGCAGAGGAAGGCTGG + Intronic
961974986 3:131014368-131014390 CAGACTGTACAGTGGAAGCCTGG - Exonic
963745053 3:149117423-149117445 CAGGCTGAGCAAAGGAAGGTAGG - Intergenic
965622161 3:170652797-170652819 CAGGCTGTGTAGATGTAAGCTGG - Intronic
966460004 3:180165982-180166004 CAGTCTATGCACAGGAAGGGTGG + Intergenic
966809751 3:183833134-183833156 CAGGCAGGGGAGAGGAGGGCAGG + Intronic
967105833 3:186254440-186254462 CAGGCTGTGCAAAGGCAGGGAGG - Intronic
967189047 3:186969689-186969711 CAGGAAGTGCAGAGGAAGAGCGG + Intronic
967245705 3:187484265-187484287 CTGGCAGTCCAGAGGAAGGAAGG - Intergenic
968078861 3:195833173-195833195 AAGGCAGTGGGGAGGAAGGCTGG + Intergenic
968538265 4:1148787-1148809 CAGGCTGTGGAGACTGAGGCAGG - Intergenic
968670940 4:1851207-1851229 CAGGCTGTGCAGAGGCTAGGCGG + Intronic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
969122443 4:4920145-4920167 CCAGCTGTGCAGAGGTTGGCCGG - Intergenic
969489334 4:7490318-7490340 CAGGCCTGGCAGAGGGAGGCAGG - Intronic
969517275 4:7654707-7654729 CAGGCTGAGCAGTGGAAGGGGGG - Intronic
969574840 4:8030721-8030743 AGGGCTGTGCAGAGGACGCCCGG - Intronic
969696895 4:8740075-8740097 CAGGCTGGGCAGGGGGAGGGTGG + Intergenic
969725937 4:8918080-8918102 GCGGCTGTGCAGAAGAAGGCTGG + Intergenic
969921393 4:10543591-10543613 CAGGCGGTGCAGTGGAGAGCGGG - Intronic
970444876 4:16115230-16115252 AAGGCAATGCAGAGGGAGGCTGG + Intergenic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
970716816 4:18936251-18936273 AAGGCTGTGAAGAGAAAGGCAGG + Intergenic
972205544 4:36768004-36768026 AAGGCAGTGCAGAGGAAGCAGGG + Intergenic
972297261 4:37752071-37752093 CAGTCTGTGCAAAGGCAGGGAGG - Intergenic
972374285 4:38456288-38456310 CAGGCTGTGCAGGTGCAGGCAGG + Intergenic
972736536 4:41847184-41847206 CAGACTATGAAGAGTAAGGCCGG - Intergenic
972844187 4:42968184-42968206 CAAGCTGTGTACAGGAGGGCTGG - Intronic
973840051 4:54852220-54852242 CAGGCAAGGCAGAGGAGGGCGGG - Intergenic
976702776 4:87989418-87989440 CAGGCGGTGGAGAGGAAGCAGGG + Intergenic
978299495 4:107250386-107250408 TAGTCTGTGCACAGCAAGGCTGG + Intronic
980360922 4:131754384-131754406 CGGGCTTTGGAGATGAAGGCAGG + Intergenic
980362005 4:131759339-131759361 CGGGCTTTGGAGATGAAGGCAGG + Intergenic
980726456 4:136767820-136767842 CAGGCTTTGAAGATGGAGGCAGG - Intergenic
982437148 4:155392839-155392861 CACGCTGTGCCGAGGAGTGCGGG + Intergenic
984171764 4:176368247-176368269 CAATCTCTGCAGAGGAAGGGTGG + Intergenic
984580763 4:181507410-181507432 CAGATTCTGAAGAGGAAGGCAGG - Intergenic
984612437 4:181856354-181856376 GAGGCTTTGCAGATGAAGCCGGG - Intergenic
984742048 4:183174251-183174273 CAGGTTGGGCAAAGGCAGGCAGG + Intronic
984922687 4:184779531-184779553 CAGACTGCCCAAAGGAAGGCTGG + Intronic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985616051 5:922641-922663 CAGGCGGTGCAGAGGCGGGGGGG + Intergenic
985714549 5:1448097-1448119 CAGGAAGTGCAGAGGCAGGGGGG - Intergenic
985772302 5:1820531-1820553 GACGCTCTGCAGGGGAAGGCTGG - Intergenic
985781176 5:1872580-1872602 CAGGGTGTGCGGACAAAGGCAGG + Intergenic
985956416 5:3269174-3269196 AAGGCTGTGCAGTGGACTGCAGG + Intergenic
986792915 5:11181033-11181055 CAGGCTGGGCAGAGGCTGACTGG + Intronic
987888215 5:23838669-23838691 CAGGCTGTCAGGAGAAAGGCTGG + Intergenic
988079795 5:26401160-26401182 CAGGCTGGGCAAGAGAAGGCAGG + Intergenic
988510574 5:31861235-31861257 CAGGAAGTGCAGAGGAAGGGTGG - Intronic
988901140 5:35733613-35733635 GAGGCAGTTCACAGGAAGGCAGG + Intronic
990336209 5:54775065-54775087 AAAGCTGTGCAAAGGAAGGGTGG + Intergenic
991946174 5:71900409-71900431 CAGGCTGGGGAAAAGAAGGCAGG - Intergenic
992879167 5:81088137-81088159 CAGTCTGTGCAGAGGAATAGAGG - Intronic
993177359 5:84503708-84503730 CAGGATTTGGAGAGGGAGGCTGG + Intergenic
993386281 5:87267497-87267519 GAGGCGGTGGAGAGGAAGGAGGG - Intergenic
994106312 5:95953087-95953109 CGGGCTGAGCAGAGGATGGCAGG + Intronic
994965075 5:106659236-106659258 CAGACTGTTCAGAGCCAGGCTGG - Intergenic
996392173 5:122973517-122973539 CAGGCTGGGGAGGAGAAGGCTGG + Intronic
996746167 5:126848002-126848024 CTGGCAGTGAAGAGGAAGGCTGG - Intergenic
997437005 5:133882801-133882823 CAGGAAGGGCAGAGAAAGGCCGG + Intergenic
997825264 5:137100617-137100639 CAGGCTGTACAATGGCAGGCAGG - Intronic
997852585 5:137346085-137346107 GAGCCTGTGCAAAGGAAGACAGG - Intronic
997930595 5:138069532-138069554 CTGAGTTTGCAGAGGAAGGCAGG + Intergenic
998384718 5:141750160-141750182 GAGGCTCTGCAGAAAAAGGCTGG + Intergenic
998730074 5:145064742-145064764 CAGGCTTTGAAGAGGGAGGATGG + Intergenic
999269750 5:150289894-150289916 CAGGTTTCGCAGTGGAAGGCAGG - Intronic
1000937193 5:167316951-167316973 GGGGGTGTGCAGAGGAAGGCTGG - Intronic
1001573096 5:172743682-172743704 CAGGTGGTCCAGAGGAAGGAGGG + Intergenic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1003291362 6:4781187-4781209 CAGGATTTGCAGGGGAAGGTAGG + Intronic
1003333125 6:5146118-5146140 CAGCCCGTGCTGAGGCAGGCAGG - Intronic
1003395894 6:5751672-5751694 TGGGCTGTGCACAGGAAGACAGG + Intronic
1005174644 6:23030884-23030906 CAGGAACTGCAGTGGAAGGCAGG + Intergenic
1005914602 6:30341620-30341642 CAGGCTCTGTAAAGGCAGGCTGG + Intronic
1006817498 6:36862350-36862372 CAGGCTGTGGAGGAGGAGGCTGG - Intronic
1007165327 6:39824920-39824942 CTGGCTCTGGAGAGGAAGACTGG - Intronic
1007543090 6:42668114-42668136 GAGGCTGTGTAGGGGAAGGAGGG - Intronic
1007922959 6:45627231-45627253 CCGTGTGTACAGAGGAAGGCTGG - Intronic
1008998632 6:57688075-57688097 CAGGCTGTACAGAAAACGGCTGG + Intergenic
1011078167 6:83460174-83460196 CTGCCTGTGCAGGGGAAGCCAGG + Intergenic
1011957207 6:93037744-93037766 CAGTCTCTGCACAGGAAGGGTGG + Intergenic
1013302839 6:108820183-108820205 CAGGCAGTCCAGATGAAAGCAGG + Intergenic
1014004724 6:116405177-116405199 CAGGCAATGCTGAGCAAGGCAGG - Intronic
1014015340 6:116523132-116523154 CAGGCTATTCTGGGGAAGGCAGG + Exonic
1014082748 6:117306527-117306549 CAGGCTATGGAGAGAAGGGCAGG + Intronic
1014474606 6:121857137-121857159 CAGGCTGTGCACTGTGAGGCTGG - Intergenic
1015042142 6:128733890-128733912 CAGGAAATTCAGAGGAAGGCTGG + Intergenic
1016147297 6:140692447-140692469 CAGGCTGTGGGGGAGAAGGCAGG + Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1019219661 6:170463728-170463750 CAGGCTGGGCCGGGGCAGGCAGG - Intergenic
1019426936 7:982402-982424 CAGGCTGTGCAAAGCAGGCCCGG + Intergenic
1019546623 7:1580617-1580639 CTGGCTCTGCAGAGGTAGCCAGG + Intergenic
1019742562 7:2682140-2682162 CAGGCTGGGCACAGGGAGGCTGG + Intronic
1020009917 7:4802164-4802186 CAGGCTGTGCTCCGGATGGCGGG - Intronic
1021606078 7:22410903-22410925 CAGGGAGTGCAGAGAAGGGCTGG + Intergenic
1021627422 7:22608146-22608168 CAGGCTGTGAGGAAGAGGGCTGG - Intronic
1021928376 7:25554854-25554876 TAAGATGTGGAGAGGAAGGCAGG + Intergenic
1022471994 7:30687759-30687781 GAGGGAGGGCAGAGGAAGGCAGG + Intronic
1024374199 7:48619066-48619088 CCCACTTTGCAGAGGAAGGCAGG + Intronic
1024459510 7:49645512-49645534 CTGGCTGTGCAGATGTAGGGAGG + Intergenic
1024675755 7:51636625-51636647 CTGGCTGTGCAGAGGAGAGGAGG + Intergenic
1025236950 7:57240906-57240928 CAGGTGGTGCAGAGGACAGCTGG - Intergenic
1026979680 7:74519087-74519109 CAGGCAATGCAGAGGCAGGAAGG + Intronic
1029064872 7:97839315-97839337 CAGGGGGAGCAGAGGAGGGCCGG + Intergenic
1030754161 7:113268443-113268465 CAGTCTCTGCACAGGAAGGATGG - Intergenic
1030754176 7:113268557-113268579 CAGTCTCTGCACAGGAAGGGTGG - Intergenic
1031427309 7:121621363-121621385 CCAGCTGTGCAGAGGGAGGACGG - Intergenic
1032395713 7:131588365-131588387 CAGCCTGTGCAGAGGAGACCAGG - Intergenic
1032849243 7:135779396-135779418 GAGGCTGGGAAGAGGAGGGCAGG + Intergenic
1033648251 7:143321395-143321417 CAGGAACTGCAGAGGAAGGCTGG - Exonic
1033842011 7:145386452-145386474 CAGGCTGTGGTGAGCAGGGCAGG + Intergenic
1034165434 7:149021764-149021786 CAGGGTTTGCAGAGCAAGGCAGG - Intronic
1034540556 7:151755383-151755405 GAGCCTGAGCAGAGGAAGACAGG + Intronic
1034994498 7:155569679-155569701 CAGGGTGTGGAGGGGAAGGCAGG - Intergenic
1035238912 7:157517492-157517514 CAGGTGGTGCAGAGGCAGGGTGG + Intergenic
1035296180 7:157867976-157867998 CCTGCTGTCCAGAGGAAGTCTGG - Intronic
1035658197 8:1327280-1327302 GAGGCTGTGCAGTGGAGGGTGGG - Intergenic
1035879901 8:3234657-3234679 CTGGGAGAGCAGAGGAAGGCAGG + Intronic
1036179248 8:6568763-6568785 CAGGCCGTGCTGAGGACGGCAGG - Intronic
1036428180 8:8665748-8665770 CAAGCAGTGCAGCTGAAGGCAGG + Intergenic
1036633035 8:10528879-10528901 CTGGCTTTGAAGATGAAGGCAGG - Intronic
1036636122 8:10550636-10550658 CAGGCAGGAGAGAGGAAGGCTGG - Intronic
1036788244 8:11702008-11702030 CAGGCTGTGCTGTGGATGGTGGG - Intronic
1037830572 8:22186194-22186216 CAGGCTTTGCAGAGAAGGGAGGG - Intronic
1038201073 8:25413217-25413239 CAGGCCTAGCAGAGGAAAGCAGG - Exonic
1038490810 8:27969733-27969755 GAGGCTGTGCATGGGAAGGGTGG + Intronic
1038828628 8:31033384-31033406 CAGGCTGTGCCGGGGGAGGCGGG - Exonic
1038927295 8:32154547-32154569 AAGGCCTTGCAGAGGAAGGAAGG - Intronic
1039387096 8:37145819-37145841 CAGGGTGTGGAGCTGAAGGCTGG - Intergenic
1039893217 8:41698207-41698229 CAGGCTCTGGAGTGGAAAGCCGG - Intronic
1041179295 8:55230945-55230967 CAGACTGAGCAGCTGAAGGCAGG - Intronic
1041670325 8:60485299-60485321 CAGCCTGTATAGGGGAAGGCAGG + Intergenic
1041709553 8:60881447-60881469 CAGGCTTTGCAGATGGAGGAAGG - Intergenic
1042540864 8:69906016-69906038 CAGGCTGTGCAGAATGGGGCAGG - Intergenic
1045347354 8:101305036-101305058 CAGGGTGGGCAGGGAAAGGCAGG + Intergenic
1045559869 8:103250738-103250760 CAGACAGTGAAGAGGAAGGCTGG - Intergenic
1045593834 8:103629899-103629921 CTGGCAGTACAAAGGAAGGCAGG + Intronic
1045617669 8:103937601-103937623 ATTGCTGTGCAGAGGAGGGCAGG + Intronic
1046515890 8:115260045-115260067 CAGGCTGTGAAGATGAGTGCTGG - Intergenic
1047422685 8:124720202-124720224 CAGGCTGTGTCAAGGAAGCCTGG + Intronic
1047445266 8:124913754-124913776 CAGGAGGTGCAGAGCCAGGCAGG - Intergenic
1048331449 8:133473516-133473538 CAGGCTCTGAAGAGGAAGTTTGG + Intronic
1048382104 8:133874281-133874303 CAGGCTGGCCAAAGGAAGGCTGG + Intergenic
1048884861 8:138901886-138901908 GGGGCTGTGCTGGGGAAGGCGGG + Intronic
1048888022 8:138924309-138924331 CAGGCTGGGCAGACCCAGGCTGG - Intergenic
1048987082 8:139740460-139740482 CATGCTGGGCAGGGGGAGGCAGG + Intronic
1049063086 8:140291572-140291594 CAGGTTGTGCACACCAAGGCTGG - Intronic
1049201482 8:141342685-141342707 CAGGCTGGGCTGAGGAGGACGGG + Intergenic
1049495128 8:142926473-142926495 CGGGCTGGGCAGAGGATGACAGG - Intergenic
1050151313 9:2621901-2621923 CAGGCGCTGCAGAGGAGGGGAGG - Exonic
1052344981 9:27400399-27400421 CAGGATGTGCACAGCTAGGCGGG - Intronic
1054736955 9:68763209-68763231 CAGCCTGTGCAGAGGAAAAGAGG + Intronic
1055353362 9:75412380-75412402 CAGGGTGGGCAGAGTCAGGCAGG + Intergenic
1056172147 9:83996754-83996776 CAGGCTGTACAGGAGCAGGCTGG + Intronic
1056676167 9:88678727-88678749 GTGGCTGGGCAGAGCAAGGCAGG + Intergenic
1057182138 9:93035957-93035979 CAGGCTGGGCAGAGGCGGGGTGG - Exonic
1057222018 9:93262561-93262583 CAGGCTGGGCTGAGGAAGTGGGG + Intronic
1057605018 9:96492841-96492863 CAGCCTGGGAAGAGGCAGGCTGG + Intronic
1058800167 9:108538001-108538023 GAGGATGTGCTGAGGAGGGCTGG - Intergenic
1059042916 9:110833524-110833546 CAGCCTGTGCAGTGCAAGGAAGG + Intergenic
1060180727 9:121531847-121531869 CAGGCTGTGTGGAGGAAGAGTGG + Intergenic
1060215624 9:121736710-121736732 CAGCCAGAGCAGTGGAAGGCAGG - Intronic
1060524568 9:124313243-124313265 GAGCCTGGGCAGAGGAGGGCCGG + Intronic
1060757241 9:126222910-126222932 CAGGCTGTGCAGAGCCAGCGGGG - Intergenic
1060807765 9:126588266-126588288 CAGGCTCTGCACAGGGAGGCTGG - Intergenic
1061492888 9:130956064-130956086 AGGGCTGTGCAGAGGAAGCCAGG + Intergenic
1061895413 9:133644390-133644412 CATGCTGGGCAGACGAAGGGCGG - Intronic
1062037160 9:134387513-134387535 CACGCAGTGCTGAGGAAGGCTGG - Intronic
1062070665 9:134553502-134553524 CAGGCTGGGGAGAGGAGAGCAGG + Intergenic
1062321820 9:135993953-135993975 CAGGCACTGCAGAGCCAGGCGGG + Intergenic
1062514725 9:136926901-136926923 GAGCCTGTGCACAGAAAGGCAGG - Intronic
1062523624 9:136969687-136969709 GAGGCAGGGCAGAGGGAGGCTGG - Intronic
1062526435 9:136979773-136979795 CAGGCTGTGCAGGCGAGAGCAGG + Intronic
1185609391 X:1385557-1385579 CAGGAGGTGGAGAGGAACGCAGG + Intergenic
1185705349 X:2262687-2262709 CGGGCTGTGCAGGGAAGGGCGGG - Intronic
1186532594 X:10312292-10312314 CTGGCTTTGAAGAGGAAGGAAGG - Intergenic
1186724930 X:12347087-12347109 CAGACTGGGCACAGGAATGCAGG + Intronic
1189516611 X:41718902-41718924 CAGGCTGGGCTGAGCAAAGCAGG + Intronic
1190014720 X:46817129-46817151 GAGACTGTGGACAGGAAGGCAGG + Intergenic
1190213487 X:48466145-48466167 CAGGCTGGGCTGGGGAAGACGGG - Intronic
1190878195 X:54474628-54474650 CAGGATGTGCTGAGCAGGGCAGG - Intronic
1197467323 X:126820874-126820896 CAAGCTATGAAGAGGAATGCAGG - Exonic
1198040641 X:132848281-132848303 GAGACAGTGCTGAGGAAGGCAGG - Intronic
1199040624 X:143111364-143111386 CAGGCTGGGCAAGAGAAGGCAGG - Intergenic
1199860936 X:151800057-151800079 CAAGCTGGGCAAAGGAGGGCTGG - Intergenic
1199963801 X:152801279-152801301 CAGGCTGCGCAGGGAAATGCTGG + Intergenic
1200073829 X:153541650-153541672 CAGGCTGTGCGGAGGACAGAAGG - Exonic