ID: 1119256905

View in Genome Browser
Species Human (GRCh38)
Location 14:73206397-73206419
Sequence TGGTTGGTGAATATGGCAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119256897_1119256905 23 Left 1119256897 14:73206351-73206373 CCAGTGCTTACCTGGAATTTTGT 0: 1
1: 0
2: 3
3: 12
4: 169
Right 1119256905 14:73206397-73206419 TGGTTGGTGAATATGGCAGAAGG 0: 1
1: 0
2: 0
3: 16
4: 170
1119256898_1119256905 13 Left 1119256898 14:73206361-73206383 CCTGGAATTTTGTCTTTCCCAAC 0: 1
1: 1
2: 1
3: 19
4: 235
Right 1119256905 14:73206397-73206419 TGGTTGGTGAATATGGCAGAAGG 0: 1
1: 0
2: 0
3: 16
4: 170
1119256901_1119256905 -4 Left 1119256901 14:73206378-73206400 CCCAACAGCAACAATGGTGTGGT 0: 1
1: 0
2: 0
3: 7
4: 123
Right 1119256905 14:73206397-73206419 TGGTTGGTGAATATGGCAGAAGG 0: 1
1: 0
2: 0
3: 16
4: 170
1119256902_1119256905 -5 Left 1119256902 14:73206379-73206401 CCAACAGCAACAATGGTGTGGTT 0: 1
1: 0
2: 0
3: 11
4: 113
Right 1119256905 14:73206397-73206419 TGGTTGGTGAATATGGCAGAAGG 0: 1
1: 0
2: 0
3: 16
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119256905 Original CRISPR TGGTTGGTGAATATGGCAGA AGG Exonic
902790780 1:18766389-18766411 GGGTAGGTGAAGAGGGCAGAGGG + Intergenic
904367489 1:30024021-30024043 TGGTTGGTGAGAAAAGCAGACGG - Intergenic
905303211 1:36999496-36999518 TGGGTGGTGAGTAGGGGAGATGG - Intronic
906965098 1:50448526-50448548 TGCCTGGTGAATTTGGGAGAAGG + Intronic
908055890 1:60286859-60286881 AGTTTGGTGAATATTGCAAATGG + Intergenic
909726038 1:78836860-78836882 TGGTTGGAGTATGTGGCAAAGGG + Intergenic
910047387 1:82933922-82933944 TGGATGCTGAACCTGGCAGATGG - Intergenic
910944484 1:92575183-92575205 TAATTGGTGAATATAGCTGAAGG - Intronic
912850429 1:113119454-113119476 TGGTTGGTGGGAAAGGCAGATGG - Exonic
916839775 1:168587609-168587631 TGGATGCTGATGATGGCAGAAGG - Intergenic
918081741 1:181213173-181213195 TGGTTGGTGAATGTGGGTGGGGG + Intergenic
919414144 1:197285764-197285786 TCCTTGGTAAATATGGGAGAAGG - Intronic
921931101 1:220754951-220754973 TGGCTGGTGATTAAGGAAGATGG + Exonic
923869303 1:237973649-237973671 TGATTGGTGAGTTTGGCAGAAGG + Intergenic
924181867 1:241446898-241446920 TTGTTGCTGCGTATGGCAGAAGG - Intergenic
924492111 1:244548546-244548568 TGGATGATAATTATGGCAGAAGG - Intronic
1063852393 10:10207724-10207746 TGTTTGGTGAAGCTGGGAGAAGG - Intergenic
1064376941 10:14805176-14805198 TGATTGGTGAATCTGGCGGAGGG + Intergenic
1064806340 10:19138122-19138144 CTGTTGATGAACATGGCAGAAGG - Intronic
1065667301 10:28075877-28075899 CCGTTGTTGAATAAGGCAGAAGG - Intronic
1066157025 10:32689482-32689504 TGATTGGTGCCTATGGAAGAAGG - Intronic
1069457168 10:68561927-68561949 AGGTTGGTTAATTTGGGAGAGGG - Intronic
1075685740 10:124364138-124364160 TGGTTGGTGTCTCTGGCAAAGGG - Intergenic
1077225629 11:1437974-1437996 TGGCTGGTGGAGAGGGCAGAGGG - Intronic
1080903428 11:36516988-36517010 TGGTTTGTGTATATTGCTGATGG + Intronic
1081631461 11:44692717-44692739 GGGTCGGGGAAGATGGCAGACGG - Intergenic
1083483418 11:62965172-62965194 TGATTGGTGAATCTGGGAGAAGG + Intronic
1084580525 11:70020297-70020319 TGGGTGGTGAGGATGGAAGAAGG - Intergenic
1085798071 11:79562026-79562048 GGGTTGGTGAATATGGAAGTAGG + Intergenic
1085902093 11:80713203-80713225 TGGTGGGCGTAGATGGCAGAGGG - Intergenic
1086240321 11:84682560-84682582 TGGTTGCTGAATAGAGCTGAAGG + Intronic
1086499905 11:87441903-87441925 TTGTTGGTAAACATGGCAGAAGG + Intergenic
1089319943 11:117618932-117618954 GGGTTGCTGAATACTGCAGAAGG + Intronic
1090258861 11:125304395-125304417 TGGATGGAACATATGGCAGAGGG + Intronic
1090675460 11:128990073-128990095 TGGTTGGTTTGTATGGCAAAAGG - Intronic
1091068301 11:132538879-132538901 TGAATGGGGAATATGGCACATGG - Intronic
1091566684 12:1654005-1654027 TGGTAGGGGCATATGGCAGGGGG + Intergenic
1095193841 12:39289433-39289455 GGTCAGGTGAATATGGCAGATGG - Intergenic
1098269393 12:68755176-68755198 TGGGAGGTGACTATGGCATAAGG - Intronic
1101095178 12:101331269-101331291 TGGTTGGTGGGAATGGGAGATGG + Intronic
1101478159 12:105071314-105071336 TGTTTGGTGAATTTGGGAGAAGG - Intronic
1106232063 13:27828120-27828142 AGGTTGGAGAATTAGGCAGAGGG - Intergenic
1106911951 13:34472371-34472393 TGGTAAGTGAAGATGGCAGTGGG + Intergenic
1106928533 13:34638366-34638388 TGGTTGGAGGATAGGGCAAAGGG + Intergenic
1107119827 13:36784439-36784461 TTTTTGGTGAGGATGGCAGAAGG + Intergenic
1107518829 13:41159439-41159461 TGGGTAGTCAATGTGGCAGAAGG + Intergenic
1108562974 13:51664960-51664982 TAGTAGTTAAATATGGCAGATGG + Intronic
1109585745 13:64400803-64400825 TGGTTTTTGAATATGGTATAAGG + Intergenic
1112926642 13:104683503-104683525 TGGTTTGGGCATAAGGCAGATGG - Intergenic
1114251752 14:20967884-20967906 TGGTTGATGAAGGTGGAAGAAGG + Intergenic
1115383137 14:32762816-32762838 TGATTGGTGAGTATACCAGATGG + Intronic
1118049376 14:62010225-62010247 TGGCTGGTGAATATCACATATGG - Intronic
1118466426 14:66035155-66035177 CAGTTGGTGGATAAGGCAGAGGG + Intergenic
1119256905 14:73206397-73206419 TGGTTGGTGAATATGGCAGAAGG + Exonic
1119970480 14:78964815-78964837 TGGTGAGTGACTAGGGCAGAGGG - Intronic
1119971217 14:78972697-78972719 GGGTTGGGGAGTAGGGCAGAGGG - Intronic
1120932892 14:89866502-89866524 TGGCTGGTGAATCTTGAAGAGGG - Intronic
1122797959 14:104215877-104215899 TGGATGGCGGGTATGGCAGATGG + Intergenic
1124472321 15:29999258-29999280 TGGATGGTGCTTATGGAAGAAGG - Intergenic
1125815043 15:42576607-42576629 TGGAAGGTAAATCTGGCAGAGGG + Intronic
1128713161 15:69887038-69887060 GAGTTGGAGAATATAGCAGAAGG - Intergenic
1128763099 15:70232336-70232358 TACTTGGTGAAAATAGCAGATGG + Intergenic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129874692 15:78965990-78966012 TTGGTGTTGAATAAGGCAGAGGG + Intronic
1131875619 15:96803053-96803075 GGATTGCTGAATATGGAAGACGG + Intergenic
1132515517 16:364117-364139 TGATTGGTGAGGATGGCAGAAGG + Intergenic
1140061703 16:71576097-71576119 TGGTTGGAGAAGATGGCAGTTGG - Intronic
1140916702 16:79500291-79500313 ATGTTGGTGGAGATGGCAGATGG - Intergenic
1141432672 16:83978853-83978875 TGCTGGCTGAAGATGGCAGAAGG - Intronic
1141555549 16:84834482-84834504 TGGTTTGTGGCTTTGGCAGATGG + Intronic
1143016884 17:3895535-3895557 TGGTTGGGGAAGAGGGCAGAAGG + Intergenic
1144580634 17:16457124-16457146 TGGGGAGTGAAGATGGCAGATGG - Intronic
1149338693 17:55664371-55664393 CGATTGCTGAATATGGTAGAAGG - Intergenic
1152671736 17:81612006-81612028 TGGTACGTGAACATGGCAAAGGG + Intronic
1155535028 18:26808214-26808236 AGGTTGCAGAACATGGCAGATGG + Intergenic
1156803286 18:41145010-41145032 TGCTTAGTGAAGATGGAAGAGGG + Intergenic
1158548966 18:58418749-58418771 TGGTTGGTGTAGATGGCACAGGG + Intergenic
1158981983 18:62771832-62771854 TGACTGGTGAAAATGGCTGATGG - Intronic
1162463120 19:10824968-10824990 TGGTGGGACAATAGGGCAGATGG + Intronic
1163118987 19:15204714-15204736 TGGTTGGTGAATCTGGACAAAGG - Intergenic
1163174157 19:15552500-15552522 TGCTGGATGAATATAGCAGAGGG + Intergenic
1163491664 19:17620498-17620520 GGGTTGGTGGGTAGGGCAGAGGG - Intronic
926124046 2:10260554-10260576 GGGATGGTGAAAATGGCAAAAGG - Intergenic
926359960 2:12077698-12077720 TGATAGGTTAATATGACAGATGG + Intergenic
929792172 2:45031428-45031450 AGGCTGGTGAGGATGGCAGAAGG - Intergenic
931171373 2:59807184-59807206 TGGATGCTGTAAATGGCAGAAGG - Intergenic
933881863 2:86677680-86677702 TGGTTGTTGCATATGGCAGTGGG + Intronic
936937819 2:117854956-117854978 TGGTTGTTGAATGTAGCAGGAGG - Intergenic
937152486 2:119695531-119695553 TGGGTGGGGGATATGGGAGATGG + Intergenic
937912664 2:127083020-127083042 TGATTGGTGAATCTGGGTGAAGG - Intronic
939956087 2:148528803-148528825 TGGATGGAGAATCTGGGAGAAGG - Intergenic
940653337 2:156459323-156459345 TAGGTGGTAAAAATGGCAGAAGG + Intronic
941206112 2:162575272-162575294 TGATTGAGGAATAAGGCAGAAGG - Intronic
942937713 2:181577772-181577794 TGGTTGGCGAGTAAGGCAGTAGG + Intronic
947291423 2:228579114-228579136 TGATTGGTGAATATTTCACAAGG - Intergenic
1169173963 20:3492120-3492142 TGGTTGTTGAATATACAAGAAGG + Intronic
1169344538 20:4820085-4820107 GGGTTGGTGAATGGGGCAGGAGG - Intronic
1171376814 20:24699540-24699562 TGTTTTGTGAATAAAGCAGATGG - Intergenic
1171945818 20:31376755-31376777 TGTTTGGTGGTTATTGCAGAAGG - Intergenic
1175002867 20:55648648-55648670 TGAGTGGTGAAAATTGCAGAAGG + Intergenic
1175705446 20:61173259-61173281 TGGATGGTGGAGATGGCTGATGG - Intergenic
1182040058 22:27231279-27231301 AGGGTGGAGACTATGGCAGAAGG + Intergenic
1183015556 22:34983680-34983702 TAGTTGGTGGATAAGGCAAAAGG - Intergenic
1183859490 22:40659408-40659430 TGGCCAGTGAAGATGGCAGATGG - Intergenic
951111810 3:18812754-18812776 TGATTGGTGAACTTGGGAGAAGG + Intergenic
953663351 3:44907059-44907081 TGGTTGGTGAAGATGGTGAATGG + Exonic
956788397 3:72661427-72661449 TAGTTACTGAAAATGGCAGAAGG + Intergenic
961223734 3:125220361-125220383 TGTTTGGTGAATGTGGTTGAAGG - Intergenic
961249869 3:125492581-125492603 TTGTTGGGGAATATGACAGCAGG - Intronic
962097721 3:132309146-132309168 TGGTTGGGCAATTTGGCATAAGG - Intergenic
962400937 3:135058239-135058261 CAGTTGATGAATGTGGCAGAGGG + Intronic
962772541 3:138626360-138626382 TGATGGGGGAACATGGCAGATGG - Intronic
962952916 3:140235956-140235978 TGGATGGTGACTGTAGCAGATGG + Intronic
964848699 3:161070720-161070742 TGGCCGGTGAATGTGGCATATGG - Exonic
965216319 3:165868724-165868746 TGGTTTGTGAATATGCAAAAAGG + Intergenic
971718090 4:30207035-30207057 CGGTTGGTAAATGTGGGAGAGGG - Intergenic
974075757 4:57166828-57166850 TGGTTGGTGAATCTACCAAATGG - Intergenic
974751191 4:66143968-66143990 TGGTAGGTGGTCATGGCAGAAGG + Intergenic
975860155 4:78668653-78668675 AGGGTGGTGAAGATGGCACAGGG - Intergenic
976246963 4:83013940-83013962 TGGGTGTTGATTATGGCACAAGG - Intergenic
977119267 4:93076587-93076609 AGGTTGGTGAATTTTGAAGAAGG - Intronic
977922190 4:102658033-102658055 TGGTTGTTGAATAGGGAAGAAGG - Intronic
978795215 4:112701990-112702012 TGCCAGGTGAGTATGGCAGAGGG + Intergenic
983859353 4:172686166-172686188 TGGTTGGTGGATCTGGCAGTGGG - Intronic
987745747 5:21969393-21969415 TACTTGTAGAATATGGCAGAAGG + Intronic
988050132 5:26016998-26017020 TGGTTGGTGAAAATGTAAAATGG + Intergenic
992074163 5:73175705-73175727 GGGTGGGTGAAAATGGCAGGGGG - Intergenic
994537280 5:101048289-101048311 TGGTTGGAGCATTTGGCAAAAGG - Intergenic
996736260 5:126761163-126761185 AGGTTGGGGAATTTGGCAAAAGG - Intergenic
997645331 5:135477888-135477910 GGGTTGGGGAATATGGCACTCGG + Intergenic
997675896 5:135712993-135713015 TGATTGCAGAATTTGGCAGAAGG - Intergenic
998731582 5:145083120-145083142 TGGTGGGGGAAGATAGCAGAAGG - Intergenic
999401662 5:151269033-151269055 TGTTGGGTGAATGAGGCAGATGG + Exonic
999521728 5:152357856-152357878 TGGTGTGTGCAGATGGCAGATGG - Intergenic
1001946878 5:175786627-175786649 TCGTTGGTGAGTCTGGCTGATGG + Intergenic
1004238648 6:13898676-13898698 TGGTTGCAGAAAATGGGAGAAGG - Intergenic
1004629912 6:17411389-17411411 TTGCTGGTGAATATGGAAAATGG - Intronic
1004823211 6:19392584-19392606 TGGGAGGTGAATATGTCATAAGG - Intergenic
1005885218 6:30092269-30092291 TGGGTGGTGTATGTGGCAGGAGG + Intergenic
1008581776 6:52914410-52914432 GGGTAGGTGAACATGCCAGAAGG - Intergenic
1013047004 6:106496688-106496710 AGGTTGGTGAGAATGGCAGGAGG + Intergenic
1020520559 7:9180653-9180675 TGGGTTGTGAAACTGGCAGAAGG + Intergenic
1021459866 7:20874146-20874168 TGGTTAGCAAATGTGGCAGATGG + Intergenic
1022426492 7:30273450-30273472 TGGTTGGTGGATACTTCAGAGGG + Intergenic
1023599322 7:41865626-41865648 TGGTTAGTGAGTATGGAAAAAGG + Intergenic
1023619775 7:42058250-42058272 TGGGTGGAGAGTATGGAAGAAGG + Intronic
1023872486 7:44270260-44270282 GGGATGGTGCACATGGCAGAAGG + Intronic
1024048059 7:45598834-45598856 TGGCTGGTGATTATGGAGGACGG + Intronic
1027653873 7:80904727-80904749 TGGTTTCTAAATATGGCAGTAGG + Intronic
1028362680 7:89987846-89987868 TGGGTGGTAAAACTGGCAGAAGG + Intergenic
1031800111 7:126232702-126232724 TGGGTTGTAAATCTGGCAGAGGG - Intergenic
1032846602 7:135756780-135756802 TGCTTGGTCATCATGGCAGAGGG + Intergenic
1033899759 7:146122140-146122162 TGTTTGGTGACTATGGGAAAAGG + Intronic
1034590440 7:152133751-152133773 TGTTTGGTGACTAGGACAGAGGG + Intergenic
1034680592 7:152925104-152925126 TGGTTTGTGGATGTGGAAGAGGG + Intergenic
1036786327 8:11690125-11690147 TGGTGGGTGATTATGGCACCAGG - Intronic
1037445343 8:18959863-18959885 TGATTGGTGAATTTGTAAGAAGG - Intronic
1037945079 8:22984484-22984506 ATGTTGGTGACTATAGCAGAAGG + Intronic
1039631434 8:39115909-39115931 TGGTTATTGAATATGGCAAAAGG + Intronic
1041993923 8:64029837-64029859 TGGGTGGTGAGCATGGCAAAGGG - Intergenic
1043477608 8:80620427-80620449 TGGTTTTTGAATGTGGCACATGG + Intergenic
1043953128 8:86331562-86331584 TGGTTTGTGAATCTGGAAGCTGG + Intergenic
1044866454 8:96575603-96575625 GGGTTGGTGAGGATGGCAGTAGG + Intronic
1046088365 8:109467268-109467290 TGGCTGGTGCAAATGCCAGATGG - Intronic
1047220161 8:122912300-122912322 TGGCTGGTGGACATGACAGATGG - Intronic
1047531429 8:125680400-125680422 GGGTTTCTAAATATGGCAGAGGG + Intergenic
1049134536 8:140884023-140884045 TGGGAGGTGAATATGAAAGAAGG - Intronic
1051675310 9:19552798-19552820 TGCCTGGTGACTTTGGCAGATGG - Intronic
1051795611 9:20866189-20866211 TACTTGGTGAATCTGACAGATGG + Intronic
1052434309 9:28406692-28406714 TGGTTGGAGAATGCTGCAGATGG - Intronic
1057320035 9:94004248-94004270 GGTTTGGTAAAGATGGCAGATGG + Intergenic
1057691987 9:97293608-97293630 GGGTCAGTGATTATGGCAGAGGG - Intergenic
1057749245 9:97778295-97778317 TGGGTGGGGGATATGGGAGAAGG + Intergenic
1060719942 9:125970038-125970060 TGGCTGCTGAATGTGGCACATGG - Intergenic
1062638706 9:137505799-137505821 TGGTTGGGGAACATCGCACAAGG + Intronic
1186170083 X:6867547-6867569 TGGTTGGTGATAATGGTGGATGG + Intergenic
1186518294 X:10183695-10183717 TGGTGGGAGAATATGGGAGATGG + Intronic
1186827196 X:13352158-13352180 TGGTTGGTCATGATGGCAGAGGG - Intergenic
1187057664 X:15756522-15756544 TGGTTGGAGAATATGTCATCAGG + Intronic
1187106610 X:16249843-16249865 TAGTTGGTTAATATGGCTAAAGG - Intergenic
1187464874 X:19518093-19518115 TGGTTGGTGAGAATGGAAAACGG - Intergenic
1193717685 X:84951210-84951232 TGGTTGGGCAATTTGGCATAAGG - Intergenic
1194702421 X:97130590-97130612 GGGTTGGGGGATAAGGCAGATGG + Intronic
1195541880 X:106071557-106071579 TGATTTGTGTATATGGCATAAGG + Intergenic
1196236860 X:113291859-113291881 TGATTGGTGAATTTGGAATAAGG - Intergenic
1198990719 X:142511603-142511625 AGGTAGGTGAATAAGGAAGATGG + Intergenic
1200205848 X:154315664-154315686 TGGTTGCAGAATTGGGCAGAAGG - Intronic