ID: 1119257229

View in Genome Browser
Species Human (GRCh38)
Location 14:73208932-73208954
Sequence CATGGGAGGGAGACTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1359
Summary {0: 1, 1: 4, 2: 27, 3: 176, 4: 1151}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119257229_1119257242 11 Left 1119257229 14:73208932-73208954 CCCTCCTCAGTCTCCCTCCCATG 0: 1
1: 4
2: 27
3: 176
4: 1151
Right 1119257242 14:73208966-73208988 CCAAAGTCCAGAGGGGGCCAAGG 0: 29
1: 70
2: 146
3: 237
4: 459
1119257229_1119257248 21 Left 1119257229 14:73208932-73208954 CCCTCCTCAGTCTCCCTCCCATG 0: 1
1: 4
2: 27
3: 176
4: 1151
Right 1119257248 14:73208976-73208998 GAGGGGGCCAAGGTGGCAGGGGG 0: 23
1: 59
2: 108
3: 228
4: 903
1119257229_1119257246 19 Left 1119257229 14:73208932-73208954 CCCTCCTCAGTCTCCCTCCCATG 0: 1
1: 4
2: 27
3: 176
4: 1151
Right 1119257246 14:73208974-73208996 CAGAGGGGGCCAAGGTGGCAGGG 0: 18
1: 36
2: 76
3: 206
4: 553
1119257229_1119257238 4 Left 1119257229 14:73208932-73208954 CCCTCCTCAGTCTCCCTCCCATG 0: 1
1: 4
2: 27
3: 176
4: 1151
Right 1119257238 14:73208959-73208981 TCAGCACCCAAAGTCCAGAGGGG 0: 12
1: 31
2: 87
3: 140
4: 388
1119257229_1119257245 18 Left 1119257229 14:73208932-73208954 CCCTCCTCAGTCTCCCTCCCATG 0: 1
1: 4
2: 27
3: 176
4: 1151
Right 1119257245 14:73208973-73208995 CCAGAGGGGGCCAAGGTGGCAGG 0: 15
1: 33
2: 91
3: 184
4: 680
1119257229_1119257243 14 Left 1119257229 14:73208932-73208954 CCCTCCTCAGTCTCCCTCCCATG 0: 1
1: 4
2: 27
3: 176
4: 1151
Right 1119257243 14:73208969-73208991 AAGTCCAGAGGGGGCCAAGGTGG 0: 16
1: 44
2: 91
3: 143
4: 358
1119257229_1119257237 3 Left 1119257229 14:73208932-73208954 CCCTCCTCAGTCTCCCTCCCATG 0: 1
1: 4
2: 27
3: 176
4: 1151
Right 1119257237 14:73208958-73208980 GTCAGCACCCAAAGTCCAGAGGG 0: 7
1: 23
2: 66
3: 127
4: 296
1119257229_1119257247 20 Left 1119257229 14:73208932-73208954 CCCTCCTCAGTCTCCCTCCCATG 0: 1
1: 4
2: 27
3: 176
4: 1151
Right 1119257247 14:73208975-73208997 AGAGGGGGCCAAGGTGGCAGGGG 0: 21
1: 38
2: 107
3: 238
4: 819
1119257229_1119257239 5 Left 1119257229 14:73208932-73208954 CCCTCCTCAGTCTCCCTCCCATG 0: 1
1: 4
2: 27
3: 176
4: 1151
Right 1119257239 14:73208960-73208982 CAGCACCCAAAGTCCAGAGGGGG 0: 9
1: 23
2: 81
3: 137
4: 390
1119257229_1119257249 25 Left 1119257229 14:73208932-73208954 CCCTCCTCAGTCTCCCTCCCATG 0: 1
1: 4
2: 27
3: 176
4: 1151
Right 1119257249 14:73208980-73209002 GGGCCAAGGTGGCAGGGGGCTGG 0: 25
1: 56
2: 113
3: 265
4: 1053
1119257229_1119257236 2 Left 1119257229 14:73208932-73208954 CCCTCCTCAGTCTCCCTCCCATG 0: 1
1: 4
2: 27
3: 176
4: 1151
Right 1119257236 14:73208957-73208979 TGTCAGCACCCAAAGTCCAGAGG 0: 3
1: 13
2: 48
3: 100
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119257229 Original CRISPR CATGGGAGGGAGACTGAGGA GGG (reversed) Intronic
900034046 1:392243-392265 CATGGGATGGAGAGAAAGGAGGG - Intergenic
900054882 1:622133-622155 CATGGGATGGAGAGAAAGGAGGG - Intergenic
900146319 1:1160401-1160423 CAAGGGAGGGAGACAGTAGAGGG + Intergenic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900481240 1:2900443-2900465 CATGGGAGGGGTGATGAGGAGGG + Intergenic
900618362 1:3575768-3575790 CATGGGAGGGACCCAGTGGAAGG - Intronic
900822402 1:4899665-4899687 CCTGGGAGGCAGAGTGAGGAGGG - Intergenic
900887957 1:5428858-5428880 GGAGGGAGGGAGACAGAGGAAGG + Intergenic
901094191 1:6665173-6665195 CTTGGGAGGCAGACGAAGGAGGG - Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901974034 1:12930252-12930274 CATGGGAGGGAGGCTGAGAGGGG + Intronic
902011146 1:13271516-13271538 CATGGGAGGGAGGCTGAGAGGGG - Intergenic
902066191 1:13690159-13690181 TATGGGAGGGAACCTGTGGAAGG - Intergenic
902094518 1:13931947-13931969 CTTGGGAGGGAGGTTGAGGCAGG - Intergenic
902153365 1:14462834-14462856 CATGGGAGGGAGCCTGCAGGAGG - Intergenic
902238514 1:15073373-15073395 CATGGGGCAGAGACTGAGGGTGG + Intronic
902384529 1:16068786-16068808 GATGGGAGGGAGCCTGGGGAAGG - Intronic
902623792 1:17665154-17665176 CCTGGGCGGGAGACTCAGCATGG + Intronic
902656002 1:17868853-17868875 AATGGGAGTGAGACTGTGTAGGG + Intergenic
902714012 1:18260186-18260208 AACAGGAGGGACACTGAGGATGG + Intronic
902729067 1:18356917-18356939 TAGGGGATGGAGATTGAGGATGG + Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903229137 1:21911391-21911413 CAGGGAAGGGTGACAGAGGAGGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904118093 1:28176939-28176961 CATGAGAGTGAGAAAGAGGAGGG + Exonic
904259499 1:29280238-29280260 CCTGCGTGGGAGACTGAGGGAGG - Intronic
904532599 1:31179477-31179499 CAGGGCCGGGAGGCTGAGGAAGG - Intergenic
904591265 1:31616827-31616849 CAGGGGAGGGAGACTGTGTCTGG + Intergenic
904674057 1:32187378-32187400 CATGGGAGGGGAACTGAGCTGGG + Intronic
904775947 1:32906629-32906651 CATGTGAAGGCCACTGAGGATGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904880011 1:33689212-33689234 CTGGGGTGGGAGAATGAGGAAGG + Intronic
904945338 1:34195057-34195079 CATGGGAAGGAGGCAAAGGAAGG + Intronic
905337916 1:37258082-37258104 ATTGGCAGGCAGACTGAGGAAGG + Intergenic
905491116 1:38344544-38344566 CATAGGAGGGAGGCTGAAGTAGG + Intergenic
905787211 1:40767731-40767753 TTTGGGAGGGAGGCTGAGGCAGG + Intronic
905868888 1:41391731-41391753 CAGGGGAGGAAGACAGAGGTGGG + Intergenic
906102010 1:43270025-43270047 CATTTGAGGGAGAATGAGCACGG + Exonic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
906813245 1:48850761-48850783 AATGGGTGGGAGGCTGAGGCGGG - Intronic
906848298 1:49218779-49218801 CATGGGAGGGACACAGCGGGAGG + Intronic
906959355 1:50407230-50407252 TTTGGGAGGGAGGCCGAGGAGGG + Intergenic
907241315 1:53082548-53082570 CATGGGAGAGTGAGTGAGGGGGG + Intronic
907526962 1:55059378-55059400 CCTGGCAGGGACACTGATGAGGG + Intronic
908348182 1:63257542-63257564 CAGGAGAGAGAGACTGGGGAGGG - Intergenic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908613955 1:65896389-65896411 CATGGGAGGGACACAGTGGGAGG - Intronic
908831217 1:68180429-68180451 GTTGGGAGGGAAACTGAGGCAGG + Intronic
908983485 1:69987131-69987153 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
909266098 1:73559410-73559432 CATGGGAGGGACCTGGAGGAAGG + Intergenic
909296365 1:73954290-73954312 GATGGACGGGAGACAGAGGAAGG - Intergenic
909385659 1:75053404-75053426 CACTGGAGGGATACTGAAGAAGG + Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
909779491 1:79525102-79525124 CATGGGAGAGAGACTGAAATGGG - Intergenic
910831821 1:91469068-91469090 CATGGGAGAAAGACAGAGGCTGG + Intergenic
911025908 1:93435277-93435299 CATGGGAGGGAGGCTGAGAGGGG - Intergenic
911419366 1:97620324-97620346 CTTAGGAGGGAGGCTGAGGCTGG - Intronic
912013791 1:105005796-105005818 CATGGGAGGGAGCCTCAGGTGGG - Intergenic
912161666 1:106992987-106993009 GAAGGGAGGGAGACGGATGAGGG + Intergenic
912332489 1:108832329-108832351 CTTGGAAGGGAGGCTGAGGTGGG - Intronic
912376566 1:109214221-109214243 CCTGGGAGGGGGTCTGACGAAGG - Intronic
912474929 1:109929151-109929173 CATGGAAGGGAGTGAGAGGAGGG - Exonic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
912752601 1:112298148-112298170 CATTGGAGGGAAGCTGAGCAAGG + Intergenic
912803282 1:112735242-112735264 CTTGGGAGGCTGAGTGAGGAAGG + Intergenic
912927096 1:113922826-113922848 CTTGAGAGGGAGGCTGAGGTTGG - Intergenic
913251182 1:116912912-116912934 CATGGTAGGTAGGCTTAGGAAGG - Intronic
913459613 1:119070371-119070393 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
914197847 1:145459155-145459177 GAAGGGAGGGAGAGAGAGGAAGG + Intergenic
914353254 1:146858436-146858458 CAGGGTAGGGAGAATAAGGAAGG + Intergenic
914476950 1:148032279-148032301 GAAGGGAGGGAGAGAGAGGAAGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915284190 1:154842430-154842452 CATGGCTGGGACACTCAGGAAGG - Intronic
915388321 1:155517519-155517541 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
915525475 1:156473475-156473497 CATGTGAGAGAACCTGAGGAAGG + Intronic
915537940 1:156548780-156548802 CATGGGAGGGACTCGGGGGAAGG - Intronic
915551673 1:156638840-156638862 CAGGGGAGGGAGAAAGAGGGAGG - Intergenic
915637383 1:157196036-157196058 CAGGGGAGGGAGGCTGAGATGGG + Intergenic
915786892 1:158623487-158623509 CATGGGAGGGAGCCAGTGGGAGG + Intronic
915859674 1:159430732-159430754 GATGGGAAGGAGACAGAAGAAGG + Intergenic
916120066 1:161521599-161521621 CATGGGAGGGACCCAGTGGAAGG + Intronic
916129827 1:161603248-161603270 CATGGGAGGGACCCAGTGGAAGG + Intronic
916197108 1:162234787-162234809 CATGGGAGTGGGAGTGAGGGTGG - Intronic
916526137 1:165611363-165611385 CCCGGGAGGGAGGCTGAGGCAGG - Intergenic
916949015 1:169759902-169759924 CATGGGAGGGACCCTGTGGGAGG - Intronic
917009164 1:170451535-170451557 CATTAGTGGGAGGCTGAGGAAGG + Intergenic
917107182 1:171503982-171504004 CATGGGAGGGACTCGGTGGAAGG - Intronic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917376264 1:174351052-174351074 CATGAGAGGGAGACCGTGGGGGG + Intronic
917626376 1:176850678-176850700 CCTGGGAGGGAGAATGAGCCAGG + Intergenic
917633752 1:176915983-176916005 CATGGGTGAAAGACTGAGAATGG - Intronic
917848860 1:179043150-179043172 CATGGGAGGGAGGCCAAGGGAGG - Intronic
918237878 1:182597947-182597969 TGAGGGAGGGAGGCTGAGGAGGG - Intergenic
918590907 1:186240194-186240216 CTTGGGAGAGAGGCTGAGGTGGG - Intergenic
918642836 1:186864006-186864028 TTTGGGAGGGAGGCCGAGGAAGG - Intronic
919253841 1:195096366-195096388 CATGGGAGGGAGCCTGAAGGGGG + Intergenic
920070028 1:203296129-203296151 CCTGGGAGTGAGGATGAGGAGGG + Intergenic
920278905 1:204828859-204828881 CAGGGGATGGAGACAGACGAGGG - Intronic
920538642 1:206759955-206759977 GATTGGTGGGAGGCTGAGGAAGG + Intergenic
920790327 1:209083912-209083934 CATGGCAAGGAAACTGAGCATGG + Intergenic
920844015 1:209578284-209578306 CATGGGAGGGACCCAGTGGAAGG + Intergenic
921031786 1:211340587-211340609 GTTGGGAGGGAAACTGAGGCAGG + Intronic
921202744 1:212822955-212822977 GATGGGAGGGAAAGAGAGGAAGG - Intergenic
921386066 1:214571082-214571104 AATGGGAGGGAGAGTGGAGATGG + Intergenic
921399622 1:214707222-214707244 CATGGGAGGGACCCAGTGGAAGG + Intergenic
921584031 1:216927336-216927358 CAAGGGAGGGAGCCTGAAGACGG + Intronic
921706023 1:218323710-218323732 CATGAGAGGGAGGCCGAGGTGGG - Intronic
921709474 1:218359072-218359094 AACGAGAGGGAGACAGAGGAAGG + Intronic
921754354 1:218836794-218836816 CTCGGGAGGGAGGCTGAGGCAGG - Intergenic
922012466 1:221604476-221604498 CATGGGAGGGGCCCTGAGGGAGG + Intergenic
922113322 1:222584274-222584296 CATTGGAGGGAAAAGGAGGAAGG - Exonic
922256400 1:223896407-223896429 CATGGGATGGAGAGAAAGGAGGG - Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922625578 1:227038097-227038119 CATGGGAGGGACACAGTGGGAGG + Intronic
922794037 1:228330279-228330301 CAGGGAAGGGAAACTGAGGTAGG - Intronic
922873287 1:228920354-228920376 CATGGCTGGGAGACTGGGTAAGG - Intergenic
922983924 1:229851406-229851428 CCTGGGAGGGAGACAGGGGCTGG - Intergenic
923084734 1:230694785-230694807 CATGGGAGAGAGACAGAGAAGGG + Intergenic
923109507 1:230879742-230879764 CAGGGCAGGGTGATTGAGGAGGG - Intergenic
923385980 1:233465687-233465709 CATGAATGGGAGACTGAGGTGGG + Intergenic
923479744 1:234373104-234373126 CCTGGGAGGCAGGCTGAGGTGGG + Intergenic
923848154 1:237761001-237761023 CTTGGGATGGTGACAGAGGAAGG + Exonic
924275760 1:242385277-242385299 GTTGGGAGGGAAACTGAGGCAGG + Intronic
924298640 1:242614289-242614311 CTCTGGAGGGAGACTGAGGCTGG - Intergenic
924337608 1:242999266-242999288 CGTGGGATGGAGAGAGAGGAGGG - Intergenic
924430294 1:243990699-243990721 CATGGGAGGGACACAGTGGGAGG - Intergenic
1062902396 10:1156214-1156236 CATGGGGCGGAGCCTGAGGGTGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063493071 10:6482911-6482933 CATGGGAGGGACCCAGTGGAAGG - Intronic
1063542713 10:6950536-6950558 CATGGGAGGGACCCAGTGGAAGG - Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1065794970 10:29298380-29298402 CAGAGGAGGGACACTGAGGTTGG - Intronic
1065976515 10:30847005-30847027 CATGGAAGGGAGGCTGAGGAAGG + Intronic
1066364342 10:34762403-34762425 GATGGGAGGAAGGCTGAGGTGGG - Intronic
1066581886 10:36890436-36890458 CCTGGGAGGGAGGCTGAGATGGG - Intergenic
1067222194 10:44352413-44352435 TTTGGGAGAAAGACTGAGGAGGG + Intergenic
1067438186 10:46293632-46293654 CATAGAAGGGAGAGTCAGGATGG - Intronic
1067509616 10:46884293-46884315 CCTGTGAGGGTGACTGAGGTGGG + Intergenic
1067652638 10:48167565-48167587 CCTGTGAGGGTGACTGAGGTGGG - Intronic
1067973469 10:50996923-50996945 AAGGGGAGGAAGGCTGAGGAAGG + Intronic
1068198700 10:53753420-53753442 CATGGGAGGGACACAGTGGGAGG - Intergenic
1068252203 10:54456756-54456778 CATGGGAGGGACACAGTGGGAGG + Intronic
1068283726 10:54909369-54909391 CCTGGGAGGGAGGCTGAGACAGG - Intronic
1068605983 10:59005517-59005539 CTTTGGAAGGAGACTGAGGCTGG - Intergenic
1068842377 10:61629955-61629977 GCTGGGAGGGAGACTGAGGCCGG + Intergenic
1068924929 10:62526537-62526559 CATGGGAGGGACACAGTGGGAGG - Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069313548 10:67069323-67069345 CATGTAAGGGAGACTTTGGAAGG - Intronic
1069339724 10:67396760-67396782 CATGGGAGGGACACGGTGGGAGG + Intronic
1069561824 10:69436051-69436073 CCTGGGAGGGAGGCTGAGGTGGG - Intergenic
1069617306 10:69814273-69814295 AAAGGGAGGGTGAGTGAGGAGGG - Intronic
1070612796 10:77945400-77945422 TTTGGGAGGGAGGCTAAGGAAGG + Intergenic
1070846337 10:79525109-79525131 CCTGTGTGGGAGACTGTGGAGGG - Intergenic
1070927460 10:80235197-80235219 CCTGTGTGGGAGACTGTGGAGGG + Intergenic
1071052902 10:81473256-81473278 CATGGGACGGAGGCCAAGGAGGG + Intergenic
1071266339 10:83968133-83968155 CATGGGAGGGAGTCAGTGGGAGG - Intergenic
1071440863 10:85692553-85692575 CACAGGAGGGAGGCTGAGGTGGG + Intronic
1071533224 10:86404976-86404998 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1071673386 10:87632516-87632538 CATGGGAGGGAGCTGGTGGAAGG - Intergenic
1071905055 10:90163840-90163862 CATGGCACGGTGACAGAGGAAGG + Intergenic
1072407913 10:95171657-95171679 CCTGTGTGGGAGACTGTGGAGGG - Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072634318 10:97167724-97167746 CATGGGAGGGAGCCGGTGGGAGG + Intronic
1072871387 10:99124519-99124541 CACAGGAGGGAGCCTGAGGGAGG - Intronic
1073649647 10:105344614-105344636 CATGGTAGGGAGGGTGAGGGTGG + Intergenic
1074203403 10:111259510-111259532 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1074243346 10:111661956-111661978 GATGGGCGGGAGGCAGAGGAAGG + Intergenic
1074296096 10:112191064-112191086 TCTAGGAGGGAGAGTGAGGAGGG + Intronic
1074312859 10:112337400-112337422 GATGGGAGGGCCACAGAGGAAGG + Intergenic
1075034449 10:119052480-119052502 CTTGGGAGGCTGACTGAGGTGGG - Intronic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075704033 10:124488264-124488286 CATGGGAGGTAGACACAGAAGGG - Intronic
1076125042 10:127967351-127967373 CATGGGAGGGACCCTGTGGGAGG + Intronic
1077067829 11:651638-651660 CTTTGAAAGGAGACTGAGGAGGG + Intronic
1077558054 11:3236079-3236101 CAAGAGAGGGAGGCTGAGGTGGG + Intergenic
1077643750 11:3905034-3905056 TTAGGGAGGGAGCCTGAGGAGGG + Intronic
1077733700 11:4765218-4765240 CATGGCAGAGAAACTGAGGAAGG + Intronic
1077912681 11:6586951-6586973 CATAGGAGGGAAGCTGAGGGAGG + Intronic
1077933671 11:6760122-6760144 CATGGGTGGGGGACTGGGGGAGG - Intergenic
1077938805 11:6818192-6818214 CATGGGAGGGGGACTGAGGTAGG + Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078316398 11:10296510-10296532 CATGGGAGGGATCCGGTGGAAGG - Intergenic
1078423745 11:11233042-11233064 AAATAGAGGGAGACTGAGGATGG + Intergenic
1078592434 11:12655372-12655394 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1079015394 11:16864557-16864579 CATGGGAGGGACCCAGTGGAAGG + Intronic
1079347619 11:19667004-19667026 GGTGGGAGGGAGGCTGGGGAGGG - Intronic
1080041188 11:27761169-27761191 CCAGGGAGTCAGACTGAGGAAGG - Intergenic
1080414920 11:32060537-32060559 CTTAGGAGGGAGGCTGAGGCAGG + Intronic
1080876164 11:36276228-36276250 CGTGGCAGAGAGACTGTGGAAGG + Exonic
1081268538 11:41057337-41057359 CATAGGAGGGAAGCTGAGCAGGG + Intronic
1081284055 11:41246210-41246232 CCTGGGAGGGAGGCTGGAGAGGG - Intronic
1081437019 11:43038266-43038288 CACTGGATGGAGACTGGGGAAGG - Intergenic
1081767439 11:45621411-45621433 CATGGGAGGGAGGCTGAGGTGGG - Intergenic
1082099710 11:48162392-48162414 AAAGGGAGGGAGAGGGAGGAGGG - Intronic
1082217733 11:49595192-49595214 CATGGGAAGGAGAACAAGGAGGG + Intergenic
1082687748 11:56260614-56260636 CATGGGAGGGAGGCTGTGGGGGG - Intergenic
1082792765 11:57358677-57358699 CATGTGTGGGTGTCTGAGGAAGG + Intronic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083335547 11:61919695-61919717 AGAGGGAGGGAGGCTGAGGAGGG - Intronic
1083506143 11:63159343-63159365 CATGGGAGGGAGCCTGTGGGAGG + Intronic
1083519230 11:63292319-63292341 CATGGGAGGGAGCCAGTGGGAGG - Intronic
1083675945 11:64324684-64324706 CTGGGGAGGGAGGCTGAGGCAGG + Intergenic
1083784945 11:64939207-64939229 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1083857700 11:65401311-65401333 CTGGGGAGGGAGGCTGGGGAGGG - Intronic
1083857706 11:65401324-65401346 CAGGGGAGGGAGGCTGGGGAGGG - Intronic
1083857712 11:65401337-65401359 CAGGGGAGGGAGGCAGGGGAGGG - Intronic
1083857718 11:65401350-65401372 CAGGGGAGGGAGGCAGGGGAGGG - Intronic
1083857729 11:65401376-65401398 CAGGGGAGGGAGGCTGGGGAGGG - Intronic
1083916031 11:65744300-65744322 CATGGGAGGGAGGCCAAGGCGGG + Intergenic
1084016316 11:66384584-66384606 CTTGGGAGGGAGACAGAGGCGGG + Intergenic
1084162648 11:67358325-67358347 CAGTGGAGGGAAACAGAGGAGGG - Intronic
1084231328 11:67755541-67755563 TTTGGGAGGGAGGCTGAGGGAGG + Intergenic
1084372081 11:68751105-68751127 CAGGGGAGGGAGTCAGGGGAGGG + Intronic
1084479397 11:69409989-69410011 CGTGGGAAGGAGAGTGGGGAGGG - Intergenic
1084953065 11:72677288-72677310 CCAGTGAGGGAGACAGAGGAGGG - Intergenic
1085321024 11:75574075-75574097 CATGGTAGAGAAACTGAGGTGGG - Intergenic
1085399893 11:76229671-76229693 GGAGGGAAGGAGACTGAGGAGGG + Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085496827 11:76978041-76978063 CATGGGAGGGAGGCCGAGGCGGG + Intronic
1085732238 11:79009884-79009906 CATGGGAGGGACCCTGTGGGAGG + Intronic
1085906421 11:80769622-80769644 CATGGGAGGGACACTGTGGGAGG + Intergenic
1086111788 11:83207237-83207259 CATGGGAGGGACACAGTGGGAGG - Intronic
1087093756 11:94300716-94300738 CTCGGGAGGGAGGCTGAGGTGGG + Intergenic
1087251215 11:95902574-95902596 AATGGGAGGTAGAATGAGAAGGG - Intronic
1087453462 11:98353589-98353611 CATGGGAGGGAGATTGAGGGAGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088367197 11:109052255-109052277 CATGGGAGGGAGTCCAGGGATGG - Intergenic
1088470538 11:110184352-110184374 CATGTCAGGGAGACAGAGGCTGG - Intronic
1088702003 11:112421805-112421827 CCAGGGAGGGAAACTGAGGCTGG + Intergenic
1088735818 11:112726949-112726971 GATGCGAGGGAGGCTGAGGAAGG - Intergenic
1088741375 11:112770119-112770141 CATGAGGGTCAGACTGAGGACGG + Intergenic
1088763918 11:112958632-112958654 CATGGGATTGAGGCAGAGGAAGG - Intergenic
1088866633 11:113853765-113853787 CTTGGGAGGCTGACTGAGGTGGG + Intronic
1088931643 11:114357378-114357400 GTTGGGAGGGAAACTGAGGCAGG + Intergenic
1088976851 11:114823375-114823397 GACGGGATGAAGACTGAGGAAGG - Intergenic
1089606542 11:119644730-119644752 CATTGTAGGCAGAGTGAGGAGGG + Intronic
1089776505 11:120840598-120840620 CCTGGCAGGTAGACTGAGGCAGG + Intronic
1089798637 11:121004942-121004964 CCTGGGAGGGAAGCTGAGGTGGG - Intergenic
1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091302212 11:134514883-134514905 CGTGGCAGTGAGGCTGAGGAGGG + Intergenic
1091366515 11:135025407-135025429 CATTGGAGGGAGGCAGATGATGG + Intergenic
1091583050 12:1800327-1800349 CATGCGAGGGTGGCTTAGGAGGG - Intronic
1091724392 12:2835329-2835351 CCTGGGAGGGATGCAGAGGAGGG - Intronic
1091960562 12:4690596-4690618 CCCAGGAGGGAGACTGAGGCAGG + Exonic
1092409993 12:8245329-8245351 GATTGGAAGCAGACTGAGGAAGG + Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092479106 12:8844223-8844245 GTTGGGAGGGAGAGTGGGGAGGG + Intronic
1092502944 12:9065557-9065579 CGTGGGAGGGAGGCTGAGAGGGG + Intergenic
1092692684 12:11131186-11131208 CATGGAAGAGAGAGAGAGGAGGG - Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092918254 12:13207672-13207694 GCTGGGTGGGAAACTGAGGAAGG - Intronic
1093302318 12:17472230-17472252 GTTGGGAGGGAAACTGAGGCAGG + Intergenic
1093348810 12:18071475-18071497 GTTGGGAGGGAGACTGAAGCAGG + Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094181153 12:27593869-27593891 GATGGGAGGGAGAAAGTGGATGG + Intronic
1094401368 12:30063939-30063961 GTTGGGAGGGAAACTGAGGCAGG + Intergenic
1094595286 12:31859940-31859962 CATGGGAGGGACCCTGTGGGAGG - Intergenic
1095149238 12:38771351-38771373 GCTAGGAGGGAGACTGAGGTGGG + Intronic
1095712497 12:45305707-45305729 CATGTGATTGAAACTGAGGATGG + Intronic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1096058663 12:48677671-48677693 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1096330449 12:50707809-50707831 CATGGGAGGGAGGATGAAGTTGG - Intronic
1096748923 12:53746562-53746584 AATGGAAGGGAGGCTGAGGAGGG + Intergenic
1096877954 12:54645119-54645141 CAAGGGGTGGAGACTGAGGCTGG + Intronic
1097003888 12:55901204-55901226 CTCGGGAGGGAGGCTGAGGCAGG + Intergenic
1097129192 12:56797836-56797858 CATGTTGGGGAGGCTGAGGAGGG + Intergenic
1097142101 12:56910269-56910291 CATGGGAGGGACCCAGTGGAAGG + Intergenic
1097174778 12:57136229-57136251 CAGGGGAGGGAGGCTGAAGGGGG + Intronic
1097191797 12:57222832-57222854 GATGGGAGGGGGAATGAGGGGGG + Intronic
1098279437 12:68848015-68848037 CATGCATGGGAGACTGAGGTGGG + Exonic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098790528 12:74816740-74816762 CATGGGAGGGAGGCTGAGGTGGG + Intergenic
1098876039 12:75867406-75867428 GCTGGGAGGAAGAGTGAGGAGGG - Intergenic
1098964544 12:76772966-76772988 CTCGGGAGGGAGGCTGAGGCAGG - Intronic
1099463718 12:82956559-82956581 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1100189709 12:92177347-92177369 GAGGGAAGGGAGGCTGAGGAAGG + Intergenic
1100664632 12:96737938-96737960 CATGGAAGGCAGGCTGGGGATGG + Intronic
1100928988 12:99584873-99584895 CATGGGAGGGACCCAGTGGAAGG - Intronic
1100941790 12:99731046-99731068 TTTGGGAGGGAGGCTGAGGCAGG - Intronic
1101684348 12:107002738-107002760 CATGGGAGGGACCCTGTGGGAGG + Intronic
1102041123 12:109801334-109801356 CATGGGAGGGACCCTGTGAAAGG + Intronic
1102136627 12:110581541-110581563 CATGAGAGGGAGACTTAGAAAGG - Intronic
1102274933 12:111574533-111574555 CTTGGGAGGCTGACTCAGGAGGG - Intronic
1102295877 12:111736296-111736318 CCTGGGAGGGAGGCTGAGACAGG - Intronic
1102727103 12:115075293-115075315 CATTTGAGGGAGAGAGAGGAGGG - Intergenic
1103617277 12:122162323-122162345 CATGGCAGGGATGCTGAGGCTGG + Intergenic
1103972120 12:124678892-124678914 CAGGGGAGGGAGGAAGAGGAGGG - Intergenic
1104003072 12:124872838-124872860 CTCGGGAGGGAGGCTGAGGCAGG - Intronic
1104133104 12:125913596-125913618 AATGGGAGTGTGACTGGGGAAGG - Intergenic
1104140033 12:125979125-125979147 CAAGAGAGAGAAACTGAGGAAGG + Intergenic
1104353530 12:128065687-128065709 CATGGGAGGGACCCAGTGGAAGG + Intergenic
1104438850 12:128778736-128778758 CATGGGAGGGACTCTGTGGGAGG - Intergenic
1104742480 12:131188630-131188652 CATGGGAGGGAGGCTGAGGGGGG + Intergenic
1105324168 13:19355176-19355198 CATGGAAGGTAGAATCAGGAAGG + Intergenic
1105655010 13:22427222-22427244 CTTTGGAGGGTGACTGAGCAGGG - Intergenic
1105862960 13:24433067-24433089 GTTGGGAGGGAAACTGAGGCAGG + Intronic
1105867384 13:24473166-24473188 GTTGGGAGGGAGGCTGAGGTAGG - Intronic
1105869093 13:24488228-24488250 CATGGAAGGTAGAATCAGGAGGG - Intronic
1106265458 13:28105579-28105601 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1106442623 13:29790874-29790896 ACTGGGAGAGAGACTGATGAGGG - Intronic
1106475536 13:30095096-30095118 CATGGGAGGGACACTGTGGGAGG + Intergenic
1106585286 13:31051865-31051887 CATGAGTGGGTGACTGAGAAAGG - Intergenic
1107312479 13:39093929-39093951 GTTGGGAGGGAAACTGAGGCAGG + Intergenic
1107451356 13:40512928-40512950 CATGGGATGGAGCTTGAGCAAGG - Intergenic
1108287623 13:48924458-48924480 CTCGGGAGGGAGGCTGAGGTGGG - Intergenic
1108536247 13:51382967-51382989 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1108705764 13:52984499-52984521 CATGGGAGGGAGCTGGTGGAAGG - Intergenic
1108844396 13:54660145-54660167 CATGTGAGGGAGACTGAGGGAGG - Intergenic
1108868596 13:54952963-54952985 CTTGGGAGGGAGGCTGAGGTGGG + Intergenic
1108984141 13:56561664-56561686 CAGGGGCGGGAGTGTGAGGAAGG + Intergenic
1109345835 13:61113666-61113688 CACAGGAGGAAGGCTGAGGAGGG + Intergenic
1109470602 13:62799332-62799354 CATGGGAGGGAGTTTGAGGAGGG + Intergenic
1109606485 13:64704693-64704715 GTTGGGAGGGAAACTGAGGCAGG - Intergenic
1109687748 13:65843643-65843665 CATGGAAGGGAGACAGAGGTTGG + Intergenic
1109762249 13:66845254-66845276 CATGGGAGGGAGGCTGAAGTGGG - Intronic
1109850398 13:68056070-68056092 CATGGGAGGGACCCAGTGGAAGG + Intergenic
1109982256 13:69924116-69924138 CATGGGAGGGAGGCCAAGGAGGG + Intronic
1110342682 13:74411783-74411805 CATGGGAGGGACTCTGTGGGAGG + Intergenic
1110342892 13:74413708-74413730 CATGGGAGGGAGGCTGAGGCAGG + Intergenic
1110776399 13:79412931-79412953 CTTGGAAGGGAGGCTGAGGCAGG + Intergenic
1110777953 13:79432320-79432342 CATGGGAGGGAGGCCAAGGAGGG + Intergenic
1110892556 13:80708188-80708210 CATGGCAGCGAGACTGGGGGAGG - Intergenic
1111206080 13:85013102-85013124 CATGGTAGTGAGCCTGTGGAGGG - Intergenic
1111253626 13:85638867-85638889 CATGGGAGGGAGGCTGAAGGGGG - Intergenic
1111268780 13:85853592-85853614 CATGGGAGGGATGCTGGGTAAGG + Intergenic
1111360408 13:87168295-87168317 CACGGGAGGGAGGGTGAGGTGGG - Intergenic
1111485658 13:88895707-88895729 CATGGGAGGGAGGCCAAGGCAGG + Intergenic
1112178711 13:97054837-97054859 CATGGGAGCGAGGCTGGGGGAGG - Intergenic
1112279846 13:98053347-98053369 CTTGGGAGGCAGGCTGAGGTGGG - Intergenic
1112605699 13:100903960-100903982 CATGGGAGGAATACTTATGAAGG - Intergenic
1112638525 13:101245143-101245165 CAGGGGCTGCAGACTGAGGAGGG - Intronic
1112641372 13:101279407-101279429 CATTGGAAGAAGAATGAGGAAGG + Intronic
1112917935 13:104574059-104574081 CATGGGATGGAGAGTGAGGGAGG + Intergenic
1113497679 13:110744808-110744830 CATGGGAGGGACCCAGAGGAAGG - Intergenic
1113560021 13:111271319-111271341 GATGGGTGGGGAACTGAGGAGGG - Intronic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1113807702 13:113119109-113119131 CATGGGAGGGAGGGAGAGGTGGG + Exonic
1113834630 13:113320545-113320567 CATGGGAGGCAGCGTTAGGAAGG + Intronic
1113861858 13:113491515-113491537 CCAGGGAGGGAGAGAGAGGAGGG - Intronic
1114082840 14:19216425-19216447 CTTGGGAGGGAGGCTGAGGTGGG + Intergenic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114318206 14:21525887-21525909 GAAGGGAGGGTGGCTGAGGAGGG - Intronic
1114555949 14:23562472-23562494 CATTGGGGGTACACTGAGGAGGG - Intronic
1114672541 14:24419161-24419183 CCAGGGAGGGAGAGTGAGGCTGG - Exonic
1114927353 14:27421066-27421088 CATGGGAGGGAAATTGTGGGAGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1115718309 14:36130305-36130327 CATGGGAGGGAGCCTGTGGGAGG + Intergenic
1115942895 14:38628590-38628612 CATGGGAGGGAACCAGTGGAAGG - Intergenic
1116232442 14:42234867-42234889 GATGGGGGGCAGACAGAGGATGG - Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1117733977 14:58751140-58751162 CATGGGAGGGAGCCTGAGTGGGG + Intergenic
1118187894 14:63554242-63554264 CTTGGGAGGCTGACTGAGGCAGG - Intergenic
1118200141 14:63663820-63663842 CATGGGAGGGAGGCTGAGTGGGG - Intergenic
1118331425 14:64818619-64818641 GAGGAGAGGGAGACAGAGGATGG + Intronic
1118454447 14:65931887-65931909 CAGCTGAGAGAGACTGAGGAAGG + Intergenic
1118734579 14:68692146-68692168 GATGAGAGGGAGACTGGGGGCGG - Intronic
1118776266 14:68976268-68976290 CAGGGGAGTGAGTGTGAGGAGGG - Intronic
1119036135 14:71231619-71231641 CACTGGAGGGAGGCTGAGGGGGG + Intergenic
1119257229 14:73208932-73208954 CATGGGAGGGAGACTGAGGAGGG - Intronic
1119326833 14:73764836-73764858 CAGGGCAGGGAGGCTGGGGAGGG - Intronic
1119657809 14:76430023-76430045 CATGGGAGGGAGGGTAGGGAAGG - Intronic
1119757873 14:77131550-77131572 AATGGGAGGGAGAGGGAGGAGGG - Exonic
1119758787 14:77137155-77137177 CATGGGAGGGAAAGAAAGGAAGG + Intronic
1119835076 14:77742141-77742163 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1120255767 14:82117484-82117506 TATGAGAGGGAGATGGAGGAAGG + Intergenic
1120339830 14:83204911-83204933 CATGTTAGGGAGGCTGAGGCAGG - Intergenic
1120856399 14:89216509-89216531 GCAGGGAGGGAGACTGAGGCAGG - Intronic
1120990494 14:90372669-90372691 TTTGGGAGGGAGGCTGAGGCGGG - Intergenic
1121098272 14:91233063-91233085 AGGGGAAGGGAGACTGAGGAAGG + Exonic
1121318441 14:92975853-92975875 CATGGGAGGGAGCCGGTGGGAGG + Intronic
1121432867 14:93899860-93899882 CTAGGGAGGGAGAGGGAGGAGGG + Intergenic
1121549628 14:94789051-94789073 CTTGGGAGGGAGGCTGAGGCAGG - Intergenic
1121650790 14:95556329-95556351 CACAGTAGGGAGACTGCGGAGGG + Intergenic
1121905235 14:97735219-97735241 CTAGGGAGGGAGGCTGAGGCAGG - Intergenic
1122070475 14:99202602-99202624 GATGGGAGGGAGAGAGAGGGAGG + Intronic
1122090857 14:99339260-99339282 CATGACAGGGACACTGGGGACGG - Intergenic
1122288601 14:100667561-100667583 CGTAGGAGGGAGACTGAGGCTGG + Intergenic
1122370025 14:101224554-101224576 CAGGGAAGGGACACTGAGGCAGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122579417 14:102762273-102762295 CTTTGGGGGGAGGCTGAGGATGG + Intergenic
1122651800 14:103230498-103230520 CATGGCAGGTAGACTCAGTAAGG - Intergenic
1122762445 14:104039257-104039279 CATGGGAGGGACCCTCTGGAAGG - Intronic
1122935122 14:104952340-104952362 CATGGAGGGGAGACTCAGGTCGG + Exonic
1122956681 14:105074582-105074604 CAGGGGAGGGTCTCTGAGGAGGG - Intergenic
1123147120 14:106142682-106142704 CATGGTGTGGACACTGAGGAAGG + Intergenic
1123162622 14:106293930-106293952 CATGGTGTGGATACTGAGGAAGG + Intergenic
1123223690 14:106879968-106879990 CATGGTGTGGACACTGAGGAAGG + Intergenic
1202909593 14_GL000194v1_random:104625-104647 CACAGGAGGGAGGCTGAGGTGGG + Intergenic
1123410790 15:20057138-20057160 CATGGTGGGGATGCTGAGGAGGG - Intergenic
1123446657 15:20335754-20335776 CAGGGGTGGGGGACTGGGGAAGG - Intergenic
1123520120 15:21063844-21063866 CATGGTGGGGATGCTGAGGAGGG - Intergenic
1123583016 15:21732402-21732424 CATGGTGTGGACACTGAGGAAGG + Intergenic
1123619666 15:22174999-22175021 CATGGTGTGGACACTGAGGAAGG + Intergenic
1123756417 15:23400752-23400774 CTTGGGAGGCTGAGTGAGGAGGG + Intergenic
1123763032 15:23447039-23447061 CATGGGAGGGGGCCTGGGGCTGG + Intronic
1123918039 15:25051709-25051731 CATGGGTGGGAGAGTGATGGGGG + Intergenic
1124030568 15:26007149-26007171 CCAGGCAGGGAGACTGATGAGGG - Intergenic
1124218900 15:27832437-27832459 CGGGGGAGGGAGACTGTAGATGG - Intronic
1124231859 15:27952788-27952810 CTGGGGAGGGAGGCTGAGGTAGG - Intronic
1124619834 15:31267337-31267359 CATGGGTTGGAGACTGAGTTGGG + Intergenic
1124793671 15:32754306-32754328 CCCAGGAGGGAGACTGAGGCAGG + Intergenic
1124820806 15:33044166-33044188 CATGGGATGGAGGCTGAGGAGGG + Intronic
1124838770 15:33221962-33221984 CTTGGGAGGCTGACTGAGGTGGG + Intergenic
1125231395 15:37461558-37461580 CATGGGAGGGACCCAGTGGAAGG - Intergenic
1125299416 15:38238578-38238600 CATGGAAGGGAGGCTGTGGCAGG + Intergenic
1125497664 15:40212177-40212199 CATGGAAGTGAGGCTGAGGGTGG - Intronic
1125703493 15:41709724-41709746 TATGAGAGTGAGACTGAGCACGG - Intronic
1125968715 15:43894676-43894698 CAGGGGAGGGAGGCAGCGGAGGG + Intronic
1126165891 15:45653572-45653594 CTTGGGAGGGAGAATGGGGCTGG - Intronic
1126215172 15:46146219-46146241 CATGGCAGGGAGGTTGAGGTGGG + Intergenic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127305372 15:57700476-57700498 CGTGGGAGGGAGGCTGAGGTGGG + Intronic
1127567393 15:60205175-60205197 CCTGGGAGGCAGGCTGAGCAAGG + Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128057687 15:64712854-64712876 CTTGGGAGGGAGGCTGAGGCAGG - Intergenic
1128470864 15:67951327-67951349 CATGGGAGGGACCCTGTGGGAGG + Intergenic
1128849246 15:70935205-70935227 CATGGGAGTGGGCCTGAGAATGG + Intronic
1129153199 15:73702209-73702231 CATATAAGGGGGACTGAGGAGGG - Intronic
1129673986 15:77622482-77622504 CTGGGGAGGGAGACTCAGAAAGG + Intronic
1129818389 15:78576685-78576707 GATAGGAGGGAGGCTGAGGTGGG + Intronic
1129843630 15:78758393-78758415 CAGGGGCGGGAGGCTGGGGAAGG - Intergenic
1129854011 15:78811469-78811491 AAAGGGAGGGAGAGTGAGGGAGG + Intronic
1129960556 15:79680842-79680864 CCTCGTAGTGAGACTGAGGATGG - Intergenic
1129978594 15:79845928-79845950 AATGGGAGGGGAAATGAGGAGGG - Intronic
1130060073 15:80563389-80563411 CATGGGAGGGAGACAGTGATGGG - Intronic
1130111850 15:80971836-80971858 CTTGGGAGGGAGGCTGAGGTGGG + Intronic
1130243496 15:82220762-82220784 CATGGGGGTGAGAATGAGAAGGG + Intronic
1130456972 15:84120518-84120540 CATGGGGGTGAGAATGAGAAGGG - Intergenic
1130820625 15:87491355-87491377 CATGGGAGGGAGTCGGTGGGAGG + Intergenic
1131425866 15:92345053-92345075 TAAGGGAGTGAGGCTGAGGAGGG + Intergenic
1131508597 15:93036585-93036607 ACTGGGAGGCTGACTGAGGAGGG - Intronic
1131921307 15:97331751-97331773 CATGGGAGGGAGTCAATGGAGGG + Intergenic
1131969909 15:97881595-97881617 GATGGGGTGGAGAGTGAGGATGG - Intergenic
1132534188 16:469181-469203 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1132625436 16:889365-889387 CATGGGTGTGAGGCTGCGGATGG + Intronic
1132636558 16:952672-952694 CTTTGCATGGAGACTGAGGATGG - Intronic
1132664144 16:1073988-1074010 CAGGAGAGGGAAACTGAGGCAGG - Intergenic
1132806143 16:1776028-1776050 CATGAGAGGGCGCCTGGGGACGG - Intronic
1132850138 16:2021267-2021289 TTTGGGAGGGAGGCTGAGGTGGG - Intergenic
1133494522 16:6304409-6304431 CATGGAGGTGAGACGGAGGAGGG - Intronic
1133654558 16:7847891-7847913 ACTGGGAGGGAAAATGAGGATGG + Intergenic
1133820528 16:9232287-9232309 AAAGGGAGGGAGAGGGAGGAGGG - Intergenic
1134248082 16:12554905-12554927 CAGGGGAGAGGGGCTGAGGAGGG + Intronic
1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG + Intronic
1134470577 16:14521688-14521710 CACGGGAGGGAGGCTGAGGCAGG + Intronic
1134533275 16:15002295-15002317 CATGGTAGGGAGATAGAGGTAGG - Intronic
1134615422 16:15647782-15647804 TTTGGGAGGGAGGCTGAGGCAGG + Intronic
1134623267 16:15705871-15705893 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1134634259 16:15780061-15780083 CTTGGGAAGGAGAGTGAAGAAGG - Intronic
1134741880 16:16555052-16555074 CTTGGGAGGGAGGTTGAGGCAGG - Intergenic
1134925678 16:18157404-18157426 CTTGGGAGGGAGGTTGAGGCAGG + Intergenic
1135273352 16:21087649-21087671 TATGAGAGGGAGGCTGAGGCAGG + Intronic
1135673230 16:24392515-24392537 CAGGTGGGGGAAACTGAGGACGG - Intergenic
1135681905 16:24464640-24464662 CATGGGAGGGACGCTGTGGGAGG + Intergenic
1135920023 16:26641541-26641563 CAGGGGAGGGAGATGGAGGATGG - Intergenic
1135963188 16:27014737-27014759 CATGGGAGGGATACACAGCAGGG - Intergenic
1135966392 16:27039296-27039318 CATGGGAGGGACCCAGTGGAAGG - Intergenic
1136347239 16:29684001-29684023 AATAGAAGGAAGACTGAGGATGG - Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1136871972 16:33815969-33815991 CATGGTGTGGACACTGAGGAAGG - Intergenic
1137578221 16:49617857-49617879 ACTGGGAGGGAGGCTGAAGAGGG - Intronic
1137624362 16:49898407-49898429 CAGGTGAGGGAGTCTGAGGCAGG - Intergenic
1137690767 16:50425613-50425635 CATGGGTGGGAGCCTGGGGCAGG - Intergenic
1138175835 16:54897493-54897515 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1138329478 16:56202087-56202109 CCTGTGAGGGAAACTGAGAAGGG + Intronic
1138564919 16:57826073-57826095 CAGAGGAGGGAGGCAGAGGACGG - Intronic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1138955213 16:61963244-61963266 CATGGAAGGGACATGGAGGAAGG - Intronic
1139015446 16:62684180-62684202 CACTGGAGGGAGACTGAGGAGGG + Intergenic
1139147965 16:64345415-64345437 CATGGGAGAGAGGCTGAGCAGGG + Intergenic
1139309923 16:66019595-66019617 CATGGGAGGGACCCTGTGGGGGG + Intergenic
1139378559 16:66515962-66515984 CACTGGAGGGAGACAGAGGCTGG - Intronic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139625874 16:68188008-68188030 CATGGGAGGGAGGTCGAGGTAGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139980770 16:70857082-70857104 CAGGGTAGGGAGAATAAGGAAGG - Intronic
1140218420 16:73026259-73026281 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1140865665 16:79059600-79059622 CTTGGGAGGCAGGCTGAGGCAGG - Intronic
1140874397 16:79137680-79137702 CGGGGGAAGGAGACGGAGGAGGG - Intronic
1140885028 16:79235452-79235474 CACTGGAGGGAGGCTGAGGTGGG + Intergenic
1141029459 16:80575038-80575060 CAAGCAAGGGAGACTGAGGGTGG + Intergenic
1141156260 16:81599266-81599288 CAGGGGAGGGAGAGTGTGAACGG + Intronic
1141410250 16:83828245-83828267 CATGTGAGGCAGACTCGGGATGG + Intergenic
1141442516 16:84038714-84038736 GATGGGAGGGAGACAGAAGTGGG - Intronic
1141880683 16:86856967-86856989 GATGGGCGGGGGACTGCGGAAGG + Intergenic
1141884272 16:86880991-86881013 CATGAGGGAGAGACTCAGGAAGG + Intergenic
1141946026 16:87310739-87310761 CAGGGGAGAGAGTCAGAGGAGGG + Intronic
1141951143 16:87340173-87340195 CTTGGGAGTGAGGCTGAGGCAGG + Intronic
1142289011 16:89184215-89184237 CACGGGAAGGAAACTGAGGCGGG - Intronic
1142338182 16:89503805-89503827 CTCAGGAGGGAGACTGAGGCAGG - Intronic
1142358009 16:89613124-89613146 GTTGGGAGGGAAACTGAGGCAGG - Intergenic
1203094614 16_KI270728v1_random:1243417-1243439 CATGGTGTGGACACTGAGGAAGG - Intergenic
1203100200 16_KI270728v1_random:1300099-1300121 CATGGTGTGGACACTGAGGAAGG + Intergenic
1142558644 17:796672-796694 CAGGGAAGGGAGGCTGAGGCCGG - Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1142875308 17:2848906-2848928 CTTAGGAGGAAGACAGAGGAGGG - Intronic
1142901562 17:3015346-3015368 CAAGGGATGCAGACTCAGGAGGG - Intronic
1143113516 17:4567418-4567440 CAAGCAGGGGAGACTGAGGAAGG - Intergenic
1143232939 17:5372865-5372887 CTAGGGAGGGAGGCTGAGGCCGG - Intronic
1143269565 17:5665707-5665729 CACTGGAGTGAGCCTGAGGAGGG - Intergenic
1143320840 17:6068056-6068078 CTAGGGAGGGAGGTTGAGGAAGG - Intronic
1143522226 17:7451386-7451408 CCGGGGAGGGAGGCTGAGGCAGG - Intronic
1143619366 17:8072302-8072324 CCTGGGAGGGAGACTTAAGCTGG + Intergenic
1143648655 17:8248853-8248875 CTTAGGAGGGAGACGGAGGCTGG - Intronic
1143710144 17:8728698-8728720 TCTGGGAGGCAGACTGACGAGGG + Intergenic
1144715828 17:17435278-17435300 AATGGGAGAGAGAGTGAGGGAGG - Intergenic
1145109306 17:20147928-20147950 CTTGGGAGGGAGGCTGAGGTGGG + Intronic
1145398248 17:22512474-22512496 CTGGGGAGGGAAACTGAGAAAGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146359119 17:32159733-32159755 CATGGGAGGGAGGCTGAGATGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146538382 17:33673182-33673204 GAAGGGAGAGAAACTGAGGATGG + Intronic
1146554770 17:33813923-33813945 CAGTGGAGGGAGAATGAGGAAGG + Intronic
1146720660 17:35121290-35121312 CCTGGGAAGGAGAATAAGGATGG - Exonic
1146793500 17:35765939-35765961 AGTGGGAGGGAGACTGATGCAGG - Intronic
1146939911 17:36837226-36837248 CATGGGAGGAAGCCTGCAGATGG - Intergenic
1147845160 17:43399565-43399587 GATGGGAGGGTGATTTAGGAAGG + Intronic
1148444559 17:47729595-47729617 AATGGGAGGGAGCCTGAGAGTGG + Intergenic
1148689703 17:49520185-49520207 CAGGGCAGGAAGACTGTGGAGGG - Intergenic
1148750168 17:49941021-49941043 CATGGCAGGGACACAGAGGGTGG - Intergenic
1148778332 17:50108353-50108375 GATGGGTGGGAGAATGAGGCTGG - Exonic
1148860360 17:50601356-50601378 CATAGAAGGGAAACTGAGGCAGG - Intronic
1148911622 17:50946070-50946092 TTAGGGAGGGAGACTGAGGCAGG + Intergenic
1148966163 17:51437856-51437878 CCTGGGAGGGAGATGGAGAAGGG + Intergenic
1149256896 17:54837016-54837038 CATGGGAGGGAAGCTGAGGTGGG - Intergenic
1149370087 17:55985355-55985377 CATGGGAGGGACACAGTGGAAGG - Intergenic
1149401886 17:56305245-56305267 CATGGGAGGGAGCCAGTGGGAGG - Intronic
1150156909 17:62861396-62861418 CTTGGGAGGGAGGCTGAGCCAGG - Intergenic
1150411070 17:64940955-64940977 CCCAGGAGGGAGTCTGAGGATGG + Intergenic
1150420343 17:65028295-65028317 CTTGGGAGGGAGGTTGAGGCAGG + Intronic
1150521000 17:65866346-65866368 CATGGGAGGGAGGCCAAGGCGGG + Intronic
1151237065 17:72728328-72728350 CTTGGGAGGGATGCTGAGGTGGG + Intronic
1151426938 17:74037044-74037066 CATGGACGGGAGGCAGAGGAGGG - Intergenic
1151457632 17:74235780-74235802 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1151831457 17:76554589-76554611 CGTGGCAGGAAGAGTGAGGATGG - Intergenic
1151833602 17:76569594-76569616 ACTGGGAGGGAGACTGGGTAGGG + Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152323857 17:79624357-79624379 GAAGGGAGGGAGGCTGGGGAAGG + Intergenic
1152343905 17:79740084-79740106 ACTGGCAGGGAGACTGAGGTGGG + Intronic
1152431265 17:80249334-80249356 CATGGGAGGCAGGCACAGGAAGG - Intronic
1152530315 17:80914718-80914740 CATGGGAGGGAGGCTGAGGGTGG + Intronic
1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG + Intronic
1152677975 17:81651342-81651364 CAGGGGAGGGAACCAGAGGAGGG + Intronic
1152739620 17:82013227-82013249 GAGGGGATGGAGACGGAGGAAGG - Intronic
1152795101 17:82302746-82302768 CCTGGGAGGGAGACTGGGGAGGG + Intergenic
1152856655 17:82668504-82668526 CATGGGAGGGAAGCTGAGGGAGG - Intronic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1153102918 18:1494923-1494945 TTTGGGAGGGAGGCTGAGGTGGG - Intergenic
1153608132 18:6855021-6855043 CATGGGAGGGAGGCCGAGGTGGG + Intronic
1153690297 18:7585640-7585662 CATGAGAGGGAGATAGATGAGGG - Intronic
1155428842 18:25734443-25734465 TATTGTAGGGAGGCTGAGGAAGG + Intergenic
1156271417 18:35536568-35536590 AATGTGAAGGAGACAGAGGAGGG - Intergenic
1156273523 18:35559334-35559356 AACTGGATGGAGACTGAGGAAGG + Intergenic
1156281675 18:35645339-35645361 CTTGGGAAGGAGGCTGAGGCAGG - Intronic
1156585363 18:38425820-38425842 CAGGGGAGGACAACTGAGGAAGG - Intergenic
1156833195 18:41520557-41520579 CAAAGGAGGGAAACTCAGGATGG - Intergenic
1157006464 18:43589837-43589859 CATGGGAGGGAAGCTGATGGGGG - Intergenic
1157236042 18:45966262-45966284 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1157590122 18:48831480-48831502 CATGGGAGGGGCAGTGAGGAGGG - Intronic
1157599776 18:48886853-48886875 CCTGGCAGGGACACTGAGGCAGG - Intergenic
1157996394 18:52562169-52562191 CAGAGGAGGGATACTGAGTATGG + Intronic
1158157631 18:54443434-54443456 CATGGGCTGGACACTGTGGAAGG - Intergenic
1159286961 18:66366460-66366482 CATGGGAGGGACGCAGTGGAAGG + Intergenic
1159583680 18:70262490-70262512 CATGGGAGGGAGTCAGTGGGAGG + Intergenic
1160058823 18:75510850-75510872 CCTGGGAGGGGAACTGAGGTAGG + Intergenic
1160716253 19:578148-578170 CACAGGAGGGAAACTGAGGGAGG - Intronic
1160955181 19:1688049-1688071 CATCGGAGGGCGACTGACGAGGG + Intergenic
1161342441 19:3750708-3750730 CCAGGGAGGGAGAAGGAGGACGG - Exonic
1161660136 19:5540729-5540751 TAAGGGAGGGAAACTGAGGCTGG + Intergenic
1162024124 19:7884214-7884236 CTTGGGAGGGAGGGTGAGGCAGG + Intergenic
1162030346 19:7914550-7914572 CATTGAGGGGAGACTGAGGCAGG + Intergenic
1162039021 19:7958198-7958220 CACGGAGGGGACACTGAGGATGG + Intergenic
1162457179 19:10792369-10792391 TTTGGGAGGGAAACTGATGAAGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163355174 19:16805978-16806000 CTTGGAAGGGAGGCTGAGGCAGG - Intronic
1163396996 19:17069637-17069659 CCTGGGAGCGTGACTGTGGATGG + Intronic
1163415063 19:17181317-17181339 CACGGGGAGGAGACGGAGGATGG - Intronic
1163746684 19:19052856-19052878 TGTGGAAGGGAGACTGAGGTGGG - Intronic
1164000632 19:21095178-21095200 GTTGGGAGGGAAACTGAGGCAGG + Intronic
1164187258 19:22881235-22881257 CTTGGGTGGGAGGCTGAGGCAGG - Intergenic
1164904003 19:31952066-31952088 CATGGGAGGGACCCAGTGGAGGG + Intergenic
1165060388 19:33202348-33202370 CATGGTAGGCACACTGAGTAAGG - Intronic
1165073604 19:33269110-33269132 CCTGGGAGGGAGCAGGAGGAAGG - Intergenic
1165094673 19:33403573-33403595 CATGGGAGGGAGCCAGGGGGTGG + Intronic
1165289069 19:34868554-34868576 CTCGGGAGGGAGGCTGAGGCAGG - Intergenic
1165336285 19:35172228-35172250 TTTGGGAGGGAGACCGAGGTGGG + Intergenic
1165757690 19:38304013-38304035 CAGGGGAGGCCGACTGAGGGGGG - Intronic
1165883262 19:39058419-39058441 CTTGGGAGGGAGGCTGAAGAAGG - Intergenic
1165928722 19:39342761-39342783 CCCAGGAGGGAGACTGGGGACGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166187429 19:41150283-41150305 CAGGTGAGGGAGGCTGAGGCAGG - Intergenic
1166239176 19:41478249-41478271 CATGTGAAGAAAACTGAGGAGGG + Intergenic
1166377631 19:42336560-42336582 CATGGGTGGGAGTGTGTGGAAGG - Intronic
1166670634 19:44707728-44707750 GCTGGGAAGGAGACTGAGGAAGG - Intronic
1166894770 19:46016467-46016489 CAGGGGATGGAGACTGATGGTGG - Intronic
1167001263 19:46746690-46746712 CGCTGGAGTGAGACTGAGGAAGG + Exonic
1167001932 19:46750635-46750657 CTTAGGAGGGAGGCTGAGGCAGG - Intronic
1167428016 19:49439526-49439548 CTTGGGAGGGAGACTGACCTGGG + Intronic
1167448924 19:49556035-49556057 CTTGGGAGGGAGCGTGTGGAGGG + Intronic
1167588871 19:50391669-50391691 CATCAGAGGGAGACTGAGAGGGG + Intronic
1167725016 19:51205553-51205575 CATGAGAAAGAGAGTGAGGAAGG - Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168238018 19:55075840-55075862 CCTGGGAGGGAGCAGGAGGAGGG + Intronic
924970799 2:126228-126250 CATGAGAGGGAAACTGTGGAAGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925431913 2:3801976-3801998 CATTGATGGGACACTGAGGAAGG - Intronic
925476504 2:4222588-4222610 CATGGGAGGGACCCTGTGGGAGG - Intergenic
925866980 2:8236707-8236729 CAGGGCAGGCAGACTGAGGTGGG + Intergenic
926115850 2:10212898-10212920 CCAGGGAGGGAGGCTGAGGTGGG + Intergenic
926238378 2:11067254-11067276 CATGCCAGGGACACTGAGGCAGG + Intergenic
926697724 2:15782454-15782476 CAGGGGTGGGAGAGGGAGGATGG - Intergenic
926855924 2:17256131-17256153 TATGGGAGGGAAAGTGTGGAAGG - Intergenic
926966717 2:18423107-18423129 GGTGGGAGGGTGACTGAGGATGG + Intergenic
927467263 2:23346884-23346906 CATGGGAAGGAGGCTGACCAGGG + Intergenic
927598424 2:24418736-24418758 GCTGGGAGGGAGTCTGGGGAAGG - Intergenic
927705637 2:25294879-25294901 AATGGGAGGGAGGAGGAGGAGGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928044183 2:27910920-27910942 CATGGGAGGGACCCGGTGGAAGG + Intronic
928112461 2:28521884-28521906 CATGGGAGGCGGAGTGGGGAGGG - Intronic
928254456 2:29710020-29710042 CATGGGAGGGACCCTGTGCAAGG + Intronic
928271199 2:29856653-29856675 CATCGTAGGCAGACAGAGGATGG - Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928585897 2:32757803-32757825 CTTGGGTGGGAGGCTGAGGCAGG - Intronic
928899829 2:36304972-36304994 CATGGGAGGAAGAGCGAGGGAGG - Intergenic
929014523 2:37481476-37481498 CATGGGAGGGAGGCCAAGGTGGG + Intergenic
929092565 2:38233983-38234005 CAGTGGAGGGAGGCTGGGGAGGG - Intergenic
929315224 2:40469355-40469377 CATGGGAGAGAAAGTGAGGAGGG - Intronic
929371235 2:41226201-41226223 CATGGATGGAAGCCTGAGGATGG + Intergenic
929389939 2:41458527-41458549 AGTGGGAAGGAGTCTGAGGAGGG + Intergenic
929700491 2:44158873-44158895 TTTGGGAGGGAGGCTGAGGTGGG - Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930153941 2:48086226-48086248 CATGGGAGGGACCCTGTGGGAGG - Intergenic
930155448 2:48102887-48102909 CGTGGGAGGGACCCTGGGGAAGG - Intergenic
930769689 2:55119088-55119110 CAAGGGAAGGAGACAGAGGTGGG + Intergenic
930903989 2:56543578-56543600 CATGAGAAGGAGACTTAGAAGGG + Intergenic
931019222 2:58024095-58024117 CTTGGGAGGGAGGCTGAGACAGG - Intronic
931733986 2:65177684-65177706 CATGGGAGGGAGGCTGAGTGGGG - Intergenic
932198964 2:69809108-69809130 CATGTGGGGGAAAATGAGGAAGG + Intronic
932221135 2:69999890-69999912 CTTGGGTGGGAGAGGGAGGAAGG - Intergenic
932252506 2:70257342-70257364 AAAATGAGGGAGACTGAGGATGG - Intergenic
932281850 2:70499786-70499808 TATTGGGGTGAGACTGAGGAAGG + Intronic
932311852 2:70749266-70749288 CATGGGAGGGACCCTGTGGGAGG - Intronic
932436150 2:71703619-71703641 GATGGCAGGGATCCTGAGGAAGG - Intergenic
932481359 2:72041463-72041485 CATGGGATGGAGAATGGGTAGGG + Intergenic
932614446 2:73223140-73223162 CAGGGGTGGGAAACTGAGGAAGG + Intronic
933760431 2:85668482-85668504 CGTGGGAGGGAGGTTGAGGAGGG + Intronic
933943800 2:87267078-87267100 CATGGGAGGGACACAGTGGCAGG + Intergenic
934033370 2:88067300-88067322 CTTGGGAGAGAGACTGAAAAGGG + Intergenic
934177880 2:89593260-89593282 CTTGGCAGGGATACTGAGGCAGG + Intergenic
934288178 2:91667561-91667583 CTTGGCAGGGATACTGAGGCAGG + Intergenic
935149439 2:100420552-100420574 CATGGGAGGGACCCTGTGGGAGG + Intergenic
935245139 2:101212384-101212406 CATGGGAGGGACACAGTGGGAGG + Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935674114 2:105579737-105579759 GAAGGGAAGGAGACTGAGGGAGG - Intergenic
935685557 2:105679674-105679696 CATGGGCAGGAGACAGAGAAGGG - Intergenic
935885525 2:107615251-107615273 CATGGGAGGGACCCTGTGGGAGG + Intergenic
936336420 2:111594501-111594523 CATGGGAGGGACACAGTGGCAGG - Intergenic
936475023 2:112832253-112832275 CAAGGGGGGAAGACTGGGGAGGG + Intronic
936500244 2:113060984-113061006 CAGGGGAGGGGGCCTGAAGAGGG + Intronic
936528343 2:113257593-113257615 CAGGGGAGGGAGATAGAGGATGG + Intronic
936669403 2:114639343-114639365 CATGGGAGGGACCCAGTGGAAGG - Intronic
936909582 2:117576318-117576340 CATGGGAGGGAACCTGTGGGAGG - Intergenic
937079531 2:119130462-119130484 CAGGAGAGCAAGACTGAGGATGG - Intergenic
937331047 2:121030313-121030335 AATGGGAGGGAGGATGATGAAGG - Intergenic
937446115 2:121959643-121959665 CCTGGGAGGTAGACAGGGGAAGG + Intergenic
937485861 2:122314191-122314213 CTTGGGAGGGAGGCTGAGGTGGG + Intergenic
937772670 2:125739323-125739345 CATAGCAGGGAGGCTGAGGTGGG - Intergenic
937836812 2:126479416-126479438 CATGGGAGGGAGCCAGTGGGAGG + Intergenic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938493736 2:131780194-131780216 CTTGGGAGGGAGGCTGAGGTGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938656612 2:133441157-133441179 CATATGAGGGTGACAGAGGAAGG - Intronic
939517745 2:143190449-143190471 TCTGGGAGGTTGACTGAGGATGG + Intronic
939519820 2:143215609-143215631 CATGTGAGGCAGACACAGGAGGG + Intronic
939647990 2:144724781-144724803 CATGGGAGGGACACAGTGGGAGG - Intergenic
939820238 2:146948429-146948451 CATGGGAGGGACCCTATGGAAGG - Intergenic
940092470 2:149936418-149936440 CATGTGGGAGAGACTTAGGAAGG + Intergenic
940322107 2:152388524-152388546 CATGGGAGGGACTCGGTGGAAGG - Intronic
940599743 2:155843975-155843997 CATGAGTGGGAGAGTGAGGAAGG + Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
940953414 2:159702930-159702952 CTCGGGAGGGAGGCTGAGGCAGG + Intergenic
941131015 2:161650792-161650814 CATGGGAGGGAGGCTGAGTGGGG + Intronic
941414409 2:165201480-165201502 GATGGCAGGGAGAGAGAGGAAGG + Intronic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
941923373 2:170873224-170873246 CTTGGGAGGGAGACTTAGAAAGG + Intergenic
942212136 2:173681837-173681859 CATGGGAGGGACCCTGTGGGAGG - Intergenic
942733231 2:179081978-179082000 CATGGGAGGGACACAGGGGGAGG - Intergenic
942816130 2:180056529-180056551 GTTGGGAGGGAAACTGAGGCAGG + Intergenic
942816746 2:180061109-180061131 GTTGGGAGGGAAACTGAGGCAGG + Intergenic
943041149 2:182807140-182807162 TATGAGAGGGAGAATGAGGGGGG - Intergenic
943060750 2:183038918-183038940 CCAGGCGGGGAGACTGAGGATGG - Intergenic
943082806 2:183276852-183276874 GAAGGGAGGGAGAGAGAGGAAGG - Intergenic
943112657 2:183625009-183625031 CATGGGAGGGACCCAGAGGGAGG + Intergenic
943298969 2:186173458-186173480 GTTGGGAGGGAAACTGAGGCAGG - Intergenic
943396212 2:187338641-187338663 CATGGGAGGGAGGCAGAGGTGGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
943928529 2:193819828-193819850 CATGGGAGAGAGCCTGAGATGGG - Intergenic
943956088 2:194191820-194191842 GATGATAGGGAGACTGAGGCGGG - Intergenic
944289609 2:197990658-197990680 CATGGGAGGGACTCTGTGGAAGG - Intronic
945087604 2:206148540-206148562 TATGGGAGGGAGGCTGAGGCAGG + Intronic
945166789 2:206954957-206954979 CATGGGAGGGACTCTGTGGGAGG - Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945266409 2:207895503-207895525 CAGGGGAAGGAGACTGTGAAAGG - Intronic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946310182 2:218878957-218878979 CATGGTAGGGAGAGTGGGGAGGG + Intergenic
946336791 2:219042983-219043005 CAAGGGATTGAGCCTGAGGAGGG + Intergenic
947070363 2:226281473-226281495 CATGGGAGGGAGCCAGTGGGAGG + Intergenic
947561586 2:231158646-231158668 CCTGGGATGGAGACTGGGGAGGG - Intronic
947603546 2:231469122-231469144 CTCGGGAGGGAGGCTGAGGCAGG - Intronic
948118369 2:235510802-235510824 TATAGGAGTGAGGCTGAGGAGGG + Intronic
948468899 2:238165046-238165068 AGTGGGAGGGCGACTGAGGAGGG - Intronic
949021166 2:241742263-241742285 CATGTGAGGGATTCTGAGGAAGG - Intronic
1168764370 20:371853-371875 CTTGCGAGGGACACTGAGCAAGG - Intronic
1169069051 20:2710701-2710723 GATGGGTGGGAGACAGAGGTGGG - Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169152161 20:3297911-3297933 GATGAGAGGGAGAGTTAGGAGGG - Intronic
1169228943 20:3874269-3874291 CAGGGGAGGGATACTGGGGAGGG + Exonic
1169632389 20:7647734-7647756 CATGGAAGGGAAGCTGAGCAGGG - Intergenic
1169782233 20:9322057-9322079 CTCGGGAGGGAGGCTGAGGCAGG - Intronic
1169817422 20:9672418-9672440 CATGGGAGGAAGCCTGTGGGAGG + Intronic
1170327815 20:15176162-15176184 CATGGGAGGGAAGCAAAGGAGGG + Intronic
1170458323 20:16553982-16554004 CATGGGAGGGAGGCTGAGGTGGG + Intronic
1171005149 20:21457346-21457368 GAATGGAGGGAGACTGAGGTAGG + Intergenic
1171178985 20:23077589-23077611 GAAGGGAGGGAGAGGGAGGAGGG - Intergenic
1171178993 20:23077607-23077629 GAAGGGAGGGAGAGGGAGGAAGG - Intergenic
1171240990 20:23566774-23566796 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1171298040 20:24035947-24035969 CAGGGTAGTGAGACAGAGGAGGG + Intergenic
1171437511 20:25134781-25134803 CCTGGGTGGTAGAATGAGGAGGG - Intergenic
1171461256 20:25299287-25299309 CTTGGGAGGCAGGCTGAGGTGGG + Intronic
1172114039 20:32563208-32563230 GGAGGGAGGGAGAGTGAGGAGGG + Intronic
1172114066 20:32563276-32563298 CTCGGGAGGGAGAGTGGGGAGGG + Intronic
1172147517 20:32767136-32767158 TTTGGGAGGGAGGCTGAGGTGGG - Intronic
1172347001 20:34209724-34209746 AATGGGAGGGAAGCTAAGGAGGG + Intronic
1172849214 20:37948511-37948533 CAGGAGAGGGAGGCTGAGGCAGG + Intergenic
1173207649 20:41007301-41007323 CATGGAAGGGAGACCAAGGAAGG - Intergenic
1174543795 20:51309757-51309779 CATGGGAGGCAGAATTCGGAGGG + Intergenic
1174564079 20:51452268-51452290 CAGGGGAAGGAGACTTGGGAAGG - Intronic
1174857957 20:54064622-54064644 CAGGAGAGCGAGACTGCGGAGGG - Intronic
1175065067 20:56277330-56277352 CACAGGAGGGAAGCTGAGGAGGG + Intergenic
1175303016 20:57956314-57956336 CCTGGGAAGGAGACTGTGGCAGG - Intergenic
1175624204 20:60476894-60476916 GATGGGAGGGGCACTGGGGATGG + Intergenic
1175996734 20:62815341-62815363 CAGGGGAGAGCCACTGAGGAGGG + Intergenic
1175998074 20:62820211-62820233 CATGGCAGGGAGAAGGGGGATGG + Intronic
1176033054 20:63023133-63023155 CCTGGGAAGGAGACTCAGGACGG - Intergenic
1176517854 21:7799678-7799700 CATGTGAGGAAGAGAGAGGAAGG + Intergenic
1176547807 21:8209026-8209048 CAAGGGAGGGCGACCGAGGCCGG - Intergenic
1176555699 21:8253228-8253250 CAAGGGAGGGCGACCGAGGCCGG - Intergenic
1176566750 21:8392063-8392085 CAAGGGAGGGCGACCGAGGCCGG - Intergenic
1176614170 21:9014182-9014204 CTTGGGAGGGAGGCTGAGGTGGG + Intergenic
1176628943 21:9119333-9119355 CACAGGAGGGAGGCTGAGGTGGG + Intergenic
1176711019 21:10149705-10149727 ATTGGGAGGGAGGCTGAGGTGGG - Intergenic
1177037457 21:16061090-16061112 CATGGGAAGGAGGCCGAGGTGGG - Intergenic
1177344681 21:19854079-19854101 CATGGGAGGGAGGCCGAGGTGGG - Intergenic
1177902873 21:26938130-26938152 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1178020251 21:28399828-28399850 CATGGGAGGGACCCTGTGGGAGG + Intergenic
1178027347 21:28483306-28483328 CATCAGAAGGAGACTCAGGATGG + Intergenic
1178350784 21:31872287-31872309 CTTGTGAGGGAGAAGGAGGAGGG - Intergenic
1178504566 21:33152351-33152373 CCAGGGAGGGACGCTGAGGAGGG - Intergenic
1178517847 21:33263964-33263986 CTTGCGAGGGAGGCTGAGGCAGG - Exonic
1178596409 21:33957421-33957443 CATAGCATGCAGACTGAGGAAGG + Intergenic
1178651882 21:34429691-34429713 CATGTGAGGAAGAGAGAGGAAGG + Intergenic
1178813968 21:35910400-35910422 CTTGGGAGGGAGCCTGTGGGAGG + Intronic
1178947344 21:36959357-36959379 GATGGGAGGGAGGCCGAGGAGGG + Intronic
1179043544 21:37825925-37825947 CATGGGAGGGACCCAGAGGGAGG - Intronic
1179092839 21:38283888-38283910 CAGGCAAAGGAGACTGAGGAGGG - Intronic
1179811676 21:43875223-43875245 CACGGGAGGGAGGCCGAGGAGGG - Intronic
1180497939 22:15906244-15906266 CTTGGGAGGGAGGCTGAGGTGGG - Intergenic
1180729382 22:17970213-17970235 CATGGGCGGGGGACAGTGGAGGG - Intronic
1180797214 22:18611738-18611760 CCTGGGAGGGTGCCTGGGGAGGG - Exonic
1180886536 22:19248795-19248817 TTTGGGAGGGAGGCTGAGGCAGG - Intronic
1181138099 22:20783503-20783525 CTGGGGAGGGAGGCTGAGGCAGG + Intronic
1181224509 22:21383533-21383555 CCTGGGAGGGTGCCTGGGGAGGG + Exonic
1181254123 22:21551280-21551302 CCTGGGAGGGTGCCTGGGGAGGG - Exonic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182031105 22:27160132-27160154 GATGGGGAGGAGACTGAAGAGGG - Intergenic
1182277632 22:29200583-29200605 CATGGGTGGGTGATGGAGGAAGG + Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182567062 22:31208046-31208068 CCCGGGAGGGAGGCTGAGGTGGG + Intergenic
1182567396 22:31210578-31210600 AATGTGAGAGAGAATGAGGAGGG + Intergenic
1182797943 22:33004915-33004937 CATGGGAGGGACCCAGAGGGAGG + Intronic
1182891828 22:33825660-33825682 CATGGGAGGGACACAGTGGGAGG - Intronic
1183007607 22:34916516-34916538 AAAGGGAGGGAGACGGAGGGAGG + Intergenic
1183024997 22:35058370-35058392 CATGGGAGGGAAGCCGAGGAGGG - Intergenic
1183143466 22:35967066-35967088 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1183232565 22:36592146-36592168 AATGGGAGGGATTATGAGGATGG + Intronic
1183256967 22:36768727-36768749 CATGAGAGGGAAAATGGGGAGGG - Intronic
1183661495 22:39224141-39224163 AATAGGAGGGAGACTGTGGTAGG - Exonic
1184004561 22:41698814-41698836 TTTGGGAGGGAGGCTGAGGCAGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184254064 22:43277048-43277070 CAGGGCAGGGAGGCTGAGGGTGG + Intronic
1184408588 22:44313790-44313812 GATGGGTGGGAGGCAGAGGAGGG - Intergenic
1184891655 22:47383095-47383117 CATGGGAGGGATCCAGTGGAAGG + Intergenic
1184998252 22:48226253-48226275 CATGGGAGGGCAGCTGTGGAGGG - Intergenic
1185133345 22:49053190-49053212 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
1185185204 22:49394942-49394964 CATGGGAGGGACCCTGTGGGAGG + Intergenic
1185234228 22:49702474-49702496 GATGGGAGGGAAACTTAAGATGG - Intergenic
1203252681 22_KI270733v1_random:125311-125333 CAAGGGAGGGCGACCGAGGCCGG - Intergenic
949214281 3:1546583-1546605 CAAGCAAGGGAGAATGAGGAGGG + Intergenic
949607859 3:5674180-5674202 CATGGGAGGGACCCTGTGGGAGG - Intergenic
950168894 3:10822588-10822610 CAGGGGAGGGAGGTTGGGGAAGG + Intronic
950258841 3:11529123-11529145 CATGGGAGGGGGACGGGGCAAGG + Intronic
950546045 3:13638649-13638671 CATGGGGGGAAGGCAGAGGAGGG - Intergenic
950684010 3:14603321-14603343 TGTGTGGGGGAGACTGAGGACGG - Intergenic
951617343 3:24562423-24562445 TATGGGAGAAAGACTGAGGAAGG + Intergenic
952029233 3:29120694-29120716 CATGGGAGGGACACAGTGGGAGG + Intergenic
952109539 3:30106731-30106753 CATGGGAGGGATCCAGTGGAAGG + Intergenic
952152956 3:30612399-30612421 GTTGGGAGGGAGGCTGAAGAGGG + Intronic
952163997 3:30725723-30725745 CATGGAAGGGAGAGTGTGGTGGG - Intergenic
952312855 3:32205934-32205956 CATATGAGGCATACTGAGGAGGG - Intergenic
952409178 3:33032193-33032215 CATGGGGAGCTGACTGAGGAGGG - Intronic
952667705 3:35927060-35927082 CATGTGCAGGAGACTGAAGATGG - Intergenic
952833978 3:37588780-37588802 CATTTTAGGGAGACTGAGCATGG + Intronic
953099581 3:39810987-39811009 CAGGGGAGGAAGACTGAGACTGG + Intronic
953133914 3:40166678-40166700 CATGGGAGGCAGTGTGAGGCAGG + Intronic
953473767 3:43188952-43188974 CAGGGCAGGGGGACTGAAGAGGG - Intergenic
953549314 3:43888838-43888860 TATGGGAGGGAGAGTGGGGATGG + Intergenic
953609217 3:44433593-44433615 CCAGGGAGGGAGACTGGAGAAGG + Intergenic
953801994 3:46031494-46031516 CACAGGAGGAAGGCTGAGGAGGG + Intergenic
953831092 3:46298087-46298109 CATGGGAGGGAGACTTTGACAGG + Intergenic
953959264 3:47254988-47255010 CATGGTTTGGAGACTGGGGAGGG - Intronic
953959326 3:47255529-47255551 CATGGTTTGGAGACTGGGGAGGG + Intronic
953979330 3:47405893-47405915 CCTGGGAGGGAGTGGGAGGATGG - Exonic
954158888 3:48705539-48705561 CATGGTGGGGAGACTGAGGTGGG + Intronic
954257868 3:49418847-49418869 CAGGGAAGGGAGGCTCAGGAAGG + Intronic
954388178 3:50255254-50255276 CATGGCAGGGATATTGAGGCAGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954699593 3:52444238-52444260 GATGGGGAGGAGACAGAGGAAGG - Intronic
954885230 3:53867576-53867598 GATGGGGGTGAGACTGGGGAAGG - Exonic
955231381 3:57102012-57102034 CATGAGAGGGAGGCTGAGGCAGG + Intronic
955349762 3:58184704-58184726 AAGGGGAGAGAGACTGAGCATGG + Intergenic
955524703 3:59808315-59808337 CATGGTAGGGATATTGCGGAGGG + Intronic
956130822 3:66052237-66052259 CTTGGGAGGGAGCCTGAGGCAGG + Intergenic
956816359 3:72911877-72911899 CATGGAGGGGATACTGAGGCAGG - Intronic
957047864 3:75390379-75390401 TTTGGGAGGGAGGCTGAGGCAGG + Intergenic
957151461 3:76491326-76491348 GATGAGAGGAAGACTGAGCATGG - Intronic
957336047 3:78830667-78830689 CGTGGGAGGGAGCCAGTGGAAGG - Intronic
957430880 3:80104891-80104913 CATGGGAGGGACTCGGTGGAAGG + Intergenic
957507413 3:81140816-81140838 GAAGGGAGGGAGAATGAGGAAGG + Intergenic
957787921 3:84905310-84905332 CATGGGAGGGAGCCCGAGAGGGG + Intergenic
958886404 3:99732581-99732603 CATGGGAGGGACCCAGGGGAAGG - Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959809131 3:110594516-110594538 CATGGGAGGGACCCAGTGGAAGG + Intergenic
959818407 3:110703501-110703523 CATGGGAGGGACCCTGTGGGAGG - Intergenic
960659858 3:120045569-120045591 CAGGGGAGTGACACTGAGGTAGG + Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960841292 3:121962389-121962411 CATGGGAGAGATACTGAGCCAGG + Intergenic
960855822 3:122101120-122101142 GAGGAGAGGGAGTCTGAGGAGGG + Intronic
960950260 3:122994477-122994499 CATGGCAGGGAAACGTAGGAAGG - Intronic
960996717 3:123345096-123345118 CATGGGAGAGAGACAGAGGGAGG + Intronic
961525772 3:127496478-127496500 CATGGCAGGGAGGCTGAGGCAGG + Intergenic
961763492 3:129189562-129189584 CTTGGGAGGGAGGCTGAGGCAGG - Intergenic
962222202 3:133573618-133573640 GAGGGGAGGGAGAGGGAGGAGGG - Intergenic
962636494 3:137337365-137337387 CCTGGGAGGGACAGTGTGGAAGG + Intergenic
962967104 3:140365520-140365542 CATGGGAGGAAACCTGTGGAAGG - Intronic
963240995 3:143002101-143002123 CCTTGGAGGGAAACTGAGGGAGG - Intronic
963250146 3:143095581-143095603 CATGGAAGGGAGGCTGAAGTGGG + Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963627210 3:147688830-147688852 CATGGGAGGGACACTGTGGGAGG - Intergenic
963899477 3:150720365-150720387 CATGGGAGGGACACGGTGGGAGG - Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964793168 3:160471635-160471657 CATGGGAGGGACATTGTGGGAGG + Intronic
964989788 3:162794907-162794929 AAAGGGAGGGAGACGGAGAATGG + Intergenic
965074010 3:163953598-163953620 CATAGGAGGGAGGCTGGGGTGGG - Intergenic
965147993 3:164931053-164931075 CAGGGGATGGAGAGTGGGGATGG + Intergenic
965748512 3:171951519-171951541 TTTGGGAGGGAGGCTGAGGTGGG - Intergenic
965865749 3:173202536-173202558 CAAGGGAGAGAGAGTGAGGGGGG + Intergenic
966612989 3:181886771-181886793 AATGTGAGGGAAACAGAGGAGGG - Intergenic
966768882 3:183486491-183486513 AATGGTGGGGAGACTGGGGAGGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
966915157 3:184580630-184580652 GCTGGGAGGGAGACTGGGGGCGG + Intronic
967364486 3:188670354-188670376 GATGGGAGAAAGAGTGAGGAAGG + Intronic
967478461 3:189947411-189947433 CATGTGAGGAAGCCTGAGGCAGG - Intergenic
967538304 3:190633601-190633623 TTTGGGAGGGAGGCTGAGGAGGG - Intronic
967601371 3:191393227-191393249 CATGGGGGGGAGACAGAGAGAGG - Intronic
967607778 3:191468005-191468027 CATGGGAGGGACACAGTGGGAGG - Intergenic
967992505 3:195142083-195142105 CAGGGGAGAGAGGCTGTGGAGGG - Intronic
968240140 3:197072802-197072824 CTCGGGAGGGAGGCTGAGGCAGG - Intronic
968431205 4:560183-560205 CATGTGAGACAGATTGAGGATGG + Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968741336 4:2333156-2333178 CAAGGGAGGGAGGTTGGGGAGGG - Intronic
968892729 4:3379791-3379813 CATGGGAGGGAGTCAGTGGGAGG - Intronic
968979376 4:3838503-3838525 CATAGGAGGCAGACTTAGGGTGG - Intergenic
969030798 4:4211651-4211673 CCTGCTAGGGAGACTGAGGCAGG + Intronic
969277215 4:6144023-6144045 CATGGGGAGGAGGCTCAGGAAGG + Intronic
969823017 4:9734811-9734833 TTTGGGAGGGAGGCTGAGGCAGG - Intergenic
969831365 4:9800134-9800156 CTTGGCAGGGATACTGAGGCAGG - Intronic
969878826 4:10156307-10156329 GTTGGCAGGGAGACTGAAGAAGG + Intergenic
970104027 4:12559937-12559959 CATGGGAGGGAACCTGTGGGAGG + Intergenic
970107125 4:12597009-12597031 CATGGGAGGGACTCGGTGGAAGG + Intergenic
970282651 4:14475043-14475065 TATGAGAGAGAGACTGATGATGG + Intergenic
970333197 4:15004379-15004401 CATGGGCGGGGGACGGAGGCGGG + Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970553524 4:17208419-17208441 CATGGGAGGGACCCTGTGGGAGG + Intergenic
970670734 4:18394004-18394026 CATGGGAGGGACCCTGTGGGAGG + Intergenic
970758008 4:19450132-19450154 CATGGGAGGGATCCAGTGGAAGG - Intergenic
971046747 4:22813527-22813549 CATGGGAGAGAGACGTAGGCTGG - Intergenic
971126404 4:23760139-23760161 CATGGGAGGGACCCTGTGGGAGG - Intronic
971330820 4:25680023-25680045 TTTGGGAGGGAGGCTGAGGCGGG + Intergenic
971789341 4:31148330-31148352 CTTGGGAGAGAGGCTGAGGTGGG - Intergenic
972127575 4:35789085-35789107 GAAGGGAGGGAAAGTGAGGAGGG + Intergenic
972318587 4:37951008-37951030 CATTGGTGGGAGGCCGAGGAGGG - Intronic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973708433 4:53602303-53602325 CAGGGGATGGAGGCTGAGAAAGG + Intronic
973957500 4:56077342-56077364 CATGGGAGGGACCCATAGGAGGG - Intergenic
974036515 4:56822503-56822525 CTTGGGAGGGAGGCTGAGGTGGG - Intergenic
974165696 4:58198705-58198727 CATGGGAGGTAGAGTGGGAAGGG - Intergenic
974179002 4:58360638-58360660 CATGGGAGGGAGACTGAGGTGGG - Intergenic
974231212 4:59116576-59116598 CATGAGAGGGACACAGTGGAAGG + Intergenic
974260331 4:59518128-59518150 CATGGGAGAGAGGCTGAGGTTGG - Intergenic
974266700 4:59595113-59595135 TATGGGAGGGAGGCTGAGATGGG - Intergenic
974683537 4:65195217-65195239 CATGGGAGGGAGACTAAAGGGGG - Intergenic
974686863 4:65242288-65242310 CATGGGATGGAGGCTGAGGAGGG - Intergenic
974981996 4:68968190-68968212 CATGGGAGGAAGACAGTGGAAGG + Intergenic
975254384 4:72216392-72216414 CATGGAAGAGAGGCTGAGGCAGG - Intergenic
975307223 4:72864270-72864292 CATGGGAGGGACCCAGTGGAAGG + Intergenic
975321269 4:73011937-73011959 TAAGGGAGGGAGGTTGAGGAGGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
975814730 4:78205886-78205908 CTTGAGAGGAAGCCTGAGGAAGG + Intronic
976108555 4:81645435-81645457 CATGGGAGGGACCCAGTGGAAGG - Intronic
976413776 4:84747623-84747645 CATGAGAGGGACACAGTGGAAGG + Intronic
976565899 4:86550589-86550611 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
976836508 4:89380678-89380700 CATGGGAGGGACCCAGTGGAAGG - Intergenic
977053554 4:92161524-92161546 CATGGGAGGGACACAGTGGGAGG - Intergenic
977303552 4:95295976-95295998 CATGGGGGGGAGGCTGAGGCAGG + Intronic
977356546 4:95953737-95953759 TATGGGAGGGACACAGTGGAAGG - Intergenic
977359042 4:95980912-95980934 CATGGGAGGGAGGCTGATGGGGG + Intergenic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
978219776 4:106256354-106256376 CAAGGGAGGGAGTCTGAAGGGGG - Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978498427 4:109384459-109384481 CATGAGAGGGAGACTGAGTCAGG + Intergenic
978785110 4:112600646-112600668 GTTGGGAGGGAAACTGAGGTAGG + Intronic
979239525 4:118436037-118436059 CATGGGATGGAGAGAAAGGAGGG + Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979615140 4:122733654-122733676 CAGGGGAGAAAGACTGAGGTAGG + Intronic
979637989 4:122978704-122978726 TATGTGAGGGAGGCTGAGGGTGG - Intronic
979649007 4:123107740-123107762 CATGGGAGGGAGGCTGAGGAGGG - Intronic
980135203 4:128852134-128852156 CATGCCATAGAGACTGAGGAAGG + Exonic
980273860 4:130622639-130622661 CAGGAGAGAGAGATTGAGGAGGG - Intergenic
980525583 4:133988091-133988113 CATGGGAGGGACATTGTGGGAGG - Intergenic
980545932 4:134261232-134261254 CATGGGAGGGAGCCTGGGGGAGG - Intergenic
980763384 4:137266549-137266571 CATGGGAGAAAGACAGAGGCCGG - Intergenic
981219712 4:142217342-142217364 CATGGGTAGGAGACTGCGGTTGG - Intronic
981308760 4:143274866-143274888 CAGGAGATGGAGACTGAGGTAGG + Intergenic
981370250 4:143951507-143951529 CATGGGAGGGACCCAGAGGGAGG + Intergenic
981536149 4:145801913-145801935 CATGGCAGGGAGGGTGGGGAGGG + Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982059396 4:151588966-151588988 CAAGTGATGGACACTGAGGAGGG + Intronic
982370442 4:154627424-154627446 CAGGGGAGGGAGACGGAGGAAGG - Intronic
982545162 4:156724472-156724494 CATGGGAGGGAGGTGGAGGTGGG + Intergenic
982802648 4:159723264-159723286 CATGGGAGGGAGGCTGAAGGAGG - Intergenic
983010186 4:162537364-162537386 GTTGGGAGGGGGACTGAGGAAGG + Intergenic
983079351 4:163366078-163366100 CAAGGGAGGGACACAGTGGAAGG + Intergenic
983182296 4:164662664-164662686 GTTGGGAGGGAAACTGAGGCAGG + Intergenic
983409076 4:167373266-167373288 CTCGGGAGGGAGGCTGAGGCAGG + Intergenic
983580849 4:169308419-169308441 CATGGGAGGGACCCAGTGGAAGG + Intergenic
984169480 4:176343486-176343508 CACAGGAGGGAGGCTGAGGTGGG - Intergenic
984325150 4:178241862-178241884 CATGGAAGGGAGGCCAAGGAGGG + Intergenic
984349390 4:178570849-178570871 CAAGGTAGTGAGAATGAGGAGGG + Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984938766 4:184913089-184913111 GTTGGGAGGGAAACTGAGGCAGG - Intergenic
984947056 4:184977461-184977483 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
985504154 5:269179-269201 GATGGGAGGGAGAATAAAGATGG + Intergenic
985704594 5:1393047-1393069 CTGGGGAGGGACACAGAGGACGG - Exonic
985855517 5:2421616-2421638 CATGTGGGGGAGAGTGAGGGTGG - Intergenic
987008024 5:13730944-13730966 TTTGGGAGGGAGGCTGAGGCGGG - Intronic
987840111 5:23212532-23212554 CTCGGGAGGGAGGCTGAGGCAGG - Intergenic
988346330 5:30042094-30042116 CATGGGAGTGAGGCTGAGGGGGG + Intergenic
988356849 5:30187675-30187697 CATGGGAGGGACACAGTGGAAGG + Intergenic
988362531 5:30254796-30254818 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
988457447 5:31398959-31398981 GTTGGGAGGGAAACTGAGGCAGG - Intergenic
988525922 5:31987476-31987498 CATCAGAGGCAGCCTGAGGATGG + Intronic
988799900 5:34686775-34686797 CATGGGAAGGAGACAGAGCAGGG - Intronic
989031728 5:37126355-37126377 CATGGCAGGGATACTGTGAAAGG + Intronic
989214277 5:38888062-38888084 CATGCGAGACAGACGGAGGAGGG + Intronic
989425453 5:41290911-41290933 CATGGGAGGGAGACTGAGCAGGG - Intergenic
989520619 5:42396381-42396403 CACAGGAGGGAGGCTGAGGGGGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990985347 5:61636503-61636525 CATGCGAGAGAGAGAGAGGAAGG - Intergenic
991149109 5:63345438-63345460 CATGGTAGGGCTACTGAGGCAGG - Intergenic
991359342 5:65803336-65803358 CATGGGAGGGAAGCTGAGGGGGG - Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
993703390 5:91143867-91143889 CATGGGAGGGAGGCTGAGGGGGG - Intronic
994397857 5:99240961-99240983 TAGGGAAGGGAGAATGAGGATGG + Intergenic
994737630 5:103575150-103575172 ACTGGGAGGGAGAGAGAGGAAGG - Intergenic
994753266 5:103764514-103764536 CATGAGAGGGAGGCTGAGAGAGG - Intergenic
994846369 5:104993422-104993444 TATGGGAGGTAGACTGGGGCTGG + Intergenic
995827021 5:116312017-116312039 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
995924455 5:117353891-117353913 CATGGGAGGGATCCAGTGGAAGG + Intergenic
996120910 5:119671107-119671129 GAAGGAAGAGAGACTGAGGAGGG - Intergenic
996179419 5:120400427-120400449 CATGGGAGGGAACCTGTGGGAGG + Intergenic
996386560 5:122915214-122915236 AATGGGAGGGAGAGTGATGATGG - Intronic
996695766 5:126393131-126393153 CAGGGAAGGGAAACAGAGGAAGG - Intronic
996699901 5:126439790-126439812 CATGGGAGGGAGCCAGTGGGAGG + Intronic
996924344 5:128806518-128806540 GATAGGAGGGAGGCTGAGGTAGG - Intronic
996967440 5:129322354-129322376 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
997042851 5:130278109-130278131 TATGGGAGGGAGACTGAGTAGGG - Intergenic
997065681 5:130556112-130556134 CCTGGGATGGAGACCCAGGATGG + Intergenic
997148603 5:131466508-131466530 CATGGGAGGGAGCCAGTGGGAGG + Intronic
997248945 5:132374106-132374128 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
997521625 5:134527201-134527223 GAAGGGAGGGAGAGGGAGGAAGG - Intronic
997569631 5:134916176-134916198 CATGGGAGGGAGGCTAGGGTTGG + Intronic
998071985 5:139205173-139205195 CTTGGTAGGGAAACAGAGGAGGG - Intronic
998101825 5:139440744-139440766 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
998219237 5:140262719-140262741 AATGGGAATGAGACTGGGGAAGG + Intronic
998466949 5:142354183-142354205 CCTAGAAGGGAGAGTGAGGAGGG + Intergenic
998480580 5:142459448-142459470 CACAGGAGGGAGGCTGAGCAAGG - Intergenic
999266372 5:150269457-150269479 CTCAAGAGGGAGACTGAGGAGGG - Intronic
999381344 5:151123641-151123663 CATGGAAAGGAGGCTCAGGAGGG + Intronic
999622913 5:153490571-153490593 CAAGGGAGGGAGAGAGAGGCAGG + Intronic
1000018374 5:157298441-157298463 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1000094251 5:157957263-157957285 CAGGTGTGGGAGACTGAGAAGGG - Intergenic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000143387 5:158428792-158428814 CAGTGGAGTGAGTCTGAGGAAGG - Intergenic
1000267454 5:159651438-159651460 TAAGGGAGGGAGACAGGGGATGG - Intergenic
1000364257 5:160476483-160476505 GATGGGAAGATGACTGAGGACGG + Intergenic
1000372896 5:160554273-160554295 TATGAGAGGGAGACAGAAGAAGG - Intergenic
1000483874 5:161814399-161814421 GATGGGAGGGAGGGTGAGAAAGG - Intergenic
1000691031 5:164320955-164320977 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
1000711969 5:164591501-164591523 CTCGGGAGGGAGGCTGAGGCAGG + Intergenic
1001008495 5:168075968-168075990 CGTGGGAGGGAGACGGTGGGAGG - Intronic
1001644120 5:173267631-173267653 AATGGTTGGGAGACTGAGGTGGG - Intergenic
1001916835 5:175568967-175568989 CTTGGGATGGGGATTGAGGAAGG + Intergenic
1002012716 5:176296723-176296745 CAGGGGTGGGAGAATCAGGAGGG - Intronic
1002416657 5:179124357-179124379 GCTGGGAGGAAGAATGAGGATGG - Intronic
1002538001 5:179888777-179888799 CCTGGCAGGGAGACGGACGAGGG + Intronic
1002739774 5:181426625-181426647 CATGGGATGGAGAGAAAGGAGGG + Intergenic
1003238144 6:4316994-4317016 GCAGGGAGGGAGAGTGAGGATGG + Intergenic
1003291680 6:4784793-4784815 CATGGGAGGGACCCTGTGGGAGG + Intronic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003460381 6:6323040-6323062 CAGTGGAGGGAGACTGGGCAGGG - Intergenic
1003923510 6:10855692-10855714 AATGGGAGGGAGGTTGAGGGTGG - Intronic
1003923528 6:10855744-10855766 TGTGGGAGGGAGATTGAGGGTGG - Intronic
1004214142 6:13685817-13685839 AATGGGAGGGAGGCTGAGGTGGG + Intronic
1005475438 6:26203403-26203425 AATGGGAGGGAGAAAGAGGAAGG + Intergenic
1006104468 6:31708127-31708149 CCTGGCAGGTAAACTGAGGAAGG + Exonic
1006849812 6:37090165-37090187 TTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1006894541 6:37458807-37458829 TATGGTAGGGACATTGAGGAGGG + Exonic
1007218106 6:40256869-40256891 CTTGGGTGGGAGACAGAGGAGGG - Intergenic
1007342705 6:41201546-41201568 CCTGGGAGAGAGAGAGAGGAAGG - Intergenic
1007404424 6:41625838-41625860 CAAGAGAGGGGGACAGAGGAAGG - Intergenic
1007581523 6:42963004-42963026 GATGGGAGGGAGACTGGTGCTGG + Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008541681 6:52551490-52551512 CAGGGGAGGGTGAATGAGGGAGG + Intronic
1008787702 6:55189401-55189423 CATGAGAGGCAGTCTGAAGATGG + Intronic
1009241746 6:61193621-61193643 CATGGGAGAGAGGCTGAAGGGGG - Intergenic
1009243410 6:61205162-61205184 CATGGGAGGGAGACTGAGGGGGG - Intergenic
1009534347 6:64861193-64861215 CATGGGAGGGAATCTGAGGCAGG - Intronic
1009643139 6:66362968-66362990 TATGGGAGGGAGACTGAAGGGGG - Intergenic
1010380843 6:75223212-75223234 CATGTGAGGGCGAGTGAGAAAGG - Intergenic
1011003901 6:82622519-82622541 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
1011712522 6:90069138-90069160 GATGGGAGGAAGCCTGAAGACGG + Intronic
1012142057 6:95636618-95636640 CATGGGAGGGAGGCTGAGGTAGG - Intergenic
1013338800 6:109192542-109192564 CATGGGAGGGACACAGTGGGAGG + Intergenic
1014268232 6:119306418-119306440 CATGGAAGAGAAAGTGAGGATGG - Intronic
1014391632 6:120872248-120872270 CATGGGAGGGAGGCTGAGAAGGG + Intergenic
1014619432 6:123647437-123647459 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
1014708108 6:124773290-124773312 AATGGGAAGGAGAAAGAGGAGGG + Intronic
1014813582 6:125911314-125911336 GGTGGGAGGGAAACTGAGGCAGG - Intronic
1014813768 6:125912761-125912783 GTTGGGAGGGAAACTGAGGCAGG - Intronic
1014969033 6:127791737-127791759 CATGGGAGGGAGGGTGAGGTGGG - Intronic
1014986817 6:128021526-128021548 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1015094851 6:129403018-129403040 CATAGGAGGGAGAGTAAAGAGGG + Intronic
1015530182 6:134213820-134213842 CATGGGAGTATGATTGAGGAGGG + Intronic
1015971325 6:138745549-138745571 TTTGGGAGGGAGGCTGAGGCAGG - Intergenic
1016270949 6:142289846-142289868 TTTGGGAGGGAGGCTGAGGCGGG - Intergenic
1016702692 6:147071084-147071106 CATGGGAGGGACCCTGTGGGAGG - Intergenic
1016743594 6:147554243-147554265 CATGGGAGGGACCCAGCGGAAGG - Intronic
1017522399 6:155213754-155213776 CATGGGAGGCAGGCCAAGGAGGG - Intronic
1017592233 6:155990068-155990090 CAATGGAGGGAGGCGGAGGAGGG - Intergenic
1017931518 6:158959464-158959486 CTGGGGAGGGAGTCTGTGGAAGG + Intergenic
1017969897 6:159303306-159303328 CATGGGAGGGAGGCTGCAGGTGG + Intergenic
1018167375 6:161110897-161110919 CAGTGGACAGAGACTGAGGATGG - Intronic
1018245087 6:161814895-161814917 CATGGGAGGGACCCTGTGGGAGG - Intronic
1018472931 6:164112401-164112423 CATGGGAGGGACTCTGTGGAAGG + Intergenic
1018549614 6:164980683-164980705 CATGGGAGGGACACAGAGGGAGG + Intergenic
1018855484 6:167671559-167671581 GATGGCAGTGAGACTGAAGATGG - Intergenic
1018855506 6:167671754-167671776 GATGGTAGTGAGACTGAAGATGG - Intergenic
1018855524 6:167671930-167671952 GATGGCAGTGAGACTGAAGATGG - Intergenic
1019037173 6:169071487-169071509 GAAGGGAGGGAGGGTGAGGAGGG - Intergenic
1019180792 6:170186388-170186410 CCCGGGAGGAAGACTGAGGGAGG + Intergenic
1019244887 6:170702211-170702233 CATGGGATGGAGAGAAAGGAGGG + Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019833475 7:3357460-3357482 GATGCCAGGGAGACTGAGGTGGG - Intronic
1019954808 7:4405213-4405235 CATGGGAGGGACCCAGAGGGAGG - Intergenic
1019964079 7:4484679-4484701 GAGGGGAGGGAGAAAGAGGATGG + Intergenic
1020256713 7:6506492-6506514 CAGGGCAGGGACACTGAGGATGG + Intronic
1020314977 7:6899197-6899219 TTTGGGAGGGAGGCTGAGGTAGG + Intergenic
1020389424 7:7642399-7642421 TTTGGGAGGGAGACGGGGGAGGG - Intronic
1021136805 7:16974843-16974865 CATGGGAGGGACACCGTGGGAGG - Intergenic
1021400803 7:20207918-20207940 CATGGGAGGGACCCTGTGGGAGG + Intronic
1021417177 7:20401084-20401106 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1021899012 7:25264523-25264545 GAAGGGAGTGAGACTGAGGCAGG + Intergenic
1022112122 7:27238278-27238300 CTTGGAAGGGAGACTGAGCTTGG + Intergenic
1022423493 7:30246183-30246205 CATGGGAGGGAAGCTGAGCGGGG - Intergenic
1022457093 7:30566952-30566974 GATGGGAAGTAGACTAAGGAGGG + Intergenic
1023054865 7:36283332-36283354 CAGGTGAGGGAGGCAGAGGAAGG + Intronic
1023356476 7:39372025-39372047 CTTGGGAGGGAGGCTGAAGCAGG - Intronic
1023910564 7:44552695-44552717 GTTGGGAGGGAAACTGAGGCAGG + Intergenic
1024058169 7:45679467-45679489 AGTGGGAGGTAGACTCAGGAGGG + Intronic
1024263174 7:47587048-47587070 CAGGAGAGGGAGCCTGGGGAGGG + Intergenic
1024413653 7:49078178-49078200 CATGGGAGAGAGCCGGTGGAAGG - Intergenic
1025061249 7:55810584-55810606 CTCGGGAGGGAGGCTGAGGCAGG - Intronic
1025160380 7:56654222-56654244 CATGAAAGAGGGACTGAGGAGGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026101460 7:67387885-67387907 GAGGGGAGGGAGACAGAGCAAGG + Intergenic
1026158039 7:67844461-67844483 CTTGGGAGGGAGGCTGAGATGGG - Intergenic
1026242617 7:68590097-68590119 CACAGGAGAAAGACTGAGGACGG + Intergenic
1026865772 7:73823131-73823153 AATTGGAGGGAGAGTCAGGAGGG - Intronic
1026910488 7:74088963-74088985 CCTGGGACAGTGACTGAGGATGG + Intronic
1027154164 7:75754681-75754703 CTCGGGAGGGAGGCTGAGGCAGG + Intergenic
1027797904 7:82716658-82716680 CATGGGAGGGACCCAGTGGAAGG - Intergenic
1028006320 7:85573686-85573708 GATGGGATGCAGACTGACGAGGG + Intergenic
1028115315 7:86990373-86990395 CATGGGAGTGAGACTGGTGGTGG + Intronic
1028136727 7:87230436-87230458 CATGGGAGGGAGGCTGATGGGGG + Intergenic
1028308230 7:89293675-89293697 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1028527452 7:91801530-91801552 CATGGGAGGGAGGCCAAGGAGGG - Intronic
1029090882 7:98047308-98047330 CATGAGAGTGAGAAGGAGGAGGG + Intergenic
1029454324 7:100660535-100660557 CATAGGAGGGATACTGAGATGGG + Intergenic
1029540727 7:101180478-101180500 CTGGGGAGTGGGACTGAGGATGG + Intergenic
1029976155 7:104836169-104836191 GATGGGAAGGAGAATCAGGAAGG + Intronic
1029977556 7:104849036-104849058 CTTGGGTGGGAGGCTGAGGTGGG - Intronic
1030091461 7:105862325-105862347 CTTGGGAGGGAGGCTGAGGTGGG + Intronic
1030328101 7:108243211-108243233 CATGGGCAGGAGCCAGAGGACGG - Intronic
1030359414 7:108579618-108579640 CATGGGAGGGAGGCTGAGGTGGG + Intergenic
1030570240 7:111213325-111213347 CATGGGAGGGAGGCTGAGTGGGG + Intronic
1030587131 7:111434655-111434677 CCTGGGTGGGAGGCTGAGGCAGG - Intronic
1030681702 7:112441026-112441048 CTTTGGTGGGAGGCTGAGGAGGG + Intronic
1030756294 7:113291487-113291509 CATTGGAGGGAGGCTGATGAGGG + Intergenic
1031018111 7:116597415-116597437 CAGGGAAGGGAGACTGAGGTTGG - Intergenic
1031114927 7:117657103-117657125 AATGGGAGGGAAACTTGGGAGGG + Intronic
1031298683 7:120038120-120038142 CATGGGAGGGACACAGTGTAAGG - Intergenic
1032520144 7:132537667-132537689 CATGGAAGTGGGAGTGAGGAAGG + Intronic
1033074294 7:138234149-138234171 CTTGGGAGGAAGGCTGAGGTGGG + Intergenic
1033227059 7:139570731-139570753 AAAGGGAGGGAGGATGAGGATGG + Exonic
1033256313 7:139804617-139804639 CATGGGAGGGACACAGTGGGAGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033346846 7:140532155-140532177 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1033370334 7:140701514-140701536 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1033600936 7:142888033-142888055 TTTGGGAGGGAGACTTAGGGAGG + Intergenic
1033792475 7:144807403-144807425 CATGGGAGGGACACAGTGGGAGG - Intronic
1034210450 7:149358342-149358364 CACAGGAGGGAGGCTGAAGAGGG - Intergenic
1034324682 7:150220087-150220109 CAGGGGTCGGTGACTGAGGATGG - Intergenic
1034440299 7:151082691-151082713 GAGGGGACGGAGGCTGAGGACGG - Intronic
1034496887 7:151428486-151428508 CATGGGAGGGAGGCCCAGGAAGG + Intergenic
1034615899 7:152416435-152416457 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1034683710 7:152951208-152951230 CATGGGAGGGACCCTGTGGGAGG + Intergenic
1034768509 7:153749144-153749166 CAGGGGTCGGTGACTGAGGATGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1034977318 7:155456085-155456107 CGTGGGATGGACACTGGGGAAGG + Intergenic
1035117579 7:156537403-156537425 CATGGGAGGGACCCAGTGGAAGG + Intergenic
1035174016 7:157037712-157037734 AAGGGGAGGGAGCCTGGGGAGGG + Intergenic
1035189609 7:157154075-157154097 CTTGGGAGGGAGGCCGAGGTGGG + Intronic
1035313395 7:157983603-157983625 CCTGGGAGTGAGTCTGAGGCAGG + Intronic
1035503236 8:105976-105998 CATGGGATGGAGAGAAAGGAGGG - Intergenic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1035678944 8:1473540-1473562 CAGGGGCTGGAGACTGGGGAGGG + Intergenic
1035796288 8:2360299-2360321 CTCGGGAGGGAGGCTGAGGCAGG - Intergenic
1035834942 8:2740040-2740062 CATGGGAGGGATCCAGTGGAAGG + Intergenic
1035960043 8:4126558-4126580 TGTGGGATGGAGACTGGGGACGG + Intronic
1036095408 8:5718793-5718815 CATGGGAGGGACACAGTGGGAGG - Intergenic
1036661233 8:10710435-10710457 CCTGGGAGGGAGGCTGGGCAGGG + Intronic
1036810612 8:11865905-11865927 CTTGGGAGGGAGGCTGAGACAGG + Intronic
1037006807 8:13791562-13791584 CAGGGGAGGTAGGCTGAGGGAGG - Intergenic
1037150198 8:15626812-15626834 CATGGGAGAGTGGCTGAGGGGGG + Intronic
1037589419 8:20300737-20300759 GATGGTAGGGACTCTGAGGAAGG + Intronic
1038019220 8:23538976-23538998 CGTGGGAGGGAGGGTGAGGATGG - Intronic
1038290148 8:26241932-26241954 CCTGGGAGGGAGGCTGAGGTGGG + Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038785620 8:30612636-30612658 CAGGAGAGGGAGGCTGAGGCAGG - Intronic
1038813494 8:30876835-30876857 CATGGGAGGGACCCAGTGGAAGG + Intronic
1039541692 8:38377593-38377615 TTTGGGAGGGAGGCTGAGGCGGG - Intronic
1039593741 8:38771845-38771867 CTTGGGAGGGAGGCTGAGTTGGG - Intronic
1039604035 8:38866240-38866262 CAGGGGAGGCAGACTGGGGAAGG + Intergenic
1039847610 8:41336849-41336871 CTTGGGAGAGAGTATGAGGAAGG - Intergenic
1039950189 8:42164948-42164970 AAGGGGAGGGAGAGAGAGGAAGG + Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040611316 8:48984973-48984995 CTTGGGAAGGAGAGTGGGGAAGG + Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1040918592 8:52590191-52590213 CATAGGAGGCAGATTGATGAGGG - Intergenic
1041316397 8:56567624-56567646 CATGGGAGGGACCCTGTGGGAGG + Intergenic
1041688560 8:60667261-60667283 CTTGGGAGGGGAACTGAGGCTGG - Intergenic
1042026875 8:64433335-64433357 CAAGATAGGGAGGCTGAGGAAGG + Intergenic
1042193452 8:66211506-66211528 CATGGGAGGGAGCCGGTGGGAGG - Intergenic
1042289894 8:67159365-67159387 CATGGGAATGAGACTAAGAATGG - Intronic
1042622859 8:70725167-70725189 CATGGGAGGGACCCGGAGGGAGG - Intronic
1042819543 8:72915426-72915448 CATGGGAGGGGGAAGGAGGTAGG + Intronic
1043082590 8:75784774-75784796 CATGGGAAGGAGGCTGAGAGAGG - Intergenic
1043385840 8:79747277-79747299 CATGGGAGGGACCCTGTGGGAGG - Intergenic
1043675872 8:82952990-82953012 CAAGAGAGGGAGAGTGAGGAGGG - Intergenic
1043750355 8:83926616-83926638 CATGGGAGGGAGGCTGAAGGGGG - Intergenic
1043798695 8:84579125-84579147 CATGGGAGGGAGGCCTAGGGGGG - Intronic
1043856820 8:85274091-85274113 CTTGGGACTGAGCCTGAGGAGGG + Intronic
1044444921 8:92264637-92264659 CTTGGGAGGGAGGCTAAGGTGGG + Intergenic
1044774998 8:95678398-95678420 CATGGGAGTGAGGCCGAGGGGGG - Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046264445 8:111813476-111813498 TGTGGGAGGGACACTGAGGGAGG - Intergenic
1046473351 8:114708832-114708854 CATGGGAGGGACCCTGTGCAGGG - Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046674710 8:117094839-117094861 CATGGGAAGGAGGCTGAGGTGGG - Intronic
1046682126 8:117182157-117182179 CATGAGAAGGAGAGTGAGGTGGG + Intergenic
1047135296 8:122071175-122071197 CTTGGGACTGAGTCTGAGGAGGG - Intergenic
1047414536 8:124653130-124653152 GATGGGAAAGAAACTGAGGAAGG + Intronic
1047457813 8:125032047-125032069 CCTGGCAGGGTGACTAAGGATGG + Intronic
1047773434 8:128049307-128049329 CAAGGGAGAGTGAATGAGGAAGG + Intergenic
1048081976 8:131138297-131138319 CTCGGGAGGGAGGCTGAGGCGGG + Intergenic
1048083252 8:131151179-131151201 CAGGGTAGTGAGTCTGAGGATGG + Intergenic
1048189168 8:132272745-132272767 CATGGGAGGGACCCAGTGGAAGG - Intronic
1048548003 8:135404939-135404961 CATGGGAGGGAGGCTGAGTGGGG - Intergenic
1048633382 8:136268765-136268787 CATGGGAGGGAGCCAGTGGGAGG + Intergenic
1049182933 8:141232189-141232211 CATGTGTGGGAGCCTGAGGGGGG - Intronic
1049290293 8:141798081-141798103 CATTGTCGGGAGACTGGGGAGGG + Intergenic
1049595333 8:143480828-143480850 CATGGCAGGAAGGCTGGGGAAGG + Intronic
1049614236 8:143569230-143569252 CATGAGAGGGAGAAACAGGAGGG + Intronic
1049614253 8:143569264-143569286 CCTGGGAGGGAGACTGGGGGCGG + Intronic
1049624347 8:143613424-143613446 CGTGGGTGGGACACTGCGGAGGG - Intronic
1049813594 8:144587565-144587587 CATGGGACGGGGCCTGGGGAGGG + Intronic
1049826888 8:144674740-144674762 CACAGGAGGGAGCCCGAGGAGGG - Intergenic
1049835231 8:144730996-144731018 CATGGGATTAAGACTGAAGACGG + Intronic
1050092328 9:2027577-2027599 CGTGGAAGGGAAACTGAGCATGG + Intronic
1050120574 9:2303224-2303246 CATGGGAGGGACTCTGTGGGAGG - Intergenic
1050142184 9:2527579-2527601 CATGGGAGGGACCCGGTGGAAGG + Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1050756802 9:9014665-9014687 CATGGGAGACAATCTGAGGAAGG + Intronic
1050888106 9:10790616-10790638 CATGGGAGGGAGGCTAAAGGGGG + Intergenic
1050890235 9:10816037-10816059 GATGGGGGAGAGACGGAGGAGGG + Intergenic
1051089189 9:13386006-13386028 CATGGGAGGGACCCAGTGGAAGG + Intergenic
1051160025 9:14197266-14197288 CAGGAGAGTGAGACTGAGAAAGG - Intronic
1051919094 9:22243219-22243241 GATGGGAAGGATAATGAGGAAGG + Intergenic
1052405776 9:28059081-28059103 GTTGGGAGGGAAACTGAGGCAGG + Intronic
1052538268 9:29775878-29775900 GTTGGGAGGGAAACTGAGGCAGG - Intergenic
1052552596 9:29970025-29970047 CATGGGAGGGAGACCGAAGGTGG - Intergenic
1052652424 9:31321517-31321539 CATGGGAGTGAGGCTGAGAGGGG - Intergenic
1053166190 9:35845897-35845919 CAGGGGTGGGAGTCTGAGGGTGG + Intronic
1053203099 9:36166003-36166025 CCCGGGAGGGGCACTGAGGACGG + Intergenic
1053301137 9:36950476-36950498 CTTGGGAGGAAGACTGAGGAGGG - Intronic
1053556954 9:39146964-39146986 CATGGGAGGGAACCTGTGGGAGG + Intronic
1053619190 9:39798736-39798758 CATGGGAAGGAGGCTGAAGTGGG - Intergenic
1053665980 9:40317925-40317947 GATGGGAGGGGGACCGGGGATGG + Intronic
1053821064 9:41967234-41967256 CATGGGAGGGAACCTGTGGGAGG + Intronic
1053895316 9:42736603-42736625 CATGGGAAGGAGGCTGAAGTGGG + Intergenic
1053915561 9:42942970-42942992 GATGGGAGGGGGACCGGGGATGG + Intergenic
1054089935 9:60835373-60835395 CATGGGAGGGAACCTGTGGGAGG + Intergenic
1054111346 9:61110931-61110953 CATGGGAGGGAACCTGTGGGAGG + Intergenic
1054264967 9:62908693-62908715 CATGGGAAGGAGGCTGAAGTGGG + Intergenic
1054518630 9:66058358-66058380 GATGGGAGGGGGACCGGGGATGG - Intergenic
1054609511 9:67220194-67220216 CATGGGAGGGAACCTGTGGGAGG - Intergenic
1054775664 9:69121733-69121755 CCGGGGAGGGAGAGAGAGGAGGG - Intronic
1055989893 9:82094203-82094225 CAGGGGAGGGAAACAGAGGAGGG + Intergenic
1056045784 9:82714149-82714171 CAGTGGAGGGACACTGAAGAAGG - Intergenic
1056091932 9:83214600-83214622 CATGGGAGGGACCCTGTGGGAGG + Intergenic
1056092371 9:83217471-83217493 CATGGGAGGGACCCAGAGGGAGG + Intergenic
1056486078 9:87059214-87059236 CATGGGAGGGACCCAGTGGAAGG + Intergenic
1056716449 9:89034859-89034881 GTTGGGAGGGAAACTGAGGCAGG + Intronic
1057194797 9:93110951-93110973 CATGAGAGAGAGACGGAGGAAGG - Intronic
1057453080 9:95182885-95182907 CAGGGGAAGGTGACTGGGGAAGG + Intronic
1057510864 9:95678613-95678635 CATGGGAGGGAGGCTGAGCAGGG - Intergenic
1057754157 9:97817991-97818013 TATGGGAGGTAGACTGGAGAGGG + Intergenic
1057801923 9:98195999-98196021 CATGGCAAGGAGGCTGAGCAGGG - Intergenic
1057921821 9:99104528-99104550 CATGTGAAGGGCACTGAGGAGGG + Intronic
1058918912 9:109594554-109594576 CATGGGAGGGACCCGGAGGGAGG + Intergenic
1059017109 9:110531386-110531408 CATGGGAAGGACCCAGAGGAAGG + Intronic
1059118750 9:111622446-111622468 AATGGCAGGGAGTCAGAGGATGG - Intergenic
1059467391 9:114477652-114477674 CAGGGGAAGGACACTGAGAACGG + Intronic
1059733263 9:117077117-117077139 CAGGGGAGAGAGACAGAGGTTGG + Intronic
1059913874 9:119077128-119077150 CATGGGAGGGAAATAGTGGAGGG - Intergenic
1060215873 9:121737946-121737968 CATGGGAGGAAGAGTGAAGGTGG + Intronic
1060342751 9:122791376-122791398 CATGGGACGGAATCTGAAGAGGG + Intergenic
1060569027 9:124620934-124620956 CATGTGAGGCAGACAGAGTAGGG + Intronic
1060599549 9:124869023-124869045 CGTGGAAGGGACACTGAGGTGGG + Exonic
1060644384 9:125265520-125265542 CCCAGGAGGGAGACTGAGGCAGG - Intronic
1060969836 9:127731713-127731735 CAAGGGTGGCAGACTGAGGAGGG + Exonic
1060991393 9:127851464-127851486 TTTGGGAGGGAGGCTGAGGCGGG - Intronic
1061017482 9:127990323-127990345 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1061073673 9:128327690-128327712 CCTGGGAGGGAGTTTGAGGTAGG + Intronic
1061585256 9:131563008-131563030 AAAGGGAGGGAGGCTGAGGCCGG - Intergenic
1061775325 9:132959176-132959198 CATGGTAGGGAAACTGGGGGAGG + Intronic
1061819817 9:133220841-133220863 CGAGGGAGGGAGAGAGAGGAGGG + Intergenic
1061869136 9:133510992-133511014 CATGGGAGGGAGACACAGCTGGG + Intergenic
1061910422 9:133719452-133719474 GAGGAGAGGGAGACTGAGCAAGG + Intronic
1062170326 9:135131292-135131314 CATGGGAGGGAGAGTCTGCAGGG - Intergenic
1062218210 9:135400372-135400394 ATTGGGAGGGAAACTGAGGCAGG - Intergenic
1062385155 9:136306391-136306413 CCAGGGAGGGAGGCTCAGGAGGG - Intronic
1062391777 9:136336758-136336780 CAGGGGCGGAAGCCTGAGGACGG - Intronic
1062455899 9:136638420-136638442 CATGGGGGGAAGCCAGAGGAGGG + Intergenic
1062473277 9:136715409-136715431 CAAGGCAGAGGGACTGAGGATGG + Intronic
1202795778 9_KI270719v1_random:118694-118716 ATTGGGAGGGAGGCTGAGGTGGG - Intergenic
1203605080 Un_KI270748v1:51432-51454 CATGGGATGGAGAGAAAGGAGGG + Intergenic
1185820549 X:3198843-3198865 CATGGGAGGGAGCTGGTGGAAGG + Intergenic
1185882172 X:3751211-3751233 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
1185935933 X:4257282-4257304 CATGAGAGGGAGGCCAAGGAAGG + Intergenic
1186042128 X:5492225-5492247 CCTGGGAGGGACACTGTGGGAGG + Intergenic
1186053534 X:5625497-5625519 CATGGGAGGGACCCGGTGGAAGG - Intergenic
1186174108 X:6907093-6907115 AATGGGAGGGAGACGGTGGGAGG + Intergenic
1186255311 X:7711839-7711861 CATGGGAGGGACCCTGTGGGAGG - Intergenic
1186747212 X:12582541-12582563 GAAGGGAAGGAGACTGAGCAAGG + Intronic
1186851443 X:13583901-13583923 CATGGCAGGGATACTAAGGCAGG + Intronic
1187504301 X:19866282-19866304 CATGGCAGGGAAACTTTGGAGGG + Intronic
1188266348 X:28080694-28080716 CATGGCAGGGAGAGTGGAGAGGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188647826 X:32592026-32592048 CATGGGAGAGAGGCTGAGTGGGG + Intronic
1188732953 X:33674554-33674576 CTTGGGAGGAAGAGTGGGGATGG - Intergenic
1188737048 X:33729901-33729923 AATGGGATGGAGAGTGGGGATGG - Intergenic
1188756466 X:33969249-33969271 CATGGGGGGGAGCCTAAGGAGGG + Intergenic
1189375567 X:40463966-40463988 CTTGGGTGGGAGGCTGAGGCAGG - Intergenic
1189503373 X:41585345-41585367 CTTGGGTGGGAGAGTTAGGAAGG + Intronic
1189748894 X:44198519-44198541 CATGGGAGAGAGATTGTGCATGG + Intronic
1189773349 X:44447791-44447813 CATGGTTGGGAGGCTGAGGCAGG - Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190112637 X:47604261-47604283 AATAGGAGGGAGGCTGAGGTGGG + Intronic
1190410986 X:50136955-50136977 AATGGGAGGAGGACAGAGGAAGG - Intergenic
1190762454 X:53447895-53447917 AATGTGAGAGAGACTGAGGAAGG - Intergenic
1190805636 X:53833629-53833651 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1190912576 X:54786616-54786638 CATGGGAGGGGGCCTGTGGGAGG - Intronic
1191016318 X:55813627-55813649 CATGGAAGGGAGGCTGAGGGGGG + Intergenic
1191769186 X:64737514-64737536 CATGGGAGAAAGATTGAGGCTGG + Intergenic
1191857048 X:65635501-65635523 CAGGGGACGGAGACTGGGGTGGG + Intronic
1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG + Intergenic
1192267170 X:69546859-69546881 CACAGGAGGGAGGCTGAGGGGGG + Intergenic
1192554899 X:72081560-72081582 CATAGGAGGGAGAGAGATGAGGG - Intergenic
1192816676 X:74600910-74600932 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1192822508 X:74659372-74659394 GTTGGGAGGGAAACTGAGGCAGG - Intergenic
1193237812 X:79130573-79130595 CTCGGGAGGGAGGCTGAGGCAGG + Intergenic
1193713570 X:84908237-84908259 CATATGAGGGAGAGGGAGGAGGG + Intergenic
1194756441 X:97744171-97744193 CATGGGAGGGACACTGTGGAAGG + Intergenic
1195010631 X:100729854-100729876 CAGGGGAGGGGGAATGAGGGAGG + Intronic
1195776157 X:108408202-108408224 CTCGGGAGGGAGGCTGAGGTGGG + Intronic
1195857839 X:109349740-109349762 CAGGGGAGGTGGACTCAGGAGGG + Intergenic
1196790251 X:119458141-119458163 GATGTGAGGAAGACTGAGGAGGG + Intergenic
1198101500 X:133426155-133426177 CTTGGGAGGGAGACTGAGGTGGG - Intergenic
1198189445 X:134287909-134287931 CATGGGAGGGAGGCAGAGGGGGG + Intergenic
1198376464 X:136045096-136045118 TAGGGGAGGGAGAGTGAGGAGGG + Exonic
1198825785 X:140696574-140696596 CATGGGAGGGACCCAGTGGAAGG - Intergenic
1199235607 X:145488803-145488825 CAGGTGAGGGAGAATGAGCAAGG + Intergenic
1199982438 X:152928374-152928396 CAGGGGTGGGAGACCGGGGAAGG + Intronic
1200046920 X:153408141-153408163 CCTGGGAGGGACAGTGAGAACGG + Intergenic
1200091855 X:153639732-153639754 CATGGGCGGGGCCCTGAGGAGGG + Intergenic
1200151435 X:153953302-153953324 CAGGCCAGGGTGACTGAGGACGG - Intronic
1200226213 X:154419323-154419345 CATTGGAGGGCGTCTGTGGATGG + Intronic
1200234545 X:154461949-154461971 CTGCGGAGGGAGACAGAGGAGGG - Intronic
1201146082 Y:11066441-11066463 GATGGGAGGGAGGGAGAGGAAGG + Intergenic
1201165445 Y:11204634-11204656 CACAGGAGGGAGGCTGAGGTGGG + Intergenic
1201374753 Y:13306810-13306832 CATCGGAGGGAGACTGAGGCAGG - Intronic
1201617080 Y:15912534-15912556 CATGGGAGGGAACCTGTGGGAGG + Intergenic
1201668537 Y:16488583-16488605 CATGGGAGGGACACAGTGGGAGG - Intergenic
1201720336 Y:17089774-17089796 CATGAGAGGGATGCTCAGGAGGG + Intergenic
1202387267 Y:24337833-24337855 CATGGGATGGAGAGAAAGGAGGG + Intergenic
1202483519 Y:25332295-25332317 CATGGGATGGAGAGAAAGGAGGG - Intergenic