ID: 1119258813

View in Genome Browser
Species Human (GRCh38)
Location 14:73224470-73224492
Sequence ATGATGCCTCCAATTCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119258813_1119258816 11 Left 1119258813 14:73224470-73224492 CCTTTGAGAATTGGAGGCATCAT No data
Right 1119258816 14:73224504-73224526 GCTCTTTTAGGCAGTGTCTGTGG No data
1119258813_1119258817 26 Left 1119258813 14:73224470-73224492 CCTTTGAGAATTGGAGGCATCAT No data
Right 1119258817 14:73224519-73224541 GTCTGTGGAGTCTCCTACAGAGG No data
1119258813_1119258815 -1 Left 1119258813 14:73224470-73224492 CCTTTGAGAATTGGAGGCATCAT No data
Right 1119258815 14:73224492-73224514 TTTGTTTTCATGGCTCTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119258813 Original CRISPR ATGATGCCTCCAATTCTCAA AGG (reversed) Intergenic
No off target data available for this crispr