ID: 1119259650

View in Genome Browser
Species Human (GRCh38)
Location 14:73230208-73230230
Sequence ACTGAAAGGCAGACTGTGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119259650_1119259661 24 Left 1119259650 14:73230208-73230230 CCCGTCACAGTCTGCCTTTCAGT No data
Right 1119259661 14:73230255-73230277 CTGGAGGCCCCAGTCGACACGGG No data
1119259650_1119259660 23 Left 1119259650 14:73230208-73230230 CCCGTCACAGTCTGCCTTTCAGT No data
Right 1119259660 14:73230254-73230276 GCTGGAGGCCCCAGTCGACACGG No data
1119259650_1119259654 -5 Left 1119259650 14:73230208-73230230 CCCGTCACAGTCTGCCTTTCAGT No data
Right 1119259654 14:73230226-73230248 TCAGTGCCAATGCTGCCTGGAGG No data
1119259650_1119259657 8 Left 1119259650 14:73230208-73230230 CCCGTCACAGTCTGCCTTTCAGT No data
Right 1119259657 14:73230239-73230261 TGCCTGGAGGCCTGCGCTGGAGG No data
1119259650_1119259653 -8 Left 1119259650 14:73230208-73230230 CCCGTCACAGTCTGCCTTTCAGT No data
Right 1119259653 14:73230223-73230245 CTTTCAGTGCCAATGCTGCCTGG No data
1119259650_1119259656 5 Left 1119259650 14:73230208-73230230 CCCGTCACAGTCTGCCTTTCAGT No data
Right 1119259656 14:73230236-73230258 TGCTGCCTGGAGGCCTGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119259650 Original CRISPR ACTGAAAGGCAGACTGTGAC GGG (reversed) Intergenic
No off target data available for this crispr