ID: 1119262460

View in Genome Browser
Species Human (GRCh38)
Location 14:73245772-73245794
Sequence GCTCCTGGCCGCGGGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 209}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119262445_1119262460 9 Left 1119262445 14:73245740-73245762 CCCTCCTGGCCGATTTCCCCATT 0: 1
1: 0
2: 2
3: 19
4: 192
Right 1119262460 14:73245772-73245794 GCTCCTGGCCGCGGGCTGCTGGG 0: 1
1: 0
2: 2
3: 24
4: 209
1119262443_1119262460 14 Left 1119262443 14:73245735-73245757 CCAGCCCCTCCTGGCCGATTTCC 0: 1
1: 0
2: 3
3: 25
4: 261
Right 1119262460 14:73245772-73245794 GCTCCTGGCCGCGGGCTGCTGGG 0: 1
1: 0
2: 2
3: 24
4: 209
1119262439_1119262460 23 Left 1119262439 14:73245726-73245748 CCAGCTTCCCCAGCCCCTCCTGG 0: 1
1: 2
2: 12
3: 140
4: 1153
Right 1119262460 14:73245772-73245794 GCTCCTGGCCGCGGGCTGCTGGG 0: 1
1: 0
2: 2
3: 24
4: 209
1119262454_1119262460 -9 Left 1119262454 14:73245758-73245780 CCATTGGGATGCCCGCTCCTGGC 0: 1
1: 0
2: 1
3: 6
4: 104
Right 1119262460 14:73245772-73245794 GCTCCTGGCCGCGGGCTGCTGGG 0: 1
1: 0
2: 2
3: 24
4: 209
1119262442_1119262460 15 Left 1119262442 14:73245734-73245756 CCCAGCCCCTCCTGGCCGATTTC 0: 1
1: 0
2: 0
3: 24
4: 167
Right 1119262460 14:73245772-73245794 GCTCCTGGCCGCGGGCTGCTGGG 0: 1
1: 0
2: 2
3: 24
4: 209
1119262452_1119262460 -8 Left 1119262452 14:73245757-73245779 CCCATTGGGATGCCCGCTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1119262460 14:73245772-73245794 GCTCCTGGCCGCGGGCTGCTGGG 0: 1
1: 0
2: 2
3: 24
4: 209
1119262449_1119262460 5 Left 1119262449 14:73245744-73245766 CCTGGCCGATTTCCCCATTGGGA 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1119262460 14:73245772-73245794 GCTCCTGGCCGCGGGCTGCTGGG 0: 1
1: 0
2: 2
3: 24
4: 209
1119262450_1119262460 0 Left 1119262450 14:73245749-73245771 CCGATTTCCCCATTGGGATGCCC 0: 1
1: 0
2: 0
3: 35
4: 618
Right 1119262460 14:73245772-73245794 GCTCCTGGCCGCGGGCTGCTGGG 0: 1
1: 0
2: 2
3: 24
4: 209
1119262444_1119262460 10 Left 1119262444 14:73245739-73245761 CCCCTCCTGGCCGATTTCCCCAT 0: 1
1: 0
2: 2
3: 44
4: 388
Right 1119262460 14:73245772-73245794 GCTCCTGGCCGCGGGCTGCTGGG 0: 1
1: 0
2: 2
3: 24
4: 209
1119262446_1119262460 8 Left 1119262446 14:73245741-73245763 CCTCCTGGCCGATTTCCCCATTG 0: 1
1: 0
2: 2
3: 13
4: 96
Right 1119262460 14:73245772-73245794 GCTCCTGGCCGCGGGCTGCTGGG 0: 1
1: 0
2: 2
3: 24
4: 209
1119262441_1119262460 16 Left 1119262441 14:73245733-73245755 CCCCAGCCCCTCCTGGCCGATTT 0: 1
1: 0
2: 0
3: 17
4: 283
Right 1119262460 14:73245772-73245794 GCTCCTGGCCGCGGGCTGCTGGG 0: 1
1: 0
2: 2
3: 24
4: 209
1119262451_1119262460 -7 Left 1119262451 14:73245756-73245778 CCCCATTGGGATGCCCGCTCCTG 0: 1
1: 0
2: 1
3: 10
4: 92
Right 1119262460 14:73245772-73245794 GCTCCTGGCCGCGGGCTGCTGGG 0: 1
1: 0
2: 2
3: 24
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119262460 Original CRISPR GCTCCTGGCCGCGGGCTGCT GGG Intronic