ID: 1119263232

View in Genome Browser
Species Human (GRCh38)
Location 14:73250504-73250526
Sequence CTTTCTAGGGAGCAGAAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 225}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119263232_1119263246 11 Left 1119263232 14:73250504-73250526 CCGACCTTCTGCTCCCTAGAAAG 0: 1
1: 0
2: 0
3: 21
4: 225
Right 1119263246 14:73250538-73250560 GGAAAGGGGGCCTCATTCCCAGG 0: 1
1: 0
2: 0
3: 21
4: 201
1119263232_1119263238 -10 Left 1119263232 14:73250504-73250526 CCGACCTTCTGCTCCCTAGAAAG 0: 1
1: 0
2: 0
3: 21
4: 225
Right 1119263238 14:73250517-73250539 CCCTAGAAAGGGAATTCCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 133
1119263232_1119263249 27 Left 1119263232 14:73250504-73250526 CCGACCTTCTGCTCCCTAGAAAG 0: 1
1: 0
2: 0
3: 21
4: 225
Right 1119263249 14:73250554-73250576 TCCCAGGAGTTCTAGCCACCGGG 0: 1
1: 0
2: 0
3: 15
4: 219
1119263232_1119263248 26 Left 1119263232 14:73250504-73250526 CCGACCTTCTGCTCCCTAGAAAG 0: 1
1: 0
2: 0
3: 21
4: 225
Right 1119263248 14:73250553-73250575 TTCCCAGGAGTTCTAGCCACCGG 0: 1
1: 0
2: 2
3: 20
4: 149
1119263232_1119263240 -5 Left 1119263232 14:73250504-73250526 CCGACCTTCTGCTCCCTAGAAAG 0: 1
1: 0
2: 0
3: 21
4: 225
Right 1119263240 14:73250522-73250544 GAAAGGGAATTCCCAGGGAAAGG 0: 1
1: 0
2: 3
3: 47
4: 360
1119263232_1119263251 28 Left 1119263232 14:73250504-73250526 CCGACCTTCTGCTCCCTAGAAAG 0: 1
1: 0
2: 0
3: 21
4: 225
Right 1119263251 14:73250555-73250577 CCCAGGAGTTCTAGCCACCGGGG 0: 1
1: 0
2: 0
3: 27
4: 353
1119263232_1119263253 29 Left 1119263232 14:73250504-73250526 CCGACCTTCTGCTCCCTAGAAAG 0: 1
1: 0
2: 0
3: 21
4: 225
Right 1119263253 14:73250556-73250578 CCAGGAGTTCTAGCCACCGGGGG 0: 1
1: 0
2: 1
3: 6
4: 123
1119263232_1119263241 -4 Left 1119263232 14:73250504-73250526 CCGACCTTCTGCTCCCTAGAAAG 0: 1
1: 0
2: 0
3: 21
4: 225
Right 1119263241 14:73250523-73250545 AAAGGGAATTCCCAGGGAAAGGG 0: 1
1: 0
2: 7
3: 49
4: 479
1119263232_1119263242 -3 Left 1119263232 14:73250504-73250526 CCGACCTTCTGCTCCCTAGAAAG 0: 1
1: 0
2: 0
3: 21
4: 225
Right 1119263242 14:73250524-73250546 AAGGGAATTCCCAGGGAAAGGGG 0: 1
1: 0
2: 5
3: 40
4: 374
1119263232_1119263243 -2 Left 1119263232 14:73250504-73250526 CCGACCTTCTGCTCCCTAGAAAG 0: 1
1: 0
2: 0
3: 21
4: 225
Right 1119263243 14:73250525-73250547 AGGGAATTCCCAGGGAAAGGGGG 0: 1
1: 0
2: 5
3: 41
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119263232 Original CRISPR CTTTCTAGGGAGCAGAAGGT CGG (reversed) Intronic
900775856 1:4585113-4585135 CATTTTAGGGAGAAGAAGGGGGG + Intergenic
901147985 1:7080835-7080857 CTTTCTAGCTAGTAGAAGGGTGG + Intronic
903019790 1:20386059-20386081 GTTTCTGGAGGGCAGAAGGTGGG - Intergenic
905136827 1:35807038-35807060 GTTTCTAGTCAGCAGAAGGAAGG - Intergenic
905816224 1:40953040-40953062 GTTTCTCTGGAGGAGAAGGTGGG - Intergenic
907365893 1:53959482-53959504 CTTTTTATGGGGCAGTAGGTAGG - Intronic
907707575 1:56845981-56846003 CTTTGAAGGAAGCAGAAGGAAGG - Intergenic
908416047 1:63914385-63914407 CTTCCTAGGGAGAGGAAGGCAGG + Intronic
909869568 1:80722657-80722679 GTTTCTCAGGAGCAGGAGGTGGG + Intergenic
910161057 1:84272639-84272661 CTTTCTAAAGAGCAGCAGCTGGG - Intergenic
914514025 1:148358373-148358395 GTTTCTAGGGAGCAGTTGTTGGG - Intergenic
918555000 1:185788314-185788336 CTTTGTAAGAAGGAGAAGGTTGG - Intronic
919040100 1:192375982-192376004 CTTTCTCCAGAGCAGAAGATAGG - Intergenic
919763224 1:201111278-201111300 CCTTCTAGGGAACAGCTGGTAGG + Intronic
920564434 1:206962151-206962173 CGTTCTAGGAAGGAGAAAGTGGG - Intronic
920915426 1:210254379-210254401 CCCCCCAGGGAGCAGAAGGTGGG - Intergenic
923041091 1:230320171-230320193 CTCTTTAGGGAGCAGAGTGTGGG + Intergenic
923065974 1:230517809-230517831 CTTTGCAGGGAGCAGGAGCTTGG + Intergenic
924318732 1:242825626-242825648 GTGTCTAGGGAGAAGAAGCTTGG - Intergenic
924781225 1:247149662-247149684 GTTTCCAGGGGCCAGAAGGTAGG + Intronic
1063523938 10:6766419-6766441 CATTCGAGAGAGCAGAAGGCAGG - Intergenic
1063580857 10:7305468-7305490 CTTGCTAGGGGGCTGGAGGTGGG - Intronic
1064724231 10:18261161-18261183 CTTACCTGGGAGTAGAAGGTGGG + Intronic
1065430765 10:25653110-25653132 CTTTCTAGGGAAGGGAAGGGAGG - Intergenic
1065967190 10:30779879-30779901 CTCTCTGGGAAGCAGAAGGCAGG - Intergenic
1066378322 10:34879656-34879678 GTTTCTAGGAGGCAGAAGGAAGG + Intergenic
1067046502 10:42988296-42988318 CTTTTCATGGAGCAGAAGCTGGG + Intergenic
1067412748 10:46079210-46079232 CTTTATAGAGAGCACAAGGAGGG - Intergenic
1067982633 10:51104255-51104277 ATTTCTAGGGTGCAGAATTTGGG + Intronic
1068688054 10:59889477-59889499 CTTTGTGGACAGCAGAAGGTTGG - Intronic
1071593799 10:86902724-86902746 CTGTTCAGGGAGAAGAAGGTGGG - Intronic
1072674419 10:97454735-97454757 CTTTCTCGAAAGGAGAAGGTGGG - Exonic
1073477571 10:103764277-103764299 GTTTCTAGTGAGCAGGAGGAAGG + Intronic
1073761806 10:106637224-106637246 CTTGCTTGGGAACAGAAGATAGG - Intronic
1074847145 10:117408363-117408385 ATTTATAGGGACCAGAAGTTAGG - Intergenic
1080347067 11:31336856-31336878 CATTCTAGGTAGCAGAAGGAAGG - Intronic
1080781400 11:35433078-35433100 CTTTCTAGGGCCTGGAAGGTGGG + Intronic
1083031304 11:59595131-59595153 TTTTTTAGGGAGTAGAAGGGTGG - Intronic
1083143471 11:60740254-60740276 CTTTCTCTGGAGCAGAGGGTGGG - Intronic
1083834785 11:65259110-65259132 CATTCCAGGTAGCAGAAAGTAGG - Intergenic
1083877726 11:65533076-65533098 CTTTCCAGGGCACAGAGGGTGGG + Intronic
1084662444 11:70554079-70554101 CTTTGTGGGGAGCAGATGGTAGG + Intronic
1084685541 11:70692622-70692644 CTCTCTAGGGAGAAGAACTTGGG + Intronic
1084721743 11:70910379-70910401 GTTTTCAGGGAGCAGAGGGTGGG + Intronic
1085145246 11:74190182-74190204 CTATCAAGGGACCAGAAGGTGGG - Intronic
1085464522 11:76714891-76714913 CTGTAGAGGGCGCAGAAGGTGGG - Intergenic
1086204892 11:84246056-84246078 CATTCTGGGGACCAGGAGGTGGG - Intronic
1086605668 11:88693397-88693419 CTTTCGAGGAAGCAGAACCTGGG + Intronic
1086933396 11:92718280-92718302 CTTTCTGGGGAGAACAGGGTGGG + Intronic
1087158330 11:94925727-94925749 TTTTATAGGGAGGAGTAGGTGGG + Intergenic
1087965460 11:104407515-104407537 CATTCTAGGAAGCTGAAGATGGG - Intergenic
1089358221 11:117869638-117869660 CTTTCTAGGGAAGAGAAACTTGG + Intronic
1089440361 11:118510904-118510926 CTCTCTAGGAAGAAGAAGGGAGG + Intronic
1093203177 12:16214511-16214533 ACTTCTGGGGAGCAGAAGGAGGG + Intronic
1095851784 12:46817183-46817205 TTTTTTAGTGAGCAAAAGGTGGG - Intronic
1096616304 12:52835138-52835160 CTTTGGAGGGAGCTGGAGGTGGG + Intergenic
1097776855 12:63657332-63657354 CTTTCTAGGGAGCAGCACAAAGG - Intronic
1098204235 12:68090371-68090393 CATTCTAAGGGGCAGAAGGAGGG - Intergenic
1099702478 12:86104520-86104542 ATTTCTGGGGAGCAGGAGATGGG + Intronic
1099748871 12:86745079-86745101 CCCTCTAGGGAAGAGAAGGTTGG - Intronic
1101351682 12:103935522-103935544 CTTTCTAGGATGAAGAAAGTTGG - Intronic
1103524568 12:121559229-121559251 CCGTCTTAGGAGCAGAAGGTCGG + Intronic
1106068753 13:26385781-26385803 ATTTCTAGGTAGTAGAATGTTGG - Intronic
1108764692 13:53612394-53612416 CTTCCTCCAGAGCAGAAGGTAGG - Intergenic
1109609085 13:64739724-64739746 CTTTCAAGGTAGCTCAAGGTAGG - Intergenic
1111007050 13:82261758-82261780 TTTCCTAGGGAGAAGAAGCTTGG + Intergenic
1113797100 13:113064870-113064892 CTTTCAGGGCAGCAGGAGGTGGG + Intronic
1113883531 13:113644131-113644153 GTTACTTGGGAGCATAAGGTGGG - Intergenic
1114424889 14:22613240-22613262 TTTTATAGGGAGGAGAAGGCAGG + Intergenic
1114881271 14:26788990-26789012 CATTCTAGGGAGTAGAAAGTAGG + Intergenic
1116532312 14:45988122-45988144 CTTTCTATGGAGCATAGGGTTGG - Intergenic
1117401884 14:55365761-55365783 CTTTATCTGGAGCAGAAGGCTGG - Intergenic
1119263232 14:73250504-73250526 CTTTCTAGGGAGCAGAAGGTCGG - Intronic
1119426538 14:74539023-74539045 CATTATGAGGAGCAGAAGGTGGG + Intronic
1122428516 14:101625420-101625442 CTTTCTGGGAAGCAGAAAGTGGG - Intergenic
1124225371 15:27889142-27889164 CTTTCTAGTAACCAAAAGGTTGG + Intronic
1127292848 15:57585650-57585672 TTTTCTAGGGCACAGAAGGGTGG + Intergenic
1127314530 15:57782179-57782201 CTTTCTAGTAACCAAAAGGTTGG - Intronic
1129953637 15:79613673-79613695 GTTTCCAGGGAGCAGAAGTGGGG - Intergenic
1132655023 16:1038208-1038230 CCTTCCAGGGAGCAGAGGGCTGG - Intergenic
1132765887 16:1534016-1534038 CATCCCAGGGAGCAGAGGGTGGG - Exonic
1136401816 16:30023413-30023435 CTGTCTTGGGAGCAGCAGGAAGG + Intronic
1136636514 16:31527791-31527813 CATTCTAGGGAGGAGAAGAAGGG - Intergenic
1137813655 16:51377312-51377334 ATGTCTTGGGAGCAGAATGTGGG + Intergenic
1137834027 16:51573238-51573260 CAGAGTAGGGAGCAGAAGGTGGG + Intergenic
1138717548 16:59041613-59041635 CTCTCAGGGGAGCAGAAGTTTGG + Intergenic
1139753815 16:69126851-69126873 GTTTCTAGGGCACAGTAGGTAGG + Intronic
1141667781 16:85474724-85474746 CTTGTTGGGGAGGAGAAGGTGGG - Intergenic
1143739796 17:8944040-8944062 CTTACTTGAGAGCAGAGGGTGGG - Intronic
1143854045 17:9835289-9835311 CCTAATAGGGAGCAGATGGTGGG + Intronic
1144601993 17:16624639-16624661 TTTTTTAGTGAGAAGAAGGTAGG + Intronic
1145808804 17:27752708-27752730 CTTTCTTGGGAGCAAGAGGGAGG + Intergenic
1145917558 17:28584533-28584555 CTTGCTTTGGAGCAGAAGTTTGG - Intronic
1148450133 17:47772072-47772094 CTTTCTAGGCAGCAGGATGGAGG + Intergenic
1149944441 17:60906550-60906572 GATTCTAGGAAGCAGGAGGTAGG - Intronic
1151198796 17:72452607-72452629 CTGTTTAGAGAGCAGGAGGTGGG + Intergenic
1151512739 17:74571171-74571193 CTCTCTAGGGAGCAGGGTGTGGG + Intergenic
1151888075 17:76934964-76934986 CCTTCCAGGGAGCAGGAGCTGGG + Intronic
1151904651 17:77039755-77039777 CCTTCTAGGGAGGCAAAGGTTGG - Intergenic
1152013171 17:77733252-77733274 CTTTCTGGGGAAAAGATGGTGGG - Intergenic
1152040354 17:77898905-77898927 CTTTCTTGGTTGCAGAAGCTTGG - Intergenic
1152201807 17:78951784-78951806 ACTTCTAGGCAGGAGAAGGTGGG + Intergenic
1153160200 18:2196232-2196254 CTTTCCAGGAAGAAGAAGGCTGG + Intergenic
1156362627 18:36397852-36397874 CATTCTAGGCAGCAGAAAGGAGG + Intronic
1157569616 18:48703833-48703855 CTTTCTGGAGAGGAGAAGGGAGG + Intronic
1157881081 18:51321637-51321659 CTGTGGAGGCAGCAGAAGGTGGG + Intergenic
1158934100 18:62348816-62348838 CATTCTGGGGAGGGGAAGGTGGG + Intronic
1160132658 18:76242184-76242206 CTTTCTATGAACCAGAAAGTGGG + Intergenic
925085096 2:1101455-1101477 GTTTTTAGGGATCAGAAGCTTGG + Intronic
925820142 2:7792186-7792208 CTTTTTTGGGAACAGAGGGTTGG + Intergenic
926072349 2:9907905-9907927 CTTGGAAGGGAGCAGAGGGTGGG - Intronic
928263092 2:29785470-29785492 CTTTCTATTTAACAGAAGGTAGG - Intronic
930502108 2:52234353-52234375 CTTTATAGGGACTAGAATGTAGG + Intergenic
931704258 2:64934094-64934116 CTCTCCAGGCAGCAGCAGGTAGG + Intergenic
936184296 2:110291281-110291303 CTTTGGAGGAAGCGGAAGGTGGG - Intergenic
936725085 2:115304446-115304468 CTTTCTAAGAAGCACAAGGAAGG - Intronic
936783534 2:116063998-116064020 ATCTCTGGGGAACAGAAGGTGGG + Intergenic
936947482 2:117943531-117943553 CCTCCCAGGGAACAGAAGGTTGG + Intronic
939515425 2:143161557-143161579 ATTTCAAGGGACCACAAGGTTGG + Intronic
939948880 2:148444805-148444827 CTGTCTGGGGAGCAGAGGGGTGG - Intronic
940484626 2:154281829-154281851 CTTTTGAGGGAGCAGCTGGTGGG - Intronic
940866308 2:158820813-158820835 CTTTATAAGGAGAAGAAGGGAGG + Intronic
940985737 2:160050301-160050323 CTTTCTAGGGAGGACAAAGCAGG + Intronic
941624314 2:167813969-167813991 CAGTTTAGGGTGCAGAAGGTAGG - Intergenic
942076329 2:172359904-172359926 CATTCTAGGGAGCAGGGGTTAGG + Intergenic
942771120 2:179521642-179521664 CTTTTTAGAGAGCAGATGGATGG - Intronic
942924994 2:181420900-181420922 CTTTCTGAGGAACAGAGGGTTGG - Intergenic
943100108 2:183477963-183477985 TTTTGCAGGGAGGAGAAGGTGGG - Intergenic
943276876 2:185878540-185878562 TCTTCTAGGCAGCAGATGGTTGG - Intergenic
945973321 2:216251601-216251623 CTTTCTTGGTGGCAGAAGATGGG + Intergenic
946083789 2:217150723-217150745 CTTTCTATGGAGCGGTAGGCTGG + Intergenic
948453261 2:238091902-238091924 CTCTCGGGGAAGCAGAAGGTGGG - Intronic
1168997750 20:2145559-2145581 CTTCCTTGTGAGCAGAAGGTTGG + Exonic
1170734936 20:19006396-19006418 CTTTCTTGGCAGGAGGAGGTGGG + Intergenic
1171815730 20:29784638-29784660 ATTTCTGGTGAGCAGAAGATGGG + Intergenic
1172176767 20:32977218-32977240 CTTCCTGGGGAGCAGAGGTTAGG + Intergenic
1172792723 20:37517263-37517285 CTTTCTGGAGAGCAGATGGTGGG - Intronic
1173009465 20:39168636-39168658 CTATCTTGGGCACAGAAGGTAGG - Intergenic
1173351457 20:42249302-42249324 CTTTATAGGGAACAAATGGTAGG + Intronic
1173548583 20:43916623-43916645 GTTTTCAGGGAGGAGAAGGTTGG + Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174434992 20:50499930-50499952 AATTCTAGGGAGAAGAAGTTAGG - Intergenic
1174917799 20:54671585-54671607 CTTTTTAGGGAGGAGAGGGGTGG - Intergenic
1174935970 20:54869077-54869099 CATTCTGGGGTGCAGCAGGTAGG - Intergenic
1178629852 21:34250007-34250029 CATTCTAGGGGCCAGACGGTGGG + Intergenic
950167808 3:10814907-10814929 CTTTCTGGGGAGATGGAGGTTGG + Intergenic
951586647 3:24221671-24221693 CTTTATAGAGAGTAGAAGGTGGG - Intronic
953784750 3:45902754-45902776 TTTTCTAGGGAGCAGACAGACGG - Exonic
955676133 3:61450708-61450730 CTTTTTTGGTAGCAAAAGGTGGG + Intergenic
956737851 3:72252075-72252097 TTTTCAAGGGAACATAAGGTAGG + Intergenic
957404665 3:79762205-79762227 CTGTCTATGAAGCAGAAAGTGGG - Intronic
957772256 3:84708873-84708895 TTTTGTAGGAAGCAGATGGTTGG - Intergenic
963509658 3:146231017-146231039 CCTTCTGGAGGGCAGAAGGTGGG - Intronic
964677309 3:159297996-159298018 CATTCTAGTGAGCAGAAGACTGG - Intronic
964774600 3:160262034-160262056 TTGTCTAGGGAGCAGAATATAGG - Intronic
964781115 3:160338845-160338867 TGTTCTAGGGAGCAGAATGTAGG - Intronic
965350396 3:167604832-167604854 CCATCTAGGAAGCAGAAAGTAGG + Intronic
965742156 3:171886718-171886740 CTTTCTGGGGAGAATATGGTAGG - Intronic
965993232 3:174845800-174845822 CTTCCTAGGTTGCAGAAGGTAGG + Intronic
967276469 3:187780326-187780348 GTGTGTAGGGGGCAGAAGGTTGG - Intergenic
968771494 4:2510438-2510460 CTTTCTAGGGAGGAGAGGCCTGG + Intronic
968792276 4:2674479-2674501 GAATGTAGGGAGCAGAAGGTGGG + Intronic
969285865 4:6201347-6201369 CTTTCTAGCAAGGAGAAGGCAGG + Intergenic
969452587 4:7283353-7283375 TTTGCAGGGGAGCAGAAGGTGGG + Intronic
969534882 4:7749932-7749954 CTTACGAGGGAATAGAAGGTAGG + Intergenic
969637521 4:8377938-8377960 CTGTCTAGGGGGCAGCTGGTGGG - Intronic
969638062 4:8380871-8380893 CTGTCTAGGGGGCAGCCGGTGGG - Intronic
970459422 4:16257790-16257812 GTTCCTAGGGAACAGAAGGGAGG - Intergenic
971341687 4:25775035-25775057 GTTTGTAGGGAGCAGAGGGTGGG + Intronic
971403211 4:26295472-26295494 CTTTTTAGGAAGCAGAAAGTTGG + Intronic
973250983 4:48059672-48059694 CTTTCTAGAGAGCAGTGGCTAGG + Intergenic
974019088 4:56677048-56677070 CTTTCTCAGGAGCAGAAGGCTGG - Intronic
975624800 4:76335386-76335408 CTTTCTGGTGGGCAGAAGATGGG - Intronic
976249991 4:83040585-83040607 TCTTGTAGGGAGGAGAAGGTGGG - Intronic
977507146 4:97916560-97916582 CTTCTTCAGGAGCAGAAGGTTGG + Intronic
978311528 4:107389121-107389143 CTTTCTATGGGGCAGGAGTTGGG - Intergenic
979503439 4:121466675-121466697 CTTTCTAGGGAGAGCAAGGCCGG + Intergenic
981052898 4:140328820-140328842 CATTTTTGGGAGCAGTAGGTTGG - Intronic
983935628 4:173500960-173500982 CCTTCCGGGGAGCAGAAGGCCGG + Intergenic
987121946 5:14776083-14776105 CTTCCCAGGGAGCAGAGTGTGGG + Intronic
988080825 5:26412234-26412256 TTTGCTAGGAAGGAGAAGGTGGG - Intergenic
990927679 5:61046990-61047012 CTTTCTAGGCAGAAGAAGTATGG + Intronic
991519050 5:67474719-67474741 ATTTGTTGGGAGCAGAAGGTCGG + Intergenic
996324393 5:122256278-122256300 TTTTATAGGCAGCAGATGGTTGG + Intergenic
997192194 5:131947552-131947574 CTTTCTAAAGAACAGATGGTAGG + Intronic
998495360 5:142583739-142583761 CTTTCTACGAACCAGAAAGTGGG - Intergenic
1002038797 5:176495363-176495385 CTTTGCAGGGGGCAGAAGGGAGG + Intronic
1002869391 6:1152380-1152402 CTCACTAGGGAGAAGAACGTTGG + Intergenic
1008677670 6:53837732-53837754 CTTTCTAAAAAGCAGAAGGGAGG + Intronic
1009211669 6:60870006-60870028 CTCCCTAGGGAGCTGAAGATAGG + Intergenic
1009909576 6:69909190-69909212 CTTTCTAAGGAAAAGAGGGTAGG + Intronic
1011733724 6:90292916-90292938 CTTGCTAGGGAACAGTTGGTAGG - Intronic
1013015019 6:106153078-106153100 CTTTCTTGGGTGGAGATGGTTGG + Intergenic
1013174941 6:107668956-107668978 GCTTCCAGGGAGCAGAAGGAGGG + Intergenic
1014308742 6:119772204-119772226 CTTCCTAGGGAGCAGAGGACAGG + Intergenic
1015955565 6:138594637-138594659 CTTCCTAGGAAGCAGAAGAGTGG - Intronic
1017773245 6:157659685-157659707 CTTTCCAAGGCGCAGAGGGTGGG - Intronic
1019037742 6:169075956-169075978 CCTTCAATGGAGCAGAAAGTGGG + Intergenic
1022699822 7:32749279-32749301 CTTTCTAGGGAGCAGCACAAAGG - Intergenic
1022935774 7:35174991-35175013 CTTTCTAGGGAGCAGCAAAAAGG - Intergenic
1023803325 7:43853606-43853628 CCTTCTAGGTAGAGGAAGGTTGG - Intergenic
1023939305 7:44759729-44759751 CTGTGCAGGGAGCAGCAGGTGGG + Intronic
1024010043 7:45259446-45259468 TTTTCTAGGGAGCAGCAGGATGG - Intergenic
1024519792 7:50295008-50295030 CTTCCTGGGGAGGAGAAGATTGG + Intergenic
1025207261 7:57001047-57001069 CTCACTAGGGAGCTGGAGGTCGG + Intergenic
1025664674 7:63575839-63575861 CTCACTAGGGAGCTGGAGGTCGG - Intergenic
1026260396 7:68749908-68749930 CTTTCTAGGTCACAGAAGGATGG + Intergenic
1027715158 7:81660011-81660033 CTCTCTAGGGAGGAAAAGATGGG + Intergenic
1029831732 7:103267728-103267750 CTTTCTAGGGAGCAGCACAAAGG - Intergenic
1031326192 7:120401501-120401523 ATTTCTAGGGAGCACACAGTGGG + Intronic
1031677629 7:124631166-124631188 CTTTCTAAGGAGGAGAAGCTTGG - Intergenic
1031983846 7:128149667-128149689 CTTGCTGGGGAGGAGGAGGTGGG + Intergenic
1032395729 7:131588446-131588468 CTTTCTAGGGTGGAGAGGATGGG - Intergenic
1033227115 7:139571100-139571122 GGTTCTAGTGGGCAGAAGGTTGG - Exonic
1034585441 7:152087526-152087548 CTTTGTAGGGAGCAGATGGGTGG + Intronic
1039462173 8:37754262-37754284 CTTTCTAGGGAAAGGAGGGTGGG + Exonic
1042421598 8:68596769-68596791 CTTGCTAAGGTGCAGAAGGCAGG - Intronic
1043106294 8:76115982-76116004 CTTTCTTGGGAGCAGGGGTTTGG - Intergenic
1044245065 8:89934367-89934389 CTTCCTAGGGAACAGAAATTGGG - Exonic
1044928305 8:97228098-97228120 CACTCAAGGGAGAAGAAGGTGGG + Intergenic
1044934069 8:97277158-97277180 CTTCCTGGAGAGCCGAAGGTAGG + Exonic
1046070467 8:109246965-109246987 ATTGCTGGGGAGCAGAAGATGGG - Intronic
1046375489 8:113374431-113374453 TTTTCTAGAGATAAGAAGGTTGG + Intronic
1048685229 8:136897487-136897509 ACTTCTATGGAGCAGAATGTGGG + Intergenic
1053008104 9:34617581-34617603 CTGTCTAGTGAGCAGAAGTGAGG + Intronic
1053476298 9:38384413-38384435 CATTCTAGGGATCAGAAGGCGGG - Intergenic
1055581118 9:77707514-77707536 CTTCCTACTGAGCAGAAAGTTGG - Intergenic
1056770701 9:89476035-89476057 CTTCCTAAGAAGCAGAAGGTCGG + Intronic
1057050295 9:91918353-91918375 CTTTATAGGGAGCCTAGGGTTGG - Intronic
1058975915 9:110125439-110125461 CCTTTTAGGGAGCAGAGGGAGGG + Intronic
1059075209 9:111185721-111185743 CTTTCCAGGGAGCATCAGCTTGG + Intergenic
1059399288 9:114058912-114058934 CTTTCTGGGCAGAAGCAGGTGGG - Intergenic
1059553412 9:115253083-115253105 ATTTCTAGGAACCAGAAAGTGGG + Intronic
1059626519 9:116072945-116072967 CTATCTAGGGAAGGGAAGGTGGG + Intergenic
1059917091 9:119116228-119116250 CTTTCTAACTAGCAGAAGTTTGG + Intergenic
1060173427 9:121479973-121479995 CTATTTTGGGAGCAGGAGGTGGG - Intergenic
1060401665 9:123353246-123353268 CTTTCCAGGAAGCAGATGGAAGG + Intergenic
1061594987 9:131623150-131623172 CTTTTTAGGGAGCAGTTTGTGGG - Intronic
1062265914 9:135686404-135686426 CTTTCTGAGGAGCAGGAGCTGGG - Intergenic
1194247017 X:91526918-91526940 CTTTAAAGGGAGCAGAAGAAGGG + Intergenic
1194958467 X:100208381-100208403 CTTTCAAGGGAGGAGGAGGGAGG - Intergenic
1195274518 X:103268501-103268523 CTTCCTAGGGAGCAGTAGAAAGG - Intergenic
1195702115 X:107713439-107713461 CTTTCAAGTGAACAGAAGGATGG - Exonic
1195936993 X:110134939-110134961 CTCTCTGGGGAGTAGGAGGTGGG - Intronic
1196623064 X:117846212-117846234 CTTTCCAGGCAGCAGAAAGGAGG - Intergenic
1196758164 X:119176252-119176274 CTATCCAGGGGGCAGTAGGTAGG + Intergenic
1200419681 Y:2951423-2951445 ATTTCTAGGGATCAGAAAATAGG + Intronic