ID: 1119264237

View in Genome Browser
Species Human (GRCh38)
Location 14:73254712-73254734
Sequence CAGGGTCAGGCAGCAGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 478}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119264237_1119264244 -8 Left 1119264237 14:73254712-73254734 CCCACACCTGCTGCCTGACCCTG 0: 1
1: 0
2: 2
3: 42
4: 478
Right 1119264244 14:73254727-73254749 TGACCCTGGTCTCTGGCAGGTGG 0: 1
1: 0
2: 4
3: 28
4: 234
1119264237_1119264247 15 Left 1119264237 14:73254712-73254734 CCCACACCTGCTGCCTGACCCTG 0: 1
1: 0
2: 2
3: 42
4: 478
Right 1119264247 14:73254750-73254772 CTGCACCCGAGCGCCGTCCTTGG 0: 1
1: 0
2: 0
3: 5
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119264237 Original CRISPR CAGGGTCAGGCAGCAGGTGT GGG (reversed) Intronic
900096215 1:941151-941173 GAGGGTCCGGCAGGAGGTGGCGG + Exonic
900245543 1:1634483-1634505 CAGGGCCAGGTAGCCGGGGTAGG - Exonic
900256772 1:1701640-1701662 CAGGGCCAGGTAGCCGGGGTAGG - Intronic
900376516 1:2357297-2357319 CAGGGTCAGTCATCACGCGTGGG - Intronic
900886171 1:5417069-5417091 CGGGGTGAGGAGGCAGGTGTGGG - Intergenic
901656736 1:10773678-10773700 CAGGACAAGGCAGCAGGTGGGGG + Intronic
901764102 1:11489079-11489101 CAGGCCCAGGCAGCAGGGGACGG + Intronic
901971595 1:12913004-12913026 CAGGGGGAGGCAGAGGGTGTGGG + Intronic
902013572 1:13288736-13288758 CAGGGGGAGGCAGAGGGTGTGGG - Intergenic
902181016 1:14688385-14688407 CTGTGCCAGGCAGCAGGTGCTGG + Intronic
902450716 1:16495139-16495161 CAGGGTCACACAGCTGGTGAGGG - Intergenic
902502151 1:16918200-16918222 CAGGGTCACACAGCTGGTGAGGG + Intronic
902652020 1:17843363-17843385 CAGGGAGGGGCAGCAGATGTGGG + Intergenic
902709692 1:18230306-18230328 CAAGGTTAGGCAGCAAGAGTGGG - Intronic
902776843 1:18680303-18680325 CAGGGTCACACAGCAGGTCATGG + Intronic
904038681 1:27572019-27572041 CAGGGTCTGGCAGGAGCTGAGGG - Intronic
905402569 1:37714409-37714431 CCAGGACAGGCTGCAGGTGTGGG - Intronic
905482580 1:38271590-38271612 GAGGCTCAGGCAGCAGGTAGGGG - Intergenic
906932329 1:50182076-50182098 CTGGGACAGGCATCAGGTGTGGG - Intronic
907383457 1:54110172-54110194 GAGGGTCAGGCATAAGGTGATGG - Intronic
907997258 1:59645251-59645273 CAGCGCCAGACAGTAGGTGTTGG + Intronic
910559486 1:88575344-88575366 CAGAGTGAGGAAGCAGGAGTGGG - Intergenic
915085042 1:153380747-153380769 GAGGCACAGGCAGCAGCTGTTGG + Intergenic
915245335 1:154552282-154552304 CAGGGTCCCGGAGCGGGTGTGGG - Intronic
915763030 1:158334741-158334763 CAGGGGCAGGAAGCAGGTGGTGG + Intergenic
917439751 1:175056799-175056821 CAGGGCCTGTCAGCAGGTGGGGG - Intergenic
917637436 1:176950704-176950726 CAAGGTCAAGCAGCAGGAGTCGG + Intronic
917651937 1:177086197-177086219 TAGGGAAAGGCAGCAGGTGGGGG - Intronic
918306390 1:183250577-183250599 CCAGGTCAGCCAGCAGGTGTAGG - Exonic
919793632 1:201308196-201308218 CAGGGTGAGGCAGCCTGTGCCGG - Intronic
920197873 1:204241588-204241610 CAGGGTGTGGCACCAGGTTTTGG + Intronic
920207644 1:204304293-204304315 CAGGGTCAGGCCCCCGGTGAAGG - Intronic
920291421 1:204925892-204925914 CAGGGTGAGGAAGCTGGGGTTGG + Intronic
921519242 1:216139180-216139202 CAAGGTCAGAAAGCAAGTGTGGG + Intronic
921584513 1:216931513-216931535 AAGGCTGAGGCAGCAGGGGTGGG - Intronic
922794875 1:228335056-228335078 TAGGGGCAGGCAGGAGGTGGTGG - Intronic
923708012 1:236360973-236360995 CAGGGCCTGGAAACAGGTGTTGG + Intronic
923820174 1:237429523-237429545 CAGGGTCAGGCAGCAGTCTGTGG - Intronic
1062824572 10:558302-558324 CAGGGTCAGGAAGCGGGAGGTGG - Intronic
1065998086 10:31078608-31078630 GAGGGTCAGGAAACAGGTCTAGG + Intergenic
1066139929 10:32494548-32494570 CAGGGCCTGTCAGCAGGTGGGGG - Intronic
1067016339 10:42758564-42758586 CAGGGCCAGGCAGCAGGCAGTGG - Intergenic
1067233098 10:44425660-44425682 CAGGGTCATGCATCTGGTGAGGG - Intergenic
1067247282 10:44557512-44557534 CCGGGAAAGGCAGCAGGGGTAGG - Intergenic
1067575161 10:47404199-47404221 CAAGCTCAGGCAGCTGGAGTTGG + Intergenic
1070322496 10:75364901-75364923 CAGGCTCAGAGAGCAGGTTTAGG + Intergenic
1070550271 10:77485740-77485762 CAGGGTCAGAGAGCAGGCCTTGG + Intronic
1070833905 10:79436230-79436252 CAGGCTGAGGCAGCAAGTGTGGG - Intronic
1071455331 10:85845634-85845656 CAGGGTCAGTCAGGAGGTGGAGG - Intronic
1071692998 10:87842434-87842456 CAGGGTAAGGCAGTAGGTAATGG + Intergenic
1072871427 10:99124695-99124717 CAAGGCCAGACAGCAGGAGTAGG + Intronic
1072973617 10:100038683-100038705 CCCGGGCAGGCAGCAGGGGTGGG - Intergenic
1073558946 10:104480977-104480999 CAGGGTCAGGCTGTGGGTCTGGG + Intergenic
1073632566 10:105163092-105163114 AGGGTTCAGGCAGTAGGTGTGGG - Intronic
1074572777 10:114639510-114639532 CAGGGTCACTCAGCATGTGGTGG - Intronic
1074857857 10:117486615-117486637 CAGGGTCTGGCATCAGCTCTGGG - Intergenic
1075428542 10:122362056-122362078 GAGACTCAGGCAGCAGGTGCAGG + Intergenic
1076116741 10:127906690-127906712 CCTGGTCTTGCAGCAGGTGTGGG - Intergenic
1076697982 10:132256269-132256291 CAGGGTCCTGCTGGAGGTGTAGG - Intronic
1076907915 10:133372698-133372720 CAGGGTCAGGTGGGTGGTGTCGG + Intronic
1077055769 11:592263-592285 TAGGGCGAGGCAGCAGGTGCTGG - Intronic
1077125554 11:934051-934073 CAGGGACACACAGCAGCTGTGGG - Intronic
1077239253 11:1502154-1502176 CAGCGTCTGGCAGCAGGCCTGGG - Intergenic
1077264226 11:1641166-1641188 CAGGGTCAAGAGGCAGGTGAAGG - Intergenic
1077387426 11:2276845-2276867 CAGGGTCGGTCAGAAGGTGGGGG - Intergenic
1078078968 11:8190296-8190318 CCAGCTCAGGAAGCAGGTGTGGG - Intergenic
1078655214 11:13232557-13232579 TAGGGTCAGACTGAAGGTGTTGG - Intergenic
1078667937 11:13341470-13341492 CTGGGCCAGGCAGCAGGGGCTGG - Intronic
1079094954 11:17504186-17504208 CAGCGTCAGGGAGGAGGTGGTGG - Intronic
1080415655 11:32067750-32067772 CAAGGTCATGCAGCAAGTGTGGG - Intronic
1080656252 11:34260753-34260775 CAGGGTCATGCAAAAGGTGAGGG + Intronic
1081789359 11:45771929-45771951 CATTGTCAGGCAGCAAGTGTTGG - Intronic
1081852914 11:46286012-46286034 CAGGGTCACACAGCAAGTGAGGG - Intronic
1082080133 11:48006389-48006411 GAGGGACATGCAGCAGGTGCAGG + Intronic
1082281209 11:50273225-50273247 CAGGGTCAGGCACCTGCTGAGGG - Intergenic
1083694002 11:64430421-64430443 CTGGGTCAGCCAGGAGGTGAGGG + Intergenic
1083778381 11:64905815-64905837 CAGGGTCATCCAGCACGTCTAGG + Exonic
1083963037 11:66025116-66025138 CTGCGCCAGGCAGCAGGAGTTGG + Intronic
1084146197 11:67266574-67266596 CAGGGCCAGGCGGGAGGCGTCGG + Exonic
1084549665 11:69833816-69833838 AAGGGGCGAGCAGCAGGTGTTGG + Intergenic
1084689356 11:70716085-70716107 TGGGGTTAGGCAGCGGGTGTTGG - Intronic
1084899707 11:72300520-72300542 CAGGGGCAGGGAGCAGCTGAAGG + Intronic
1085205703 11:74730897-74730919 CAGGGTCAGGCCGCTGGTCCGGG + Exonic
1085514808 11:77105923-77105945 GAGGGGCTGGAAGCAGGTGTGGG + Intronic
1086179213 11:83930338-83930360 CAGAGTCAGGTAGCAGGCCTAGG + Exonic
1089119929 11:116126631-116126653 GAGGGCCAGGCAGCGGGTGGTGG - Intergenic
1089297886 11:117480872-117480894 CAGGCCCCTGCAGCAGGTGTGGG - Intronic
1089351819 11:117825606-117825628 CAGGGTCACACAGCCAGTGTGGG + Intronic
1089555263 11:119312520-119312542 CAGCATCAGCAAGCAGGTGTGGG - Exonic
1090059003 11:123447550-123447572 CAGGCTGAGGCAGCATGGGTTGG + Intergenic
1090401871 11:126454255-126454277 CCGGGTCAGTAGGCAGGTGTGGG + Intronic
1090529739 11:127578259-127578281 CAGGGTCACACAGCAGGTAGAGG + Intergenic
1091015855 11:132050241-132050263 CAGGGTCAAGCAGCTGGAGAGGG + Intronic
1091599959 12:1912147-1912169 CAGGGCCAAGCAGCAGGGGAAGG - Intronic
1091782415 12:3222332-3222354 CAGAGTCAGGAAGCAGATGCTGG + Intronic
1091804043 12:3343292-3343314 CAGGGGCAGCCAGCAGGTGCGGG + Intergenic
1092194404 12:6540651-6540673 GAGGGTGAGGCAGCAGGAGGAGG - Intronic
1092214638 12:6672442-6672464 CTGGGCCAGGTAGGAGGTGTTGG + Exonic
1095279114 12:40328877-40328899 CAAGGTCTGGAAGCAGGTGGAGG - Intronic
1095466975 12:42497866-42497888 CATGGGCAGGCAGCAGCCGTAGG - Intronic
1098134147 12:67383801-67383823 CAGGGTCATGGAGCTGGTGGGGG + Intergenic
1100401191 12:94231601-94231623 CAGGGTCAGGATACAGGAGTAGG - Intronic
1100435097 12:94563931-94563953 CAGCATCAGGCAGCAGGTACTGG - Intergenic
1101290408 12:103361968-103361990 GAGGATCAGGCAGTAGGTGGGGG - Intronic
1101411619 12:104473475-104473497 CCGGGTCAGGCTGCAGCTGTTGG + Intronic
1101768926 12:107730407-107730429 CAGGGTGAGGAGGCAGGTGCTGG + Intergenic
1101910129 12:108855343-108855365 CAGGGGGAGGCTGCAGGTGAGGG + Intronic
1102565888 12:113797296-113797318 CAGGGTCAGGCACCACACGTGGG - Intergenic
1102842203 12:116137160-116137182 CAATGTCAAGCAGCAGGTGTAGG - Intronic
1102963904 12:117111829-117111851 CTGGGGCAGGCAGCCGGGGTGGG + Intergenic
1103197296 12:119055879-119055901 CAAGGTCACAGAGCAGGTGTAGG + Intronic
1103611611 12:122127531-122127553 AAGAGTCAGGGAGCAGGTCTAGG + Intronic
1105544691 13:21342818-21342840 CAGGGGCAGGCAGGAGGAGCAGG + Intergenic
1105708487 13:22983169-22983191 CACGGTCAGCCCGCAGGTGCGGG + Intergenic
1111282795 13:86049479-86049501 GAGTGTCTGGCAGCAGCTGTGGG + Intergenic
1111428776 13:88124987-88125009 GAAGGACAGGAAGCAGGTGTAGG - Intergenic
1111905516 13:94251289-94251311 CAGGGCCAGGCAGGGGGTGGGGG + Intronic
1112709915 13:102115687-102115709 GAGGGTCAGGGAGCATGGGTTGG + Intronic
1113344183 13:109457937-109457959 CAGGGTCCAGCTGCAGTTGTTGG - Intergenic
1113400270 13:109985983-109986005 CAGGGTCAGGCAGTGGGAGGAGG - Intergenic
1116793279 14:49362568-49362590 CAGGGCCTGTCAGCAGGTGGGGG + Intergenic
1118806807 14:69245047-69245069 CTGGGACAGGCAGAAGGTGCTGG - Intergenic
1119264237 14:73254712-73254734 CAGGGTCAGGCAGCAGGTGTGGG - Intronic
1119841238 14:77794663-77794685 GAGGGTCAGGCTGAAGGGGTGGG + Intergenic
1120147107 14:80990541-80990563 CAGGGTTAAGTAACAGGTGTAGG - Intronic
1120705113 14:87737914-87737936 CATGGCCAGGCAGCAGGCATAGG - Intergenic
1121308738 14:92923542-92923564 CAGGGTCAGGCGGGAGGCGGAGG - Intronic
1121418771 14:93797806-93797828 CTGGGTCACGCAGAAGCTGTGGG + Intergenic
1121908069 14:97765576-97765598 CAGGGAAAGGCATCAGGAGTTGG + Intergenic
1122119624 14:99545190-99545212 GAGAGGCAGGCAGCCGGTGTGGG - Intronic
1122388649 14:101365426-101365448 CAGGGTGAGGCGGCTGGTGGGGG + Intergenic
1122612434 14:102994684-102994706 CAGTGGCATCCAGCAGGTGTGGG + Intronic
1122693993 14:103544095-103544117 CAAGCTCAGGCCTCAGGTGTCGG - Intergenic
1122757958 14:103997562-103997584 CAGGGCCAGGGAGCAGCTGGCGG + Intronic
1122768418 14:104086303-104086325 CCTGGTCAGGCAGCAGTGGTTGG + Intronic
1122834713 14:104425102-104425124 CAGGGGCAGGCAGCAGGGCAGGG - Intergenic
1123006471 14:105326246-105326268 CAGGACCAGGAAGCAGGTGCGGG - Intronic
1123030735 14:105449919-105449941 CAGTGTCCGGCAGCAGGAGGAGG + Intronic
1124186392 15:27533321-27533343 CAGGCTGAGCCAGCAGGAGTGGG - Exonic
1124433847 15:29631818-29631840 CAGGGCCAGGTGGCAGCTGTTGG - Intergenic
1124575207 15:30902012-30902034 CAGGGTCATACATCAGGTGCTGG + Intergenic
1125724754 15:41862579-41862601 CAGGCACAGGCAGCAGGAGGTGG - Exonic
1126109769 15:45168424-45168446 CAGGGTTGGCCAGCAGGGGTCGG - Intronic
1127259819 15:57319615-57319637 CAGGCTCAGGCGGCAGGTGGTGG + Intergenic
1127366437 15:58294936-58294958 CAAGGTCATGCAGCAAGTGAAGG - Intronic
1127729227 15:61783334-61783356 CAAGGGCAGACAGCAGGTCTAGG - Intergenic
1128512009 15:68319162-68319184 CAGGCTCAGGCGCCAGCTGTGGG + Intronic
1128805639 15:70529027-70529049 CAGGGTCAGGAAGGTGATGTGGG + Intergenic
1128976073 15:72154562-72154584 CAGGGGCATGCAGCATGCGTGGG - Intergenic
1129319016 15:74763453-74763475 CAGGGGCTGGGAGCAGGCGTGGG + Intergenic
1129704892 15:77788529-77788551 ATGGGTGGGGCAGCAGGTGTAGG - Intronic
1129742211 15:77994748-77994770 CATGGCCAAGCTGCAGGTGTGGG - Intronic
1129843271 15:78756732-78756754 CATGGCCAAGCTGCAGGTGTGGG + Intergenic
1129976147 15:79823471-79823493 CAAGGTCACGCAGCTGGTGTTGG - Intergenic
1131181650 15:90244114-90244136 CAAGGTCAGGCAGCTGGAGTCGG + Exonic
1131265518 15:90913011-90913033 AAGGGTCTGGAAGGAGGTGTGGG + Intronic
1131303863 15:91224109-91224131 GAGGGCCAGGAAGCAGGTGTGGG + Intronic
1131429759 15:92377415-92377437 AAGGGAGAGGCAGCAGGTTTGGG - Intergenic
1131974476 15:97930489-97930511 CAGGTTCAGGTAGCAGGAGCAGG + Intergenic
1132196291 15:99916895-99916917 CAGGCTCTGGCAGCGGCTGTTGG + Intergenic
1132579542 16:678709-678731 CAAGGTTGGGCAGCAGGTCTGGG + Intronic
1132586250 16:706766-706788 CCGGGGGAGGGAGCAGGTGTGGG + Intronic
1132718891 16:1306338-1306360 GAGGGTCATGGAGCAGGTGGGGG - Intergenic
1132862444 16:2078248-2078270 CAGTGTCTGGGTGCAGGTGTGGG + Intronic
1133316300 16:4886080-4886102 CAGGCTCTGGCAGCACATGTAGG + Intronic
1133970286 16:10562854-10562876 CAGGGTCAGGCAGCAGTCATTGG - Intronic
1134070884 16:11259029-11259051 CAAGGTCATGCAGCAGGTCTGGG - Intronic
1134238889 16:12489488-12489510 CAGGGTCACACAGCCAGTGTGGG - Intronic
1134643712 16:15849834-15849856 CAGAGTCACCCAGCAGGTTTGGG - Intronic
1135689662 16:24526083-24526105 CAAGGTCACACAGCAAGTGTTGG + Intergenic
1136095206 16:27950659-27950681 CAAGGTCACACAGCAGGTTTAGG - Intronic
1136412162 16:30083807-30083829 CAGGGACAGCCAGGAGGGGTTGG + Intronic
1136548317 16:30967594-30967616 CAGGGTCAGGCATAAGGAGAAGG + Intronic
1136777651 16:32880278-32880300 CTGGGTCATGCAGCAGGGGCTGG + Intergenic
1136892973 16:33981236-33981258 CTGGGTCATGCAGCAGGGGCTGG - Intergenic
1137462157 16:48674756-48674778 CAGGGTGAAGCAGCAAGTGCTGG + Intergenic
1138448687 16:57080032-57080054 CACGGCCAGCCAGCAGGTCTGGG - Intronic
1139836989 16:69847050-69847072 AAGAGCCTGGCAGCAGGTGTAGG - Intronic
1140055751 16:71524105-71524127 CAGGGTAAGGTAGCAGGAGTAGG + Intronic
1140126631 16:72123632-72123654 CTGGGGCAGGCAGCAGGGCTTGG + Exonic
1140775743 16:78247609-78247631 AAGGGGCAGGGGGCAGGTGTTGG - Intronic
1141055728 16:80812060-80812082 CAGGGTCAGGCTGAAGGCGTTGG + Intergenic
1142003698 16:87679145-87679167 CAGGGACAGGCAGGAGGTCGAGG - Intronic
1142034272 16:87854079-87854101 CAGGGTCAGGCTGGCGGTGGGGG - Intronic
1203080067 16_KI270728v1_random:1142387-1142409 CTGGGTCATGCAGCAGGGGCTGG + Intergenic
1143107413 17:4536585-4536607 CAGGGTCAGCCTGGAGCTGTGGG + Intronic
1143780954 17:9229520-9229542 CAGGCTTTGGCAGCAGGAGTAGG + Intronic
1144018565 17:11220403-11220425 CAGGGCCAGGGAACAGCTGTGGG - Intergenic
1144315415 17:14056151-14056173 CAGGGTGATGCAGCAGGAGATGG + Intergenic
1145090586 17:19982616-19982638 CAGGCTGAGGCAGGAGGTGGAGG + Intergenic
1146537230 17:33663211-33663233 CAGGTTCACGCAGCAGGTAATGG + Intronic
1146884197 17:36459995-36460017 CTGGGTGAGGCACCAGGGGTAGG + Intergenic
1147662295 17:42123191-42123213 GGGGGTCAGGCAGCAGGTCATGG - Exonic
1147689669 17:42307514-42307536 CAGGGTCAGGGGCCAGCTGTGGG + Intronic
1147846738 17:43409845-43409867 CAGAGACAGGCAGCAGGGGAGGG - Intergenic
1147911280 17:43857714-43857736 CATGGTCACACAGCAGGTGGTGG + Intronic
1148115389 17:45172103-45172125 CAAGACCAAGCAGCAGGTGTGGG - Intergenic
1148214154 17:45825336-45825358 CTGATACAGGCAGCAGGTGTAGG - Intronic
1148513349 17:48192523-48192545 CAGGATCAGTGAGCTGGTGTGGG - Intronic
1148561277 17:48608046-48608068 CAGGGTCTGGTAGCGGGTGTAGG + Exonic
1148562371 17:48613457-48613479 CAGGGTCTGGTAGCGGCTGTAGG + Exonic
1149654840 17:58304792-58304814 CTGCGTCAGCCACCAGGTGTTGG + Intronic
1150267848 17:63842520-63842542 CCGGGTCCGGCAGGAGGCGTGGG - Exonic
1151430036 17:74056169-74056191 CAGGATCAGGAAGCGGGTGATGG - Intergenic
1151850778 17:76688317-76688339 CATGGTCAACCAGCAGGTGGGGG + Intronic
1151963532 17:77419675-77419697 AAGCGTCAGTCAGCAGGTGCCGG - Intronic
1152210095 17:78998561-78998583 CAGGGTCAGGGTGCTGGTGGCGG + Intronic
1152315086 17:79575437-79575459 CAGGGGCAGCCAGCAGGGCTGGG + Intergenic
1152344690 17:79743833-79743855 CAGGGCCACAGAGCAGGTGTTGG - Intergenic
1152404227 17:80087327-80087349 TGGGGACAGCCAGCAGGTGTGGG - Intronic
1152488007 17:80608163-80608185 CAGGGGCAGGTGGCAGGAGTGGG - Intronic
1152589654 17:81205321-81205343 CAGGGGCAGGCGCCAGGGGTAGG + Intronic
1152622626 17:81372875-81372897 CAGGGCCAGGGAGGAGGTGCTGG - Intergenic
1154341698 18:13508283-13508305 CAGGGTAAAGCAGCAAGTGCTGG + Intronic
1155195781 18:23472589-23472611 CAGGGACAGGCTAGAGGTGTGGG - Intronic
1155546774 18:26923984-26924006 CAGGGAGAGGCAGGAGGGGTTGG + Intronic
1155719480 18:28993065-28993087 TAGGGTTAGGCAGGAGATGTAGG + Intergenic
1156625157 18:38899874-38899896 AAGGGGCAGGGAGCAGGGGTAGG - Intergenic
1157794802 18:50563675-50563697 CAGGTTCAGGCAGAAAGAGTCGG + Intronic
1158388422 18:57021217-57021239 CAGGGTGGGTCAGGAGGTGTGGG + Intronic
1158697045 18:59712848-59712870 AAGGATCTGGGAGCAGGTGTTGG + Intergenic
1160243237 18:77137533-77137555 CAGGCACAGGCAGCAGGGGGTGG - Intergenic
1160722764 19:604626-604648 CGGGGTCAGGCAGCAAGGGCGGG + Intronic
1160722777 19:604669-604691 CGGGGTCAGGCAGCAGGGGCGGG + Intronic
1160722790 19:604713-604735 CAGGGCCAGACATCAGGGGTGGG + Intronic
1161014741 19:1978095-1978117 CACGGGCAGGGTGCAGGTGTCGG + Intronic
1161070130 19:2255836-2255858 CAGGGTCACGCAGCAGGATGTGG - Intronic
1161075501 19:2283231-2283253 CAGGGTCACGCAGCAGCTCGAGG + Intronic
1162027229 19:7901209-7901231 CAGGGAGAGGCAGCAGTTCTAGG - Exonic
1162066179 19:8126645-8126667 ATGGGTCAGGGTGCAGGTGTAGG - Intronic
1162735626 19:12745528-12745550 CAGGCCCAGCCAGCAGGGGTGGG + Intronic
1162805284 19:13135133-13135155 CGGGGTCAGGCGGCAAATGTGGG - Intronic
1162875453 19:13617923-13617945 CATGGGCAGACAGGAGGTGTGGG - Intronic
1163128558 19:15257806-15257828 GAGGTTTAGGCAGCAGGTGTGGG + Intronic
1163519056 19:17781226-17781248 CAGGTGCAGGCATCAGGTCTAGG - Exonic
1163595305 19:18217984-18218006 CAGGGTCTTGGAGCAGGTCTGGG - Intronic
1163699905 19:18781831-18781853 CAGGGACAGGTGGCATGTGTTGG + Exonic
1163830169 19:19543792-19543814 CAGGCTGGGGCAGCGGGTGTCGG - Exonic
1164179509 19:22807010-22807032 CAGGCAGAGGTAGCAGGTGTGGG - Intergenic
1164671075 19:30072296-30072318 CTGGGTCAGGCATCTGTTGTAGG + Intergenic
1164822941 19:31264234-31264256 CAGTGACAGGCAGGAGGTGGTGG + Intergenic
1165137840 19:33681532-33681554 GAGGGACAGGCGGCAGGTGTGGG + Intronic
1165299633 19:34960659-34960681 AGGCTTCAGGCAGCAGGTGTGGG + Intronic
1165789506 19:38483147-38483169 CAGGCTGAGGCAGGAGATGTGGG + Intronic
1166195358 19:41202302-41202324 TCGGGTCAGGCAGCTGCTGTGGG + Intronic
1166916511 19:46199122-46199144 CAGGGTAGGGCAGCAGTTGGAGG + Intergenic
1167104256 19:47421018-47421040 CAGGGGGAGGGAGCAGGTGGCGG + Intergenic
1167510529 19:49893346-49893368 AAGCGTCAGGCGGCAGGGGTGGG + Intronic
1167712357 19:51120207-51120229 GAGGTTCAGGGAGCAGCTGTAGG - Intergenic
1167718853 19:51163440-51163462 CAGGTCCAGGCAGCACGTCTGGG + Intergenic
1167797610 19:51719861-51719883 CAGCGGCAGGCTGCAGGAGTGGG + Exonic
925318290 2:2941480-2941502 CAGGGCCAGGCTCCTGGTGTCGG - Intergenic
926739866 2:16102311-16102333 CAGGCTGAGGCAGCCTGTGTTGG - Intergenic
927473907 2:23397409-23397431 CTGGGGGAGGCAGCAGGGGTGGG + Intronic
927855054 2:26522750-26522772 CAGGGTCACACAGCAGGTTCAGG - Intronic
928129881 2:28641812-28641834 CTGTGTCTGGCAGCAAGTGTAGG - Intronic
928344278 2:30476297-30476319 CAGGGTCACACAGTAAGTGTTGG + Intronic
928817433 2:35316041-35316063 CAAAGTCAGGCTGCAGGTGAGGG - Intergenic
929847211 2:45542182-45542204 CAGGCTGAGGCAGCAGGGGCTGG + Intronic
931790189 2:65658042-65658064 CAGGGTCAGGCAGGGGCTGGAGG + Intergenic
932415450 2:71570738-71570760 AAGGGTGAGCCAGCAGGTGGTGG + Exonic
935150102 2:100426493-100426515 CAGGGCCAAGCAGCAGGCGCAGG + Intergenic
935163755 2:100551653-100551675 CAGGGGCAGGAGGCAGGTGAGGG - Intergenic
935375180 2:102388353-102388375 CAGGGTCACACGGCAGGTGAAGG + Intronic
935386150 2:102501860-102501882 CAGAGTCAAGCAGAAGGCGTGGG + Intronic
936009531 2:108916608-108916630 CTGTGCCAGGCTGCAGGTGTAGG + Intronic
936245824 2:110826528-110826550 CTGGGTCAGGCAAGAGGTCTGGG - Intronic
941347552 2:164388959-164388981 TATAGTCAGGAAGCAGGTGTAGG - Intergenic
942864770 2:180660009-180660031 CAGGCTAAGTCAGCATGTGTTGG + Intergenic
947731003 2:232431623-232431645 CAGGGTCACTCAGCAGGTGTTGG - Intergenic
948686831 2:239675304-239675326 CAGGCCCAGGCAGCAGGAGCTGG + Intergenic
948846022 2:240683184-240683206 CAGGTGCAGGGAGCAGGTATTGG - Intergenic
948847834 2:240691545-240691567 CAGGTGCAGGGAGCAGGTATTGG + Intergenic
948854103 2:240722068-240722090 CAGGGTCAGGCACCGGCTGAGGG + Intronic
948901084 2:240957217-240957239 CAGAGGCAGGAGGCAGGTGTGGG - Intronic
1168973941 20:1950013-1950035 GGGGGTCAGGCAGCAGGTGGTGG - Intergenic
1169424126 20:5483348-5483370 GAGGGTCAGACAGCACGTCTTGG - Intergenic
1171215617 20:23350343-23350365 CGGGGTCAGGCAGCTGCTGCTGG + Intergenic
1171457075 20:25278188-25278210 CAGTGTCAGGCAGCTGGGCTGGG + Intronic
1172032258 20:31990397-31990419 CAAGGTCACACAGCAGGTCTGGG + Intronic
1172094658 20:32454771-32454793 CAGGCTCAGGGAACAGGTGGCGG + Intronic
1172119868 20:32591981-32592003 CAGTCTCAGGGAGCAGGTGTAGG + Intronic
1172303260 20:33864311-33864333 CAAGGACAAGCGGCAGGTGTAGG - Intergenic
1172447254 20:34999698-34999720 CAGGGGCTGGCTGCAGGGGTGGG + Intronic
1172612310 20:36261178-36261200 CAGGGTCAGTAGGCAGGAGTGGG + Intronic
1172636650 20:36414563-36414585 CAAGGTCACACAGCAGGTGGAGG - Intronic
1173005814 20:39138889-39138911 CCAGGTAAGGCACCAGGTGTAGG - Intergenic
1173178381 20:40782895-40782917 CAGGGAAAGGCAGCAGGAATGGG + Intergenic
1173370020 20:42426876-42426898 CAGGGGAAGCCAGCAGGTGATGG + Intronic
1173436132 20:43033835-43033857 CAAGGTCATGCAGCAAGTGGTGG + Intronic
1173837932 20:46138086-46138108 CAGGGGCAAGAAGCAGGAGTGGG - Intergenic
1173839125 20:46145763-46145785 CAGGATCAGCCTGCATGTGTAGG + Intergenic
1173895193 20:46545749-46545771 CAGGGTCACTCAGCAGGTCCTGG - Exonic
1173916562 20:46712417-46712439 CAGGGTCAGGGGGCAGGGGGAGG - Intronic
1174195982 20:48773122-48773144 CTGGGTGAGGTGGCAGGTGTCGG + Intronic
1174368448 20:50070504-50070526 CAAGGTCACCCAGCAGGTGGGGG - Intergenic
1174767506 20:53267929-53267951 CAAGGTCACGCAGCTGGTGAGGG + Intronic
1175146450 20:56900188-56900210 GAGGGTCTTGCAGCAGGTCTTGG - Intergenic
1175726729 20:61323589-61323611 CACCGTCAGGGAGCAGGGGTGGG - Intronic
1175813335 20:61870513-61870535 CAGGGACATGCAGAAGGTGGAGG - Intronic
1175936969 20:62518394-62518416 CCAGCTCAGGCAGCAGCTGTGGG + Intergenic
1176148860 20:63578777-63578799 CAGCGTCACGAAGCAGGTGGAGG + Intergenic
1179613037 21:42564753-42564775 CAGCATCAGGCCGCAGGTGGAGG - Exonic
1179717726 21:43298309-43298331 CAGGGTCAGGCCCCCAGTGTGGG - Intergenic
1179883735 21:44304617-44304639 CAGCCTCAGGCAGCAGGACTTGG + Intronic
1180952830 22:19728449-19728471 CTGGGGAAGGCAGCAGCTGTGGG - Intergenic
1181033536 22:20159318-20159340 CAGGGTCCGGGAGCAGGTTGGGG - Intergenic
1181509772 22:23383926-23383948 CAGGGTCCGGGAGCAGGTGGGGG + Intergenic
1181802939 22:25359015-25359037 CAGGGTCACACAGCAGGAGGTGG - Intronic
1181917434 22:26292337-26292359 CAGAGTCTGACAGCAGGTGAAGG + Intronic
1181998416 22:26901524-26901546 CAAGGTCAAGCAGCAGGGATGGG - Intergenic
1182100260 22:27652753-27652775 CAGGGTCAGGAACAAGGTGCAGG + Intergenic
1182420870 22:30248008-30248030 CAGGGTCAGGCGGAAGGGCTGGG - Intergenic
1182443192 22:30376060-30376082 CTTGGGCAGGCAGCAAGTGTGGG - Intronic
1183101839 22:35588908-35588930 CAGAGCCAGGGAGCAGGTGAAGG + Intergenic
1183264632 22:36817619-36817641 CAGGGACAGGCAGGAGCTGCTGG + Intronic
1183472782 22:38018486-38018508 CAGGGTCAGGCCTCAGGCTTAGG + Intronic
1183688218 22:39374217-39374239 GAGGGCCAGGCAGCAGGCGAGGG + Intronic
1183817234 22:40312931-40312953 TAGGGCCAGGCACCAGGTGAAGG - Exonic
1184106992 22:42373537-42373559 CAGGGGCAGGCACCAGCTCTGGG - Intergenic
1184257925 22:43297505-43297527 CAGTGGCTGGCAGCAGGTGGAGG - Intronic
1184468950 22:44684707-44684729 TAGGGGCAGACAGCGGGTGTGGG + Intronic
1184797628 22:46741164-46741186 CAGGGTCAGGTGGCAGGTCAGGG - Intergenic
1184882252 22:47315921-47315943 AAGGGCCAGGCTGCAGGTGTGGG - Intergenic
1185158426 22:49208102-49208124 CAGGGACAGGTATCATGTGTGGG + Intergenic
1185243177 22:49757215-49757237 CAGGGCCAGGCTGCAGGTTAAGG + Intergenic
1185270118 22:49925913-49925935 CAGGGACAGGCAGGAAGTGGTGG + Intronic
949792500 3:7808685-7808707 CAGTGTCAGGGAGCAGGTCGTGG + Intergenic
950414132 3:12858681-12858703 CAGGATCAGCCAGCTGGGGTGGG + Intronic
950456266 3:13094561-13094583 CAGGGTCTGGCACCAGGTGGGGG - Intergenic
950578027 3:13844807-13844829 GAGGGTCTGGCACCAGGAGTTGG - Intronic
950656798 3:14441581-14441603 CAGGGAGAGGAAGGAGGTGTGGG + Intronic
952657297 3:35801634-35801656 CAAGCACAGGCAGCAGGGGTGGG + Intergenic
952886063 3:38011525-38011547 CAGGGTGAGGCAGGAAGTGGGGG - Exonic
952925243 3:38315362-38315384 CAGAGTTAGTCAGCAGGGGTGGG - Intronic
953544935 3:43857515-43857537 CAGGAGCAGGCAGCAGGAGGTGG - Intergenic
954312390 3:49780064-49780086 CAGGGTAGGGGAGCAGGTCTAGG - Intronic
954911512 3:54114554-54114576 CTGGGCCAGGCAGCAGTGGTGGG + Intergenic
955093258 3:55772856-55772878 CAGGGGCAGGGAGCAGGTTGTGG - Intronic
955111971 3:55958775-55958797 CAGGAGCAGGCACCAGGAGTGGG + Intronic
955405935 3:58625828-58625850 CAGGGTCATGCAGCTAGTGGGGG - Intronic
955936656 3:64109043-64109065 TATGGTCAAGCAGCAGGTGGAGG - Intronic
959748307 3:109803596-109803618 CAGGGTGGGGCAGCTTGTGTGGG - Intergenic
960960522 3:123067415-123067437 CAGGGGCAGGAGGCAGCTGTGGG + Intronic
961038108 3:123657219-123657241 CGTGGTCAGGCAGCAGGTCCTGG + Exonic
961559004 3:127716011-127716033 CAGGGTCATGGGGCAGGTGCGGG - Intronic
962372005 3:134828562-134828584 CAGGGTCAGGCAGTGAGTTTGGG + Intronic
962444830 3:135455040-135455062 TAGGGGCAGGCAGCAGGAATAGG - Intergenic
962927865 3:140011832-140011854 CAGTGACAGGCAGTGGGTGTGGG + Intronic
963335964 3:143973099-143973121 CTGGGCCAGGCTGCAGGCGTGGG + Intronic
964324480 3:155531715-155531737 CAAGGTGAAGCAGCAAGTGTTGG - Intronic
964847944 3:161064007-161064029 CAGGGTCTGTCAGGGGGTGTGGG + Intronic
965121092 3:164558613-164558635 AAGTGGCAAGCAGCAGGTGTTGG - Intergenic
965508731 3:169544858-169544880 CAGGGCCTGTCAGCAGGTGGTGG + Intronic
966884992 3:184372593-184372615 AAGGGTCAGGAAGCAGGGGGTGG + Exonic
967242239 3:187451335-187451357 CAAGGTCAGACAGCAGGTTAAGG + Intergenic
968435684 4:587681-587703 CAGGGCAAGGCAGCAGGGATAGG - Intergenic
969113557 4:4858132-4858154 CGGGGTCTGGCGGCAGGGGTCGG - Intergenic
969117317 4:4878840-4878862 CAAGGTGAGGGAGCAGGTGAGGG - Intergenic
969212600 4:5699181-5699203 CAGAGACAGGCAAGAGGTGTGGG + Intronic
969588251 4:8106980-8107002 CAGGTTAAGGCAGCAGTGGTTGG - Intronic
969657280 4:8505502-8505524 CCTGGACAGGCAGCCGGTGTGGG + Intergenic
971377399 4:26066104-26066126 CTGGGTCAGGCAGCTCCTGTTGG + Intergenic
972146064 4:36027284-36027306 CAAGGTCATGCAGCTGGTGAAGG + Intronic
972341296 4:38154854-38154876 CTGGGGCAGGCAGCTGGGGTGGG - Intergenic
973602273 4:52553623-52553645 TAGGGTCGGGGAGCAGGGGTGGG - Intergenic
978728073 4:111994042-111994064 CATGGCCAGGCAGGAGGTGGTGG - Intergenic
979122948 4:116926361-116926383 CAGGATCAGGCAGAAGGCGATGG - Intergenic
981103927 4:140859157-140859179 CATGGCCAGGCAGGAGCTGTGGG - Intergenic
981565195 4:146093862-146093884 CAGTGTCAAGCAGGAGGTGGTGG + Intergenic
981774974 4:148355863-148355885 CAGGGTCAGGTAGCAGGTCCAGG - Intronic
982221109 4:153125992-153126014 GCGAGCCAGGCAGCAGGTGTGGG + Intergenic
985830749 5:2227625-2227647 CAGAGCTAGGCAGCAGGTGCAGG + Intergenic
985903438 5:2814540-2814562 CAGGGTCATGCAGCAGGGGCTGG + Intergenic
986292072 5:6408269-6408291 CAAGGCCTGGCAGCAGGTCTCGG + Intergenic
986515606 5:8560064-8560086 CAGGGTGATGCTGGAGGTGTTGG - Intergenic
986631546 5:9778626-9778648 CAAGGTGAGGCAGCAAGTGCTGG - Intergenic
987080538 5:14421655-14421677 CAGCAACAGACAGCAGGTGTGGG + Intronic
991522613 5:67517390-67517412 CGGGGCCAGTCAGCTGGTGTAGG + Intergenic
991622503 5:68559423-68559445 CAGGGTCAGGGAGATGGTTTGGG - Intergenic
992087343 5:73289783-73289805 CATGGGCAGGCAGCTGGTGAGGG + Intergenic
992483363 5:77172791-77172813 CTGGGACAGGCAGTGGGTGTCGG + Intergenic
993476597 5:88373939-88373961 CATGGCCAGGAAGCATGTGTGGG - Intergenic
995029994 5:107469548-107469570 CAAGGTCAGTCAGAAGGTGGTGG - Intronic
995307575 5:110671733-110671755 CAGGGTCAGTCAGTGGGTGGGGG + Intronic
996330382 5:122321693-122321715 CAGAGCCAGGGAGCAGGGGTTGG - Intronic
997842030 5:137250595-137250617 CAGGGGCAAGCAGCTCGTGTTGG - Intronic
997882788 5:137605151-137605173 CAGAGGCGGGCAGCAGGTGGGGG + Intergenic
998602304 5:143597504-143597526 CAAGGTCACACAGCTGGTGTGGG + Intergenic
999419843 5:151431381-151431403 CAGGGACTGGCAGCTGGTGGAGG + Intergenic
999751263 5:154629682-154629704 CAGGGCCAGGCAGCTCATGTGGG + Intergenic
999935323 5:156479949-156479971 CAGGGCAAGACAGCAGCTGTTGG - Intronic
1001051300 5:168416564-168416586 CAGGGTCTGGGAGCAAGTGAGGG - Intronic
1002432629 5:179212304-179212326 CAGGTGCAGTGAGCAGGTGTGGG + Intronic
1002579243 5:180197598-180197620 CAGGGCCATGCAGCCAGTGTGGG - Intronic
1002618435 5:180469602-180469624 CAGGGTCTTGCAGGAGGTGCAGG - Intergenic
1002638639 5:180620125-180620147 GTGGGTCGGGCAGGAGGTGTGGG + Intronic
1002885446 6:1289795-1289817 TAGGATGAGGCAGCAGGTGAAGG - Intergenic
1002902353 6:1419765-1419787 CAGAGTCCCACAGCAGGTGTGGG - Intergenic
1003445371 6:6178745-6178767 GAGGGTCAGGCAGGAGGGGGTGG + Intronic
1006192996 6:32220883-32220905 CAGGGTCATGGATCAGCTGTGGG + Intronic
1006364579 6:33607936-33607958 TAGGGGCGGGCATCAGGTGTTGG + Intergenic
1006388263 6:33744298-33744320 TAGAGGAAGGCAGCAGGTGTGGG - Intronic
1006670599 6:35727824-35727846 CTGGGGGAGGGAGCAGGTGTGGG - Intronic
1006742192 6:36317067-36317089 GAGGGTCATGCAGCAAGTCTGGG + Exonic
1006941600 6:37755348-37755370 CTGGGTCAGGCAGCAGGAGATGG + Intergenic
1007166211 6:39830709-39830731 CAGGCCCAGGCAGCAGGAGGGGG + Intronic
1007247461 6:40472758-40472780 AAAGGTGAGGCAGCAGGTGCAGG - Intronic
1007404607 6:41627283-41627305 CAGAGGCAGGCAGCAAGTGGGGG - Intergenic
1007477310 6:42127512-42127534 CAGTGCTAGGCAGCAGGTATGGG + Intronic
1008951948 6:57171499-57171521 CTAGGTCAGGCACCAGCTGTCGG - Intergenic
1011934049 6:92753399-92753421 CAGGTTCTGACAGCAGCTGTGGG + Intergenic
1013536788 6:111069892-111069914 CAGAGGCAAGCAGCAGGTCTAGG + Intergenic
1014789605 6:125657579-125657601 AATGGCCAGGTAGCAGGTGTGGG + Intergenic
1014914709 6:127132108-127132130 CAGGATCAGGGGGCTGGTGTTGG - Intronic
1015044291 6:128760099-128760121 CAGGCTCTGGCTGCAGGTGCAGG - Intergenic
1015185306 6:130408933-130408955 CAGGGTCAGGGAGGGGGTGGTGG - Intronic
1015228246 6:130883092-130883114 CAGGGACAGGCAATAGGTTTGGG + Intronic
1017813650 6:158001725-158001747 CAGAGCCAGGGAGTAGGTGTGGG - Intronic
1018702723 6:166439933-166439955 AAGGGGCTGGCTGCAGGTGTGGG + Intronic
1018953002 6:168391300-168391322 CAGGGCCTGCCAGGAGGTGTGGG - Intergenic
1018999386 6:168736003-168736025 CAGGGTCATCCAGGAAGTGTAGG - Intergenic
1019294848 7:268513-268535 CAGGGTCAGGCAGAACATGCAGG - Intergenic
1019614135 7:1951250-1951272 GGGGCTCAGGCAGCAGGTGCAGG + Intronic
1020034483 7:4956741-4956763 CAAGGTCACACAGCAGGTGTGGG + Intronic
1020086879 7:5315252-5315274 CGGGGTCAGCCACCTGGTGTCGG - Intronic
1020885552 7:13815488-13815510 CAGGGCCTGTCAGGAGGTGTAGG + Intergenic
1021554754 7:21908071-21908093 CAGGCTCTGGCAGCAGTTGCTGG - Intronic
1022095959 7:27142024-27142046 CAGGGTCTGGTAGCGCGTGTAGG + Exonic
1022182987 7:27940009-27940031 CAGGGCCAGACTGCAGGTGTTGG + Intronic
1022208906 7:28189283-28189305 CAGGGAAAGGCAGCAGGGGAGGG - Intergenic
1022515767 7:30974256-30974278 CACAGTCCGGCAGCAAGTGTTGG + Intronic
1022982798 7:35620236-35620258 CACTCTCAGGCAGCAGGTGATGG + Intergenic
1023029409 7:36079486-36079508 CTGGATCAGGCAGCAGGTGCAGG + Intronic
1023821826 7:43984947-43984969 CTGGGCCAGGGAGGAGGTGTAGG + Intergenic
1023918374 7:44607227-44607249 CAACTTCTGGCAGCAGGTGTGGG - Intronic
1023995374 7:45156321-45156343 GAGGGGTGGGCAGCAGGTGTAGG - Intergenic
1024270588 7:47638566-47638588 CAGGGTGAGGTAGCAGGGGTGGG - Intergenic
1024421206 7:49168996-49169018 CAGGGTCTGTCAGGAGGTGCCGG - Intergenic
1025021130 7:55481091-55481113 AAGGGGCAGGCAGCAGGTACTGG + Intronic
1026946750 7:74321059-74321081 CAGGGTCACACAGCAGGAGCAGG - Intronic
1027238142 7:76310270-76310292 CAGGGTCACCCAGCAGGTCTGGG + Intergenic
1028437970 7:90827068-90827090 CAGGGACAGGCAGCAGGGGTGGG - Intronic
1029704728 7:102270243-102270265 CAGGGTGAGGCAGCCGGTGGGGG + Intronic
1030289043 7:107854283-107854305 CTGGGTGAGGCACCAGGAGTTGG - Intergenic
1031870439 7:127084966-127084988 CAGGGTCTGTCAGTAGGTGGAGG - Intronic
1031974507 7:128085209-128085231 GAGGGTCGGGCAGCTGGTTTAGG - Intronic
1032464604 7:132136131-132136153 CAGCGTCAGGCACAAGGTGCTGG - Intronic
1032703643 7:134403808-134403830 CAGGGTAAGGCAGCTGCTGTGGG + Intergenic
1032886314 7:136142997-136143019 CAGGGTGTGGATGCAGGTGTAGG - Intergenic
1033139938 7:138817007-138817029 CAAGGTGAAGCAGCAGATGTGGG + Intronic
1034315473 7:150127238-150127260 CTGGGTCAGGCAATAGGGGTGGG - Intergenic
1034570381 7:151951086-151951108 CTGGGTCATGCAGCTGGAGTGGG - Intergenic
1034658814 7:152751318-152751340 CAGTCTAAGGCAGCAAGTGTGGG + Intergenic
1034791419 7:153973562-153973584 CTGGGTCAAGCAACAGGGGTGGG + Intronic
1035472473 7:159119240-159119262 CAGGGGCAGCCAGGAGCTGTGGG - Intronic
1036031355 8:4977619-4977641 TGGGGTAAGGCAGCAGCTGTGGG - Intronic
1036384598 8:8268299-8268321 CAAGGTCAGGCTGCAGGAGAGGG - Intergenic
1037587480 8:20288044-20288066 CAGGGAGAGGCAGGAGGTGGGGG - Intronic
1037684873 8:21130168-21130190 GAGGCCCAGGCAGCAGGAGTTGG + Intergenic
1038132381 8:24747224-24747246 CAAGGGCAGCCAGCAGGTGGTGG + Intergenic
1038271269 8:26078097-26078119 CAAGGTCATGCAGCATGTGTGGG + Intergenic
1038532420 8:28329131-28329153 CAGGAGCAGGAAGCAGGTGCTGG - Exonic
1038672271 8:29591957-29591979 GAGGGTCTGGGAGCAGGAGTGGG - Intergenic
1039946034 8:42129312-42129334 CGGGGCCAGCCATCAGGTGTGGG + Intergenic
1040418698 8:47219373-47219395 CAGGGTGGGTCAGCAGGTGGTGG + Intergenic
1040421163 8:47241704-47241726 CAGGATCAGGCTGAAGGTGAGGG + Intergenic
1041321632 8:56619707-56619729 CAGGGTCTGGCCACAGGGGTAGG + Intergenic
1042527748 8:69782053-69782075 CAGGGCCTGTCAGCGGGTGTGGG + Intronic
1043370459 8:79584603-79584625 CAAGGGCAGGGAGCAGGTGGAGG + Intergenic
1043467374 8:80525160-80525182 CAGTGTTTGGGAGCAGGTGTAGG + Exonic
1045600954 8:103715317-103715339 CGGGGGCAGGCAGTAGGGGTTGG - Intronic
1047216303 8:122878935-122878957 TTGGGTCAGGGATCAGGTGTGGG - Intronic
1048736097 8:137503792-137503814 CATGGTCTGGTAGCAGGTGAAGG - Intergenic
1048951740 8:139502160-139502182 TAGGGACAGGTAGCAGGTATTGG - Intergenic
1049082964 8:140457337-140457359 CCGGCCCGGGCAGCAGGTGTGGG + Intronic
1049284511 8:141767277-141767299 CTGGGTCAGGCAGGTGGTCTAGG + Intergenic
1049410926 8:142473721-142473743 GAGGGTTCTGCAGCAGGTGTGGG + Intronic
1049654629 8:143792173-143792195 CAGGGACAGGCAGCAGGGCGGGG + Intronic
1049684839 8:143935147-143935169 CTGGGGCAGGCAGCAGGGGAAGG + Intronic
1049731625 8:144181248-144181270 TAGTTCCAGGCAGCAGGTGTGGG + Intronic
1050246684 9:3697387-3697409 GTGGGCCAGGCAGCAGGTGAAGG + Intergenic
1051199643 9:14601984-14602006 CAGGGCCAGTCAGGAGGTGGGGG + Intergenic
1052018216 9:23494648-23494670 AAGAATCAGGCAGCAGGTGGAGG + Intergenic
1053293449 9:36897172-36897194 CGGGTCCAGGCAGCAGCTGTGGG + Intronic
1054815174 9:69467777-69467799 CAGGGACAGGGGGCTGGTGTAGG - Intronic
1055312446 9:74997054-74997076 CAGGGGCAGGCAGAAGCAGTGGG + Intronic
1056967650 9:91178474-91178496 CAGGGCCAGGCAGCAGGGCTTGG - Intergenic
1057298561 9:93863309-93863331 GAGGAGCAGGCAGCAGGTGCTGG + Intergenic
1057354171 9:94321286-94321308 CAGGACCAGGCAGCAGCTGAGGG + Intronic
1059451316 9:114372934-114372956 CTGTGCCAGGCAGCAGGTGTGGG + Intronic
1060195360 9:121620183-121620205 CTGGCCCAGGCAGCAGGAGTCGG - Intronic
1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG + Exonic
1061130516 9:128705506-128705528 CAGGGCCGGGCAGCAGGATTCGG - Exonic
1061834945 9:133322687-133322709 CAGGGTCAGCCAGAAGCAGTGGG - Intergenic
1061851979 9:133421717-133421739 CAGGGCCTGGCAGGAAGTGTAGG + Intronic
1061898424 9:133660590-133660612 CAGGGTCACACAGCAGGGGCAGG - Intergenic
1062053773 9:134460195-134460217 GAGGGTCATGCAGCAGGTTGGGG + Intergenic
1062329045 9:136028779-136028801 GAGGGCCAGGCAGCAGGAGCAGG - Intronic
1062409593 9:136416340-136416362 CTGGGTCAGGCCGCAGGTTCAGG - Exonic
1062598447 9:137309574-137309596 CAGGGTCAGGCACTGGGTCTGGG - Intronic
1186470934 X:9821790-9821812 GAGGGTCTGCCAGCAGGCGTGGG + Intronic
1186744158 X:12548769-12548791 TTGGGCCAGGCAGCAGATGTAGG + Intronic
1188922831 X:35999736-35999758 AAGGGTGAAGCATCAGGTGTTGG + Intergenic
1190053791 X:47170535-47170557 CAGAGCCAGGCAGCAGGAGCTGG - Intronic
1190231216 X:48583473-48583495 CAGGGGCAGGGGGCAGGTGGCGG - Intergenic
1190623632 X:52314156-52314178 CAGGGTCAGACAGCTAGTATGGG - Intergenic
1192147491 X:68691417-68691439 CAGGGGCAGGGAGCAGGGGTTGG + Intronic
1192711716 X:73597773-73597795 CAGGGTCTGTCAGGAGGTGGGGG - Intronic
1197872851 X:131075778-131075800 CAGTTCCAGGCAGCAGATGTTGG + Intronic
1198504205 X:137285242-137285264 CAAGATCAGGCTGCAGCTGTGGG + Intergenic
1198604866 X:138325937-138325959 CAAGGTCACTCAGCAAGTGTAGG - Intergenic
1199375904 X:147109334-147109356 CAATGTCAGTCAGCAGGGGTTGG - Intergenic
1200267909 X:154655676-154655698 CAGGTCCAGGCCCCAGGTGTAGG + Intergenic
1200886571 Y:8278055-8278077 CAGGGTGGGGCAGCAGGGATGGG - Intergenic
1202161097 Y:21938043-21938065 CAGGGTGGGGCAGGAGGGGTGGG - Intergenic
1202172785 Y:22068679-22068701 CAGGAGCAGGCAGCTGGGGTTGG + Intergenic
1202218577 Y:22517692-22517714 CAGGAGCAGGCAGCTGGGGTTGG - Intergenic
1202230259 Y:22648330-22648352 CAGGGTGGGGCAGGAGGGGTGGG + Intergenic
1202312897 Y:23547835-23547857 CAGGGTGGGGCAGGAGGGGTGGG - Intergenic
1202324609 Y:23678363-23678385 CAGGAGCAGGCAGCTGGGGTTGG + Intergenic
1202546162 Y:25991691-25991713 CAGGAGCAGGCAGCTGGGGTTGG - Intergenic
1202557905 Y:26122759-26122781 CAGGGTGGGGCAGGAGGGGTGGG + Intergenic