ID: 1119264495

View in Genome Browser
Species Human (GRCh38)
Location 14:73256001-73256023
Sequence CTAGCTAAGCAGAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119264485_1119264495 27 Left 1119264485 14:73255951-73255973 CCAGACCGTGGTGGTCATGCAGC 0: 1
1: 0
2: 1
3: 3
4: 78
Right 1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG 0: 1
1: 0
2: 0
3: 22
4: 219
1119264490_1119264495 -2 Left 1119264490 14:73255980-73256002 CCTGACCGCATGGGGTGCTTGCT 0: 1
1: 0
2: 1
3: 9
4: 56
Right 1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG 0: 1
1: 0
2: 0
3: 22
4: 219
1119264491_1119264495 -7 Left 1119264491 14:73255985-73256007 CCGCATGGGGTGCTTGCTAGCTA 0: 1
1: 0
2: 0
3: 7
4: 60
Right 1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG 0: 1
1: 0
2: 0
3: 22
4: 219
1119264486_1119264495 22 Left 1119264486 14:73255956-73255978 CCGTGGTGGTCATGCAGCACAAC 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG 0: 1
1: 0
2: 0
3: 22
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119264495 Original CRISPR CTAGCTAAGCAGAGGGTGGA AGG Intronic
900110393 1:1003040-1003062 CTTGCTGAGCAGAGGCAGGAGGG + Intergenic
900603172 1:3511855-3511877 CTTGGTGAGCAGAGGGTCGAGGG - Intronic
901217149 1:7561263-7561285 GTAGCTGAGCAGATGGTAGAGGG - Intronic
901762478 1:11479823-11479845 CTAGGTAGGGAGTGGGTGGAGGG - Intronic
903349970 1:22711380-22711402 CTTGCTCCGCACAGGGTGGAGGG + Intronic
904004310 1:27355704-27355726 ATAGGTGAGCAGAGTGTGGAGGG + Exonic
906567947 1:46813890-46813912 CCTGCTAAGCAGAGGGTAGGAGG - Exonic
906713819 1:47952321-47952343 CTAGATGAGCAGAGGCAGGAGGG - Intronic
907987460 1:59546402-59546424 CTTGCTCTGCAGAGGGTGGGAGG + Intronic
909504100 1:76368384-76368406 CTAGCTAGGCAGAGAGATGAAGG - Intronic
911306374 1:96237530-96237552 CTAGGTAGGGATAGGGTGGAAGG - Intergenic
911664267 1:100536288-100536310 CTTGCTATTCAGAGGGTTGAAGG - Intergenic
913684669 1:121220410-121220432 GAAGCTGGGCAGAGGGTGGAAGG + Intronic
914036505 1:144008026-144008048 GAAGCTGGGCAGAGGGTGGAAGG + Intergenic
914152949 1:145059920-145059942 GAAGCTGGGCAGAGGGTGGAAGG - Intronic
915095615 1:153460244-153460266 CCAGCTCCACAGAGGGTGGAGGG - Intronic
915109850 1:153556419-153556441 TTGGCTAAGTAGAGGGAGGAAGG + Intergenic
916144826 1:161728870-161728892 CTAGCTCTGCAGAGGATTGATGG - Intergenic
916392140 1:164342412-164342434 CTGGCAAAGCAGTGGGAGGAGGG - Intergenic
918022341 1:180707340-180707362 CTAGCCTATCGGAGGGTGGAGGG - Intronic
919801795 1:201358867-201358889 CTAGCTGGGGAGAGGGTGGAGGG - Intergenic
920471980 1:206238960-206238982 GAAGCTGGGCAGAGGGTGGAAGG + Intronic
921315665 1:213888068-213888090 CTAGCTGAGCAGAGGCCAGAAGG + Intergenic
921615030 1:217256598-217256620 ATAGCAAAGCACAGGGTGGAAGG - Intergenic
921727406 1:218539047-218539069 ATAGCTAAGCAAAGTGTTGAGGG + Intergenic
1063521699 10:6747369-6747391 GCAGCTCAGCAGATGGTGGAAGG - Intergenic
1065491208 10:26283615-26283637 CAAGCTAAGCAGAGCATGGCAGG - Intronic
1067298007 10:44985829-44985851 CAAGCCTAGCAGGGGGTGGAAGG - Intronic
1068966208 10:62914433-62914455 CTAGCTGAGCTGAGGAGGGAAGG - Intronic
1071563636 10:86660656-86660678 AGAGCTAGGCAGAGGGTGCAAGG + Intronic
1072019380 10:91383143-91383165 CTAGGGAAGCAGAGAGTAGAAGG - Intergenic
1073088398 10:100911460-100911482 CTGGCAAAGTAGAGGGTCGAAGG - Intergenic
1073298931 10:102458896-102458918 CTATATAATCAGAGGGTTGAGGG + Intergenic
1073846417 10:107560859-107560881 CTAGCTCCTCAGAGGGAGGAAGG + Intergenic
1074223252 10:111459219-111459241 TTCGCTAAGGAGAGGGTGGCTGG + Intergenic
1076722669 10:132399496-132399518 CTTGCAAAGCAGAGGGGAGAGGG + Intronic
1077456369 11:2683709-2683731 CTAGGTAACCAGAGGGAGTAAGG - Intronic
1077841658 11:5982343-5982365 CTAGCAAAGCAGTGGGGGCAGGG + Intergenic
1079460277 11:20672218-20672240 TTACCTAAGAAGAGGGTGGATGG - Intronic
1081488831 11:43551316-43551338 TGAGCAAAGCAGAGGGTGGTAGG - Intergenic
1084666447 11:70578972-70578994 ACAGCTGGGCAGAGGGTGGATGG - Intronic
1085420317 11:76352709-76352731 CCAGCGAAGAAGAGGGTGAAGGG - Exonic
1089258186 11:117205180-117205202 CTAGCTCAGAAGAGGGGAGAAGG + Exonic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1090373861 11:126275497-126275519 CAAGCTAAGCAAGGGCTGGAGGG + Intronic
1091038337 11:132254016-132254038 CAAGCCAAGCAGGGGCTGGAAGG + Intronic
1091217083 11:133908793-133908815 CTAGTGAAGCAGGGGGCGGAGGG + Exonic
1091615593 12:2048745-2048767 CTGGCTAGGCAGTGGGGGGAGGG + Intronic
1096256262 12:50063961-50063983 CCAGCTAGGCAGGGAGTGGAGGG + Intronic
1096552714 12:52383935-52383957 CTAACTCAGCAGAAGCTGGAAGG + Intronic
1097089155 12:56491885-56491907 CTAACTAAGCTGGGGGTGAAGGG + Intergenic
1099637514 12:85233292-85233314 CTAGATAAGCAGAAGGAGAATGG + Intronic
1099941327 12:89192746-89192768 GTGGCTCAGCAGAGGGAGGAAGG + Intergenic
1100008610 12:89925048-89925070 CTAGCGATTCAGAAGGTGGAAGG - Intergenic
1100718464 12:97330104-97330126 GTAACTAGGCAGAGGGTGGGTGG + Intergenic
1102455610 12:113069247-113069269 CTAGCAAAGCAGGAAGTGGAGGG - Intronic
1104914557 12:132257998-132258020 CTAGCTCAGCAGGGGGTGGCAGG - Intronic
1108602301 13:52005330-52005352 ATATCTAAGCAGAGTGTGCAGGG - Intronic
1108615834 13:52131133-52131155 ACAGCTAAGCAGATGGCGGATGG + Intergenic
1111718276 13:91909231-91909253 CCAGCTCAGCAGAGGCTGGGAGG - Intronic
1112214425 13:97415521-97415543 TCAGCTAAGCAGAGGCTGGTGGG + Intergenic
1113291897 13:108916290-108916312 GCAGCTAAGCAGAGGGTGCAAGG + Intronic
1113740928 13:112711908-112711930 ATAGATAAGGAGCGGGTGGAGGG + Intronic
1115755453 14:36523166-36523188 CCAGCGAAGCAGAGCGTGGTCGG - Intergenic
1116579894 14:46626821-46626843 CTACTTGAGCGGAGGGTGGATGG + Intergenic
1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG + Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1119957055 14:78809710-78809732 CAACCTAAGGAGAGGGTGGAGGG + Intronic
1121761801 14:96451549-96451571 CAAGCAAAGCAGAGGATTGATGG + Exonic
1122239214 14:100350918-100350940 TTAGCTAAGCTGGGGGTGGCAGG + Intronic
1122484661 14:102070719-102070741 CAAAATAAGCAGGGGGTGGAGGG + Intergenic
1123218996 14:106839462-106839484 CTAGCTATGCAGAAAGTGCATGG - Intergenic
1123738970 15:23216469-23216491 CCAGCTCAGCAGAGGCTGGAAGG - Intergenic
1124290190 15:28445439-28445461 CCAGCTCAGCAGAGGCTGGAAGG - Intergenic
1124293048 15:28472129-28472151 CCAGCTCAGCAGAGGCTGGAAGG + Intergenic
1124550638 15:30678204-30678226 TTGGCTAATCATAGGGTGGATGG + Intronic
1125432135 15:39606035-39606057 CTAGATTAGCAGAGGGAGGGTGG - Intronic
1125663510 15:41412859-41412881 CTAGCCAAGCAGGTGGTGGCAGG + Intronic
1128717217 15:69917476-69917498 CAAGCTAAGCCCAGGGTGAAGGG + Intergenic
1128808941 15:70555922-70555944 CTAGCAAAGCCGGGGGTGGCTGG + Intergenic
1131040922 15:89266102-89266124 CTTGGGAAGCAGAGGCTGGAGGG - Intronic
1131509914 15:93044269-93044291 CTTTCTAAGCACAGGGTGGAAGG + Intronic
1131867807 15:96730710-96730732 CCAGAGAAGCAGAGGGTAGAGGG + Intergenic
1131968250 15:97867837-97867859 CTACCTAAGCCCATGGTGGAGGG + Intergenic
1132018510 15:98339793-98339815 CTGGCTTTGAAGAGGGTGGAAGG - Intergenic
1132130536 15:99273914-99273936 CTAGGGAACCAGTGGGTGGAGGG - Intronic
1133028088 16:2997329-2997351 CTAGCTAAGGAGAGGGCGAAGGG - Intergenic
1133089023 16:3389333-3389355 CTGGCTAAGCCCAGGGTGGGAGG - Intronic
1133234281 16:4380570-4380592 CTACCTAGGCAGAGGCAGGAGGG + Intronic
1133653825 16:7839765-7839787 CTAGTACAGCAGAGGCTGGAAGG - Intergenic
1134251682 16:12578551-12578573 CTAGCTTAGAAGATGGTGGAAGG + Intergenic
1135920808 16:26647364-26647386 CTAGCGAAGGAGAGAGGGGAGGG - Intergenic
1136708554 16:32212184-32212206 CCAGCTCAGCAGAGGCTGGGAGG + Intergenic
1136759353 16:32717228-32717250 CCAGCTCAGCAGAGGCTGGGAGG - Intergenic
1136808754 16:33153158-33153180 CCAGCTCAGCAGAGGCTGGGAGG + Intergenic
1137949954 16:52774218-52774240 CCAGCTATTCAGAAGGTGGAAGG + Intergenic
1138774145 16:59700522-59700544 ATAGCTCAGAAGAGTGTGGAAGG + Intergenic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1141866735 16:86755508-86755530 CTGGCTTAGCAGAGTGTGGCTGG + Intergenic
1203061508 16_KI270728v1_random:977537-977559 CCAGCTCAGCAGAGGCTGGGAGG - Intergenic
1142907361 17:3053133-3053155 CTCTCTAAGCAAAGGGAGGAGGG - Intergenic
1142927202 17:3251108-3251130 CTCTCTAAGCAAAGGGAGGAGGG + Intergenic
1143481201 17:7228169-7228191 CTAGAGAAGGTGAGGGTGGAAGG + Intronic
1143863985 17:9910832-9910854 CTAGGCAGCCAGAGGGTGGAAGG + Intronic
1145276453 17:21434177-21434199 CGAGCACAGCAGAGGGCGGAGGG + Intergenic
1147178554 17:38671519-38671541 CTCCCGAAGCACAGGGTGGAAGG + Intergenic
1147505720 17:41015356-41015378 CTAAATAAGCAGAGGGAGGCTGG + Intronic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1148394458 17:47296930-47296952 CTATTTAAGCGAAGGGTGGATGG - Intronic
1149511077 17:57242334-57242356 ATAGCACAGCAGAGTGTGGAAGG - Intergenic
1150048736 17:61938161-61938183 CAAGCTGAGCTGGGGGTGGAGGG + Intergenic
1150234139 17:63579002-63579024 TGAGCTCAGCTGAGGGTGGAGGG - Intronic
1150298930 17:64032344-64032366 CCAGCTCAGCAGGAGGTGGATGG - Intergenic
1150472945 17:65452736-65452758 CTAGCTAAGAACTGGATGGATGG + Intergenic
1150684878 17:67312501-67312523 GTTGCCAGGCAGAGGGTGGATGG - Intergenic
1151875702 17:76867185-76867207 CTGGCTAAGGAGATGTTGGAGGG - Intergenic
1153764711 18:8364623-8364645 CCCGCTGAGAAGAGGGTGGATGG - Intronic
1155780992 18:29835848-29835870 CTAGCAGAGCAGAGGATGCAGGG - Intergenic
1156063637 18:33114125-33114147 GTAGCAAAGATGAGGGTGGAAGG - Intronic
1156412311 18:36842498-36842520 ATCTCAAAGCAGAGGGTGGAAGG + Intronic
1157439091 18:47696679-47696701 CTAGTGGAGCAGAGGTTGGAGGG - Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1159044705 18:63358289-63358311 CTAGCTGAGAAGAGGCTGGGAGG + Intronic
1160123392 18:76149576-76149598 TTGGCTCAGCAGAGGATGGAAGG - Intergenic
1160203056 18:76810894-76810916 ATAGCTAAGGAGAAGGTGGAAGG - Intronic
1162897937 19:13776559-13776581 TTAGCAGAGGAGAGGGTGGAAGG - Intronic
1163056229 19:14720427-14720449 CAAGCTAAGAAGAGGGTGGCCGG + Exonic
1166594005 19:44028252-44028274 CCAGCTAAGCAGAAAGTGGGAGG - Intronic
1167520560 19:49952039-49952061 ATGGCTTAGCAGAGGCTGGAAGG + Intronic
1167632281 19:50632524-50632546 GCAGCTCAGCAAAGGGTGGATGG + Exonic
926418672 2:12675725-12675747 CTGGCAGAGCAGAGGGTGGGAGG - Intergenic
929812838 2:45206271-45206293 ATAGTTCAGCAGAGGGTGGAGGG + Intergenic
936088168 2:109483848-109483870 CCAGCTAAGCAGGGGATGGTGGG - Intronic
936116041 2:109704020-109704042 CTACCTAGGCTGAGGGTGGTGGG + Intergenic
936932037 2:117799755-117799777 CTTGCAAAGCAGAGGCTGGGGGG - Intergenic
938104411 2:128520348-128520370 CACGCCAAGCAGAGGCTGGAAGG + Intergenic
938503188 2:131846409-131846431 GGAGCTTATCAGAGGGTGGAGGG - Intergenic
941160569 2:162029963-162029985 ATAGATAAGCAGAGGATGGATGG - Intronic
942396175 2:175551989-175552011 CTAGCAAAGCAGATGGGGGAGGG + Intergenic
947216122 2:227751766-227751788 CTAGCCAAGCAGTGGGTCAAGGG + Intergenic
947492910 2:230611253-230611275 CCAGGGCAGCAGAGGGTGGAGGG - Intergenic
947857513 2:233334039-233334061 CTGGCTAGGCACAGGATGGAGGG + Intronic
948217715 2:236244241-236244263 CTATATGAGCAGAGGCTGGAGGG + Intronic
1169279571 20:4255490-4255512 CTATGTCAGCAGAGGCTGGAGGG + Intergenic
1169310271 20:4532133-4532155 CTTGCAAAGAAGAGGATGGAAGG - Intergenic
1171478636 20:25434885-25434907 CTTGCATAGCAGAAGGTGGAAGG + Intronic
1173943529 20:46932277-46932299 TTAGCTATGCAGAGACTGGAAGG - Intronic
1174607347 20:51770411-51770433 CTAGCAAAGCAGATGGGAGATGG - Intergenic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1176997386 21:15571357-15571379 CTAGAGAAACAGAGAGTGGAAGG + Intergenic
1177167569 21:17619747-17619769 CTAGCTAAGAACATGGTTGAAGG - Intergenic
1177439280 21:21099490-21099512 AGTGCTAAGCAAAGGGTGGAGGG + Intronic
1178141886 21:29693651-29693673 CTAGTTAATCATAGAGTGGAGGG + Intronic
1178301724 21:31458860-31458882 CTAGCCAGGCAGAGCTTGGAAGG + Intronic
1180116181 21:45706698-45706720 CTAGCCAGGCAGAGGGAGGCAGG + Intronic
1180299266 22:11023789-11023811 CTAGATAGGCAGATAGTGGAGGG - Intergenic
1185173006 22:49304384-49304406 CCAGCAAAGCACAGGCTGGAGGG + Intergenic
952417816 3:33105472-33105494 ATAGTTCAGCAGAGGGGGGAAGG - Intergenic
952808034 3:37375545-37375567 CTAGCCAAGCAAAGGGTAAAAGG - Intergenic
954886587 3:53880792-53880814 GGAGCTAACCAGAGGGAGGAGGG - Intronic
958064725 3:88528778-88528800 CTAGCAAAGCAGTAGGGGGAGGG + Intergenic
958410931 3:93814922-93814944 CTAGGGAAGCAGAGGCTGAAAGG + Intergenic
962121944 3:132570663-132570685 GTAGCCTACCAGAGGGTGGAAGG - Intronic
963106944 3:141655466-141655488 ATAGCTGAGCAGATGATGGAAGG - Intergenic
963281348 3:143387372-143387394 AAAGGTAAGCCGAGGGTGGAGGG + Intronic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
963923782 3:150930226-150930248 TTAGCTGAGCAGAGGGAGGCTGG + Intronic
964066039 3:152580786-152580808 CTAGCCAAGCAGACGTAGGATGG - Intergenic
964433317 3:156627144-156627166 CTAGCTAGCAAGAAGGTGGAAGG + Intergenic
965284843 3:166805561-166805583 CTAGCAAAGCAGAGGGTCAGTGG - Intergenic
967218496 3:187229741-187229763 CTAGGTAGGGAGAAGGTGGAAGG - Intronic
967826447 3:193881509-193881531 CTACCTGAGCAGAGAGAGGAAGG - Intergenic
972506047 4:39721242-39721264 CTAGCCATGTAGAGGGTAGAGGG + Intronic
972618105 4:40719596-40719618 CTAGCTAATCACAGGGTAGTAGG + Intergenic
973800700 4:54474933-54474955 TTGGCTATGCTGAGGGTGGATGG + Intergenic
976813035 4:89117653-89117675 CTAGCCAAGCAGAAGGAGTAGGG + Intergenic
977694434 4:99950404-99950426 CAAGCGAAGAAAAGGGTGGAGGG + Intergenic
977917972 4:102614560-102614582 GAGGCCAAGCAGAGGGTGGAAGG - Intronic
978143238 4:105341603-105341625 CTAGCTTTGAAGAGGGAGGAAGG - Intergenic
978940900 4:114434954-114434976 CTGGCAAAGCAGAGTGAGGAAGG + Intergenic
979490412 4:121320323-121320345 CTAGCAGATCAGAGGGAGGAAGG + Intergenic
979531621 4:121774453-121774475 CCAGCAAGGCAGAAGGTGGAAGG - Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
983144977 4:164202250-164202272 TAAGCTAAGGAGATGGTGGAGGG + Intronic
983566898 4:169162939-169162961 CTGGGTAAGGAGAGGATGGAGGG - Intronic
984679268 4:182588420-182588442 ATAGATAAGGACAGGGTGGAAGG - Intronic
985186751 4:187325798-187325820 CTAGGTAAGCAGAGGTGGGTAGG - Intergenic
987037832 5:14035908-14035930 CTAGCTAAGTAGGGAGTGGGAGG + Intergenic
991254504 5:64599454-64599476 GCAGCTCAGCAGAAGGTGGAGGG + Intronic
994337555 5:98585951-98585973 CTACCTACGAAGGGGGTGGAAGG + Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
998729333 5:145056244-145056266 ATAGCGAAGCAGAGGAGGGAGGG - Intergenic
999159683 5:149485070-149485092 CCAGCTACCCAGAAGGTGGAGGG - Intergenic
999275238 5:150325654-150325676 CTTGGTGTGCAGAGGGTGGAGGG - Intronic
999503759 5:152173830-152173852 AAAGCTAAGCAAAGGGTTGAAGG - Intergenic
1004882594 6:20023538-20023560 CTAGCTAATCAGCGGGGGGTTGG + Intergenic
1004904355 6:20222616-20222638 CTTGCAAAGCTGAGGCTGGAGGG + Intergenic
1006077380 6:31542440-31542462 CTAGCTGAGGGGAGGGAGGAGGG + Exonic
1007076965 6:39074269-39074291 CCAGCCAAGGAAAGGGTGGACGG + Intronic
1009055056 6:58325160-58325182 TTAACTAAGCAAAGGTTGGAAGG - Intergenic
1009417940 6:63436532-63436554 GTAGCAAAGCTGGGGGTGGAGGG - Intergenic
1015064472 6:129007105-129007127 GTAGCTATGCAGAGGGCGTAGGG + Intronic
1016505346 6:144772866-144772888 GTAGCTAAGGAGATGCTGGAGGG + Intronic
1016652456 6:146478352-146478374 CTACTTGAGCAGAGGGTGGGAGG - Intergenic
1018312116 6:162521320-162521342 CTAGTAAAGCAAAGGATGGATGG + Intronic
1019171656 6:170136420-170136442 TTAGAGAAGCAAAGGGTGGACGG - Intergenic
1019358807 7:594507-594529 CTAGGTAAGGACAGAGTGGAGGG + Intronic
1022600578 7:31755164-31755186 TTACGTAAACAGAGGGTGGATGG + Intronic
1023985099 7:45089384-45089406 CTGACCAAGCAGAGGGTGCAGGG + Intergenic
1023991244 7:45130084-45130106 CTGGCCAGGCAGAGGGTGGCTGG - Intergenic
1024737413 7:52320560-52320582 CTAGCCAAGCAGTAGATGGAAGG - Intergenic
1028016349 7:85719008-85719030 TTAGCCAAGGAGAGGGTGGAAGG + Intergenic
1030063780 7:105643526-105643548 CTAGCTGAGCAGCGGGGGGAGGG - Intronic
1031427309 7:121621363-121621385 CCAGCTGTGCAGAGGGAGGACGG - Intergenic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1035079025 7:156200817-156200839 CTAGCTGAGCAGGGGGAGCAGGG + Intergenic
1035092973 7:156329746-156329768 TTTTCTGAGCAGAGGGTGGAAGG - Intergenic
1035872454 8:3150437-3150459 CTTGCTCAGCAGAGAGTGGCCGG - Intronic
1036528635 8:9559345-9559367 CTAGCCAAGCAAAGGTTGGAAGG + Intronic
1038014237 8:23499742-23499764 GTAGCCAGGCAGAGGCTGGATGG + Intergenic
1038317928 8:26503340-26503362 CCAGCTCAGGAGAGGCTGGAAGG - Intronic
1039794444 8:40900299-40900321 CCAGCAGAGCAGAGTGTGGAGGG + Intergenic
1043303293 8:78761986-78762008 CCAGCGAAGAAGAGGGTGAAGGG - Intronic
1043618741 8:82160845-82160867 CTTGCTGAGCAGCGGGTGGTGGG + Intergenic
1044866262 8:96574046-96574068 CTAGCTATGCAGAGGGGAGGGGG - Intronic
1045590772 8:103593641-103593663 CTAGCTTAGTAGAAGGTGGCTGG - Intronic
1047060986 8:121225659-121225681 CTAGCAAAGCAGAGGCTTCATGG - Intergenic
1047610811 8:126518973-126518995 CCAGCTGAGCAGAGGGGAGAAGG + Intergenic
1047934615 8:129764612-129764634 CTGGCTATGCAGAGGTGGGAAGG + Intronic
1053219101 9:36296671-36296693 GAAGGGAAGCAGAGGGTGGAAGG + Intronic
1054850234 9:69839960-69839982 CCAGCTATTCAGAGGGTTGAGGG + Intronic
1055697978 9:78908935-78908957 CTAGCTTTGAAGATGGTGGAAGG + Intergenic
1057364255 9:94404038-94404060 CTCACAAAGCAGAAGGTGGAAGG - Intronic
1057659079 9:96984033-96984055 CTCACAAAGCAGAAGGTGGAAGG + Intronic
1058603163 9:106693075-106693097 CTAGCTAAGCAAAGGGCTCATGG - Intergenic
1062551785 9:137090991-137091013 CTAGCCGGGCAGAGGGTGTAGGG + Intronic
1187362413 X:18640976-18640998 ATTGCAAGGCAGAGGGTGGAGGG + Exonic
1188958586 X:36463743-36463765 CAAGCTAAACAGAGAATGGAAGG + Intergenic
1189980637 X:46506826-46506848 CCAGCAATGCAGAGGGTGAAGGG + Intronic
1193437787 X:81499648-81499670 CTGGCTATGCAAAAGGTGGAGGG + Intergenic
1200095391 X:153657224-153657246 CTAGCTGACCAGAGACTGGAGGG - Intergenic