ID: 1119266476

View in Genome Browser
Species Human (GRCh38)
Location 14:73265607-73265629
Sequence CCTGGAGTCCGGCTCAGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 179}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119266476_1119266485 3 Left 1119266476 14:73265607-73265629 CCAGTCCTGAGCCGGACTCCAGG 0: 1
1: 0
2: 3
3: 9
4: 179
Right 1119266485 14:73265633-73265655 TCTTGAGAGATGGAGCAGCTGGG 0: 1
1: 0
2: 2
3: 10
4: 253
1119266476_1119266489 19 Left 1119266476 14:73265607-73265629 CCAGTCCTGAGCCGGACTCCAGG 0: 1
1: 0
2: 3
3: 9
4: 179
Right 1119266489 14:73265649-73265671 AGCTGGGCAAAGGGCTCCTTGGG 0: 1
1: 0
2: 2
3: 14
4: 186
1119266476_1119266481 -7 Left 1119266476 14:73265607-73265629 CCAGTCCTGAGCCGGACTCCAGG 0: 1
1: 0
2: 3
3: 9
4: 179
Right 1119266481 14:73265623-73265645 CTCCAGGGCCTCTTGAGAGATGG 0: 1
1: 0
2: 0
3: 40
4: 453
1119266476_1119266486 9 Left 1119266476 14:73265607-73265629 CCAGTCCTGAGCCGGACTCCAGG 0: 1
1: 0
2: 3
3: 9
4: 179
Right 1119266486 14:73265639-73265661 GAGATGGAGCAGCTGGGCAAAGG 0: 1
1: 0
2: 2
3: 71
4: 681
1119266476_1119266490 23 Left 1119266476 14:73265607-73265629 CCAGTCCTGAGCCGGACTCCAGG 0: 1
1: 0
2: 3
3: 9
4: 179
Right 1119266490 14:73265653-73265675 GGGCAAAGGGCTCCTTGGGTTGG 0: 1
1: 0
2: 0
3: 15
4: 189
1119266476_1119266488 18 Left 1119266476 14:73265607-73265629 CCAGTCCTGAGCCGGACTCCAGG 0: 1
1: 0
2: 3
3: 9
4: 179
Right 1119266488 14:73265648-73265670 CAGCTGGGCAAAGGGCTCCTTGG 0: 1
1: 0
2: 0
3: 30
4: 307
1119266476_1119266487 10 Left 1119266476 14:73265607-73265629 CCAGTCCTGAGCCGGACTCCAGG 0: 1
1: 0
2: 3
3: 9
4: 179
Right 1119266487 14:73265640-73265662 AGATGGAGCAGCTGGGCAAAGGG 0: 1
1: 0
2: 5
3: 69
4: 620
1119266476_1119266484 2 Left 1119266476 14:73265607-73265629 CCAGTCCTGAGCCGGACTCCAGG 0: 1
1: 0
2: 3
3: 9
4: 179
Right 1119266484 14:73265632-73265654 CTCTTGAGAGATGGAGCAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119266476 Original CRISPR CCTGGAGTCCGGCTCAGGAC TGG (reversed) Intronic
900165505 1:1242888-1242910 CCTGGAGGCCGTCTCAGGCCTGG - Exonic
900180058 1:1307441-1307463 CCTGCAGTCCAGCTCTGGCCAGG - Intronic
901063680 1:6485242-6485264 CCTGGCCTCCCGCACAGGACTGG + Intronic
901628311 1:10635865-10635887 CCTGGAGTCCAGCTCAGGGAGGG + Intergenic
902236586 1:15061470-15061492 CCTGGGGCCCTGCTCAGGCCTGG + Intronic
903219163 1:21859511-21859533 CCTGCAGCCCAGCCCAGGACAGG + Intronic
904094643 1:27967332-27967354 CCTGGTGCCCGGCCCAGCACAGG - Exonic
904209016 1:28873562-28873584 GCTGAAGTCCAGCTCAGGGCAGG + Intergenic
914962486 1:152219150-152219172 ACACGAGTCTGGCTCAGGACAGG - Exonic
915751325 1:158213302-158213324 CCTGGAGTCTGGCTGAGTCCAGG - Intergenic
917717798 1:177755677-177755699 CCTGCAGTCCGCCTCTGCACAGG + Intergenic
922163720 1:223097520-223097542 CATGGAGACCAGCTCAGGATAGG - Intergenic
923516076 1:234698908-234698930 CATGGAGTCAGGCTCATAACAGG + Intergenic
923591810 1:235327258-235327280 CCCGGCGTCCGGCGCAGGGCCGG + Intronic
1065978294 10:30863731-30863753 CCAGGAGGCCGGCTCTGGAATGG - Intronic
1070813583 10:79310439-79310461 GCGGGCGTGCGGCTCAGGACTGG - Intronic
1071456054 10:85852450-85852472 CCTGGCGCCAGGCACAGGACTGG + Intronic
1073202767 10:101749660-101749682 CCTGGAGCGCGGCTGGGGACTGG - Intergenic
1073267739 10:102238352-102238374 CCAGGACTCAGGTTCAGGACGGG - Intronic
1074283017 10:112070846-112070868 CCTGGAGGCTGACTTAGGACAGG + Intergenic
1074752062 10:116596301-116596323 CCTGTAATCCTGCTCAGGCCTGG - Exonic
1076837923 10:133030376-133030398 CCTCGAGCCCGGCTCTGGCCTGG + Intergenic
1077049048 11:558555-558577 CCAGGAGTCCGGGCGAGGACAGG + Intronic
1077115061 11:880403-880425 CCTGGGGTCCAGCACAGGCCTGG - Intronic
1077501820 11:2912821-2912843 CCTGCTGTCTGGCTCAGGATAGG - Intronic
1077518226 11:3015285-3015307 CCTGGGCTCAGGGTCAGGACTGG + Intronic
1081676779 11:44974571-44974593 CCTGGAGTCTGGCTCAGCCCTGG - Intergenic
1083301068 11:61739841-61739863 CCTGGAGTCCTGCTCAGGGCTGG - Intronic
1084666577 11:70579604-70579626 CCTGGGATCCGGCCCAGGCCCGG - Intronic
1085134574 11:74074482-74074504 CATGGAGTCCAGCTCATGAGTGG + Exonic
1085516888 11:77116715-77116737 CCTGGAGGCAGGCTGAGGGCAGG - Intronic
1091041588 11:132285938-132285960 AATGGAGTTCAGCTCAGGACTGG + Intronic
1091582820 12:1799307-1799329 CCCGGAGTCCCGCTGAGGGCTGG + Intronic
1091649730 12:2301074-2301096 CCTGAGGACCGGCTCACGACAGG - Intronic
1092296367 12:7202282-7202304 CCTGGAGTCCGGTGCAGGGTCGG + Exonic
1094443513 12:30505415-30505437 CCTGGAGTCCTGCTGAGGAAGGG - Intergenic
1096516306 12:52157407-52157429 CCAGGTGTCCAGCTCAGGCCTGG + Intergenic
1099973672 12:89525283-89525305 CCCGGAGTCCGGCTTGGGAATGG + Intronic
1102298781 12:111756655-111756677 CCTGGAGTCTGTTTCAGGCCAGG + Exonic
1102302261 12:111779534-111779556 CCTGGAGTGAGGCTCACAACAGG - Intronic
1103209647 12:119156997-119157019 CCTGGGGCCCAGCTCAGGCCTGG + Exonic
1104021560 12:124995297-124995319 CCTGGAGTCTGGCGCGGGAAAGG + Intronic
1104439292 12:128781900-128781922 CCTGGAAACCTGCTCAGCACTGG + Intergenic
1104991294 12:132625219-132625241 CCTGGAGGAGGCCTCAGGACTGG - Intronic
1107416488 13:40206058-40206080 CCTGGAATCGTGCTCAGGCCAGG - Intergenic
1113179440 13:107608921-107608943 CCTGGTGCCCGGCCCAGCACAGG - Intronic
1113768539 13:112894900-112894922 CCTGGGGTCCGGCTGGGGTCGGG + Intronic
1117487464 14:56212769-56212791 CCTGGAGGCTGGGCCAGGACAGG + Intronic
1119266476 14:73265607-73265629 CCTGGAGTCCGGCTCAGGACTGG - Intronic
1119410592 14:74427558-74427580 CCTGGGGTCTGTCTCAGGGCTGG + Intergenic
1119519903 14:75277847-75277869 CCTGGGGCCCAGCTCAGAACCGG + Intergenic
1119711917 14:76828571-76828593 CCTGGAGTCCTCCTCCGGGCTGG + Intronic
1121043987 14:90774692-90774714 CCTGGAGTGCGGCTTAGGGAAGG - Intronic
1121125059 14:91400495-91400517 CCGGGAGTCCAGCTCTGGCCTGG - Intronic
1121278885 14:92686143-92686165 CCAGGAGTGTGGCTCAGGACTGG - Intronic
1122355928 14:101122806-101122828 CCTGGAGGCCTCCTGAGGACAGG - Intergenic
1123134200 14:106012184-106012206 GCAGGAGTCGGGCCCAGGACTGG - Intergenic
1123165884 14:106324516-106324538 GCAGGAGTCGGGCCCAGGACTGG - Intergenic
1123168584 14:106349548-106349570 GCAGGAGTCCGGCTCAGGACTGG - Intergenic
1123176270 14:106421974-106421996 GCAGGAGTCGGGCCCAGGACTGG - Intergenic
1123194839 14:106606378-106606400 GCAGGAGTCGGGCCCAGGACTGG - Intergenic
1123197122 14:106627508-106627530 GCAGGAGTCGGGCCCAGGACTGG - Intergenic
1123198463 14:106639384-106639406 GCAGGAGTCGGGCCCAGGACTGG - Intergenic
1202947416 14_KI270726v1_random:41594-41616 GCAGGAGTCGGGCCCAGGACTGG + Intergenic
1123584229 15:21742626-21742648 GCAGGAGTCGGGCCCAGGACTGG - Exonic
1123620880 15:22185229-22185251 GCAGGAGTCGGGCCCAGGACTGG - Intergenic
1130228155 15:82075739-82075761 CCTGGAGAAGGGCTCAGGGCTGG + Intergenic
1130601887 15:85281188-85281210 CCAGGAGGCAGGCTCAGGGCTGG + Intergenic
1130767020 15:86880979-86881001 CCAGGAGGCAGGCTCAGGGCTGG - Intronic
1132681549 16:1144515-1144537 CCTGGAGGCTGGCGCAGGATGGG - Intergenic
1133036351 16:3036241-3036263 CCTGGCGTGGGGCCCAGGACAGG + Intronic
1137548383 16:49419476-49419498 TCTGGAGTGAGGCTCAGGGCTGG + Intergenic
1138105389 16:54284943-54284965 GCTGGAGCCAGACTCAGGACCGG + Exonic
1138432966 16:56981282-56981304 CTTGGAGTCAGGCACAGGGCGGG + Intronic
1138534785 16:57654085-57654107 CCTGGAGGCCGGCTGTGGGCTGG - Exonic
1140564931 16:76030903-76030925 CCTGGCCTCCACCTCAGGACGGG + Intergenic
1142743570 17:1943752-1943774 CCTGGAGCCTGGCTCAGCCCTGG + Intronic
1144966379 17:19079175-19079197 CCTGGAGTCCAGCTGGGCACGGG + Intergenic
1144981539 17:19172882-19172904 CCTGGAGTCCAGCTGGGCACGGG - Intergenic
1144986685 17:19205357-19205379 CCTGGAGTCCAGCTGGGCACGGG + Intergenic
1146651873 17:34612135-34612157 CCTAGAGACCAGCTCAGGAAGGG + Intronic
1147557513 17:41488843-41488865 CCTGGGGTGTGGCTCAGGGCTGG - Intronic
1151423979 17:74017615-74017637 CCTGGAGTCAGGGTCAGCAGGGG + Intergenic
1152016958 17:77757065-77757087 CCTGGAGTCCCACTCAGGGTGGG + Intergenic
1152413557 17:80144140-80144162 CCTGGGGTGCGGCGCAGGGCTGG - Intronic
1152705874 17:81843396-81843418 CCTGGGGCCCGGCACAGGCCTGG - Exonic
1157220704 18:45826790-45826812 ACTGGAGTCCAGCTCGGGGCTGG + Intronic
1157623317 18:49028368-49028390 TCTGGAGTACAGCTCAGGAGTGG - Intergenic
1159010760 18:63057173-63057195 CCTGGAGTCCAGGTCAGGGTTGG + Intergenic
1160572291 18:79826318-79826340 CCTGGAGCCTGGCTCTGGAGGGG - Intergenic
1160742679 19:694750-694772 CCTGGAGTCCCCCTCATGTCGGG + Intronic
1160751540 19:736664-736686 CCTGGGGCCCGGCACAGGACAGG + Intronic
1160993642 19:1871968-1871990 CCTGCAGTCCTGCTGAGGAGGGG - Intergenic
1161014343 19:1976259-1976281 CCTGGTCCCCGGCTCAGGACTGG + Intronic
1161014355 19:1976291-1976313 CCTGGTCCCTGGCTCAGGACTGG + Intronic
1161067340 19:2245285-2245307 CCTGGGGTTTGGCTGAGGACAGG - Intronic
1161069262 19:2252305-2252327 CCTGGACTCCGGCGCGGGGCCGG + Exonic
1161699240 19:5785864-5785886 TCTGGGCTCCGGCTCAGGCCAGG - Intronic
1161905353 19:7152452-7152474 CGTGGAGACCAGCTCAGGAGAGG + Intronic
1162189946 19:8937043-8937065 GCTGGATTCTGCCTCAGGACTGG + Exonic
1163195636 19:15717684-15717706 CCTGGAGCCCGCTTGAGGACTGG + Intergenic
1165120014 19:33552839-33552861 TCTGGAGTCTGGCTCAGCTCTGG + Intergenic
1167138379 19:47632327-47632349 CCCAGAGTCCGGCACAGGCCTGG - Intronic
1168721832 19:58558572-58558594 CCCGTAGTCCGGCTCCGGCCTGG + Exonic
931637068 2:64350513-64350535 TCTGGAGTCCTCCTCAGGAATGG + Intergenic
936462194 2:112722100-112722122 CCAGGTGTGTGGCTCAGGACAGG + Exonic
937311611 2:120906355-120906377 CCTGGAGTCCAGGGCAGGAGAGG - Intronic
937333696 2:121047562-121047584 CCTGGAGCTCTGCCCAGGACCGG + Intergenic
941645010 2:168030943-168030965 CCAGGAGACCGGATGAGGACAGG + Intronic
948628288 2:239284204-239284226 CCTGTAGCTGGGCTCAGGACCGG - Intronic
1172869356 20:38126286-38126308 CCTGGACTCCGGATCAGAGCTGG - Intronic
1174054084 20:47785905-47785927 CCCGAAGTCCAGCTCCGGACGGG + Exonic
1174412466 20:50344805-50344827 CCTGGAGTCCTCGTCAGGTCAGG + Intergenic
1175676162 20:60948561-60948583 CCTGCAGTCCCGCTCAAGCCTGG - Intergenic
1176148995 20:63579370-63579392 CCTGGAGGCAGCCTCAGGATGGG + Intergenic
1178498017 21:33103241-33103263 CCTGGCTTCAGGCTGAGGACGGG + Intergenic
1178807330 21:35850687-35850709 CCTGGAGGCCAGCTCACCACAGG - Intronic
1178843541 21:36156697-36156719 CCTGGAGGCGGGCTCAGGGGCGG - Intergenic
1182429452 22:30291311-30291333 CCTGGAGCCCTGGTCAGGAGAGG + Intronic
1183080039 22:35450440-35450462 CCTGGAGTCTGTCCCAGGAGGGG - Intergenic
1183379940 22:37485714-37485736 CCTGGAGTCAGGACCAGTACAGG + Intronic
1183483032 22:38075280-38075302 CCTGGGCTCCTGCCCAGGACAGG + Exonic
1183821074 22:40346480-40346502 CCTGGAGGCCAGGGCAGGACGGG - Intergenic
1184160468 22:42694424-42694446 CCTGGGGTTCGTCTAAGGACAGG + Intronic
1184607138 22:45580658-45580680 CCTGGGCTCCGGCTCTGGGCGGG - Intronic
1184841067 22:47052679-47052701 ACAGGAGTCCTGCTCAGGACAGG - Intronic
1184877054 22:47282661-47282683 CCTGGTGCCCAGCTCAGGGCAGG + Intergenic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
950027757 3:9832513-9832535 CCTGGAGCCCAGCTGAGGGCAGG + Intronic
950310578 3:11954328-11954350 CATGGAGTCTGGCACAGGGCAGG + Intergenic
953272071 3:41455571-41455593 CCAGAAGTCTGGCTCAGGAGAGG - Exonic
953609264 3:44433881-44433903 CCTTGAGACCTGATCAGGACCGG - Intergenic
956026015 3:64983905-64983927 CCTGGAGGCCAGCTCAGTCCAGG - Intergenic
961441832 3:126958004-126958026 CCTGTAGACCAGCTCAGGGCAGG - Intronic
967805583 3:193712085-193712107 CCTGGAGTCAGGCTGTGGAGAGG - Intergenic
968442015 4:628966-628988 CCTGGAGCCTGGCCCAGGCCTGG + Intronic
968662252 4:1803498-1803520 CCTGGCTTCGGGCTCAGTACCGG + Intronic
969363956 4:6683094-6683116 CCTGGAGCCCAGCTCAGGACAGG - Intergenic
969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG + Intronic
969600937 4:8176056-8176078 CCTGGAGCCCGTCTCCGCACAGG - Intergenic
980306276 4:131065023-131065045 CCTGGAGTCTGGCTGAGTCCAGG + Intergenic
984335034 4:178379456-178379478 CCTGTAGTGGGGCTCAGGCCTGG - Intergenic
986112186 5:4730521-4730543 CCTGGAGCCAGGATCTGGACTGG - Intergenic
988860393 5:35271570-35271592 CCTGGAGCCAGACTCATGACTGG - Intergenic
992153128 5:73926098-73926120 CCTGGTGTCCAGCCCAGGGCAGG + Intronic
997225877 5:132209076-132209098 CCTGGACTCTGGCTCTGGGCAGG - Intronic
997364104 5:133314451-133314473 CCTGAAAGCAGGCTCAGGACTGG + Intronic
997690183 5:135823029-135823051 CAAGGAGTCTGGCTTAGGACAGG + Intergenic
999743993 5:154577705-154577727 CCTGGAATGCAGCTCAAGACAGG + Intergenic
1001122597 5:168992633-168992655 CCTGGGGTCCTGCTCAGGCCTGG + Intronic
1002044468 5:176534146-176534168 CCTTGTGTCCAGCTCAGGGCAGG + Intronic
1002603550 5:180369032-180369054 CCTGGAGTCCCGCCGAGCACAGG + Intergenic
1004273306 6:14213406-14213428 CCTGGAGGCTGGCTTAGGTCTGG - Intergenic
1005992045 6:30909253-30909275 CCTGGAGTCGGGGTGGGGACTGG + Intronic
1008547392 6:52595443-52595465 TATGGACTCAGGCTCAGGACAGG + Intergenic
1014175364 6:118325900-118325922 CCAGGAGTCCAATTCAGGACAGG - Intergenic
1015736335 6:136403806-136403828 TCATGAGTCAGGCTCAGGACTGG - Intronic
1015848645 6:137549040-137549062 CATGGAGTCCGGCCCAAGAGTGG + Intergenic
1016758839 6:147715881-147715903 CCTGGAGTCTGGCTGAGTTCAGG + Intronic
1019519655 7:1454910-1454932 TCTGGAGGCGGGCTCAGGGCTGG - Intronic
1020078757 7:5275360-5275382 GCTGGAGGCAGGCCCAGGACAGG - Intronic
1020503966 7:8959942-8959964 CCTGGAGCCTGGCTCAAGCCTGG - Intergenic
1025144828 7:56493905-56493927 CCTGGGGTCCAGCTCTGCACAGG + Intergenic
1025200138 7:56956825-56956847 GCTGGAGGCAGGCCCAGGACAGG + Intergenic
1025260415 7:57414360-57414382 CCTGGGGTCCAGCTCTGCACAGG + Intergenic
1025671806 7:63620107-63620129 GCTGGAGGCAGGCCCAGGACAGG - Intergenic
1026349862 7:69506419-69506441 CCTGGAGGTTGGCTGAGGACAGG - Intergenic
1029692642 7:102192377-102192399 CCTGGAGTACGGACCAGGAGTGG + Intronic
1034637122 7:152576327-152576349 CCTGGGGCCCACCTCAGGACTGG + Intergenic
1034964858 7:155384626-155384648 CCTGGATTCTGGTTCAGGGCGGG - Intronic
1035045167 7:155960936-155960958 CCTGAAGGCCAGCTCAGGGCAGG - Intergenic
1036210380 8:6835705-6835727 GGTGGAGTCCAGCTCAGGTCCGG + Intergenic
1036667803 8:10759103-10759125 TCTGGGGGCCGGATCAGGACAGG + Intronic
1037876636 8:22551876-22551898 CCTCGTGACCGGGTCAGGACGGG - Exonic
1038431749 8:27505790-27505812 CCTGGAGTCAGCCTCAGAGCAGG + Intronic
1039880206 8:41620992-41621014 GCTGGAGGCAGGCTCAGGAGCGG - Exonic
1040548505 8:48420509-48420531 CCTGGACTCCGGCCCAGCATGGG + Intergenic
1047404163 8:124571182-124571204 CCTGGAATCTGCCTCAGGGCAGG + Intronic
1049554251 8:143274329-143274351 CCTGCAGTGCTGCTCTGGACCGG - Intronic
1051822989 9:21190870-21190892 CCTGGAGTCTTGCTTAGGGCAGG - Intergenic
1051824813 9:21209405-21209427 CCTGGAGTCTTGCTTAGGGCAGG - Intronic
1051826809 9:21231482-21231504 CCTGGAGTCTTGCTTAGGGCAGG - Intronic
1053786332 9:41655227-41655249 CCCGGACCCCGGCCCAGGACCGG - Intergenic
1055142540 9:72892252-72892274 CCTGGAGTGCTGCTGAGGGCTGG + Intergenic
1056555512 9:87684246-87684268 CCTGGAGGCATGCTCAGGAGCGG - Intronic
1056869912 9:90267869-90267891 CCAGGAGTCCTCCTCAGGAGAGG + Intergenic
1057270369 9:93646982-93647004 GCTGGATCCCGGCTCAGGGCAGG - Intronic
1058946018 9:109857072-109857094 CCTGGAGGCAGTCTCAGGGCAGG - Intronic
1060752495 9:126182588-126182610 CCTGGACTCAGCCCCAGGACTGG + Intergenic
1062108868 9:134771187-134771209 CCGAGAGCCCGGCTCTGGACCGG - Intronic
1062729510 9:138101307-138101329 GCTGGAGTGCGGGGCAGGACAGG - Intronic
1198081028 X:133239595-133239617 CATGGTGGCCAGCTCAGGACTGG - Intergenic