ID: 1119266476

View in Genome Browser
Species Human (GRCh38)
Location 14:73265607-73265629
Sequence CCTGGAGTCCGGCTCAGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 179}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119266476_1119266486 9 Left 1119266476 14:73265607-73265629 CCAGTCCTGAGCCGGACTCCAGG 0: 1
1: 0
2: 3
3: 9
4: 179
Right 1119266486 14:73265639-73265661 GAGATGGAGCAGCTGGGCAAAGG 0: 1
1: 0
2: 2
3: 71
4: 681
1119266476_1119266487 10 Left 1119266476 14:73265607-73265629 CCAGTCCTGAGCCGGACTCCAGG 0: 1
1: 0
2: 3
3: 9
4: 179
Right 1119266487 14:73265640-73265662 AGATGGAGCAGCTGGGCAAAGGG 0: 1
1: 0
2: 5
3: 69
4: 620
1119266476_1119266481 -7 Left 1119266476 14:73265607-73265629 CCAGTCCTGAGCCGGACTCCAGG 0: 1
1: 0
2: 3
3: 9
4: 179
Right 1119266481 14:73265623-73265645 CTCCAGGGCCTCTTGAGAGATGG 0: 1
1: 0
2: 0
3: 40
4: 453
1119266476_1119266484 2 Left 1119266476 14:73265607-73265629 CCAGTCCTGAGCCGGACTCCAGG 0: 1
1: 0
2: 3
3: 9
4: 179
Right 1119266484 14:73265632-73265654 CTCTTGAGAGATGGAGCAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 220
1119266476_1119266489 19 Left 1119266476 14:73265607-73265629 CCAGTCCTGAGCCGGACTCCAGG 0: 1
1: 0
2: 3
3: 9
4: 179
Right 1119266489 14:73265649-73265671 AGCTGGGCAAAGGGCTCCTTGGG 0: 1
1: 0
2: 2
3: 14
4: 186
1119266476_1119266488 18 Left 1119266476 14:73265607-73265629 CCAGTCCTGAGCCGGACTCCAGG 0: 1
1: 0
2: 3
3: 9
4: 179
Right 1119266488 14:73265648-73265670 CAGCTGGGCAAAGGGCTCCTTGG 0: 1
1: 0
2: 0
3: 30
4: 307
1119266476_1119266485 3 Left 1119266476 14:73265607-73265629 CCAGTCCTGAGCCGGACTCCAGG 0: 1
1: 0
2: 3
3: 9
4: 179
Right 1119266485 14:73265633-73265655 TCTTGAGAGATGGAGCAGCTGGG 0: 1
1: 0
2: 2
3: 10
4: 253
1119266476_1119266490 23 Left 1119266476 14:73265607-73265629 CCAGTCCTGAGCCGGACTCCAGG 0: 1
1: 0
2: 3
3: 9
4: 179
Right 1119266490 14:73265653-73265675 GGGCAAAGGGCTCCTTGGGTTGG 0: 1
1: 0
2: 0
3: 15
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119266476 Original CRISPR CCTGGAGTCCGGCTCAGGAC TGG (reversed) Intronic