ID: 1119280209

View in Genome Browser
Species Human (GRCh38)
Location 14:73400465-73400487
Sequence CAAATTATGAAACATATAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 631
Summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 571}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119280206_1119280209 29 Left 1119280206 14:73400413-73400435 CCTAAGGACTTAGGGTGAAAATA 0: 1
1: 0
2: 1
3: 18
4: 173
Right 1119280209 14:73400465-73400487 CAAATTATGAAACATATAATTGG 0: 1
1: 0
2: 4
3: 55
4: 571

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119280209 Original CRISPR CAAATTATGAAACATATAAT TGG Intronic
901254806 1:7813788-7813810 GAAATTATGTAGCATATGATGGG + Intronic
901437542 1:9257074-9257096 CAATAAATGAAAAATATAATTGG - Intronic
902832583 1:19026931-19026953 CAAATTTGAAAACATAAAATGGG + Intergenic
906013216 1:42549198-42549220 CAATATATGAAACATAAAAGTGG - Intronic
906336120 1:44932817-44932839 CAAAATATGAAACAAATATGTGG + Intronic
907646659 1:56251418-56251440 CAAGTTATGAAAAATACTATAGG + Intergenic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
907933792 1:59023911-59023933 CAAATTATGAGACATAAATCAGG + Intergenic
908134734 1:61118990-61119012 CAGAATATGAAAGATATTATAGG + Intronic
908434897 1:64095888-64095910 TAAATTATGAAGTTTATAATTGG + Intronic
908586207 1:65572551-65572573 TAAAAAATAAAACATATAATAGG - Intronic
909160396 1:72140950-72140972 CAAATTATCTAACACATATTAGG - Intronic
909238121 1:73178967-73178989 CAAATTATGCTACATAAAATCGG + Intergenic
909261384 1:73493500-73493522 CAAAAGATGATACACATAATTGG - Intergenic
910031807 1:82735162-82735184 CAACTTATGAAAGAGAAAATGGG + Intergenic
910527828 1:88201396-88201418 TAACTTAGGAAACATGTAATAGG + Intergenic
910690450 1:89960038-89960060 CACAGTAAGAAACATATATTTGG - Intergenic
910824190 1:91388204-91388226 CAAATTATTAAACCTAAGATGGG + Intronic
911419409 1:97620669-97620691 AAAATTATGAACAATATAAAAGG - Intronic
911749721 1:101482253-101482275 AAAATTGTGAAATATATATTTGG - Intergenic
911786411 1:101954775-101954797 CAAAATTTAAAACATTTAATTGG + Intronic
912015741 1:105033254-105033276 CAGATTATGAAACAAGGAATAGG - Intergenic
912202880 1:107478274-107478296 TAAATAATGAAATATATTATAGG + Intronic
914405755 1:147370392-147370414 TATATTATAAAACATATACTTGG + Intergenic
915005981 1:152636723-152636745 CAAATTTTTAAAAATATATTTGG - Intergenic
915047944 1:153034679-153034701 CAAATTATGAAACAAACAAATGG + Intergenic
916821914 1:168407893-168407915 CAAATTATGTTACATGTAAGTGG + Intergenic
917123266 1:171663003-171663025 AAAAATATGAACCATATAGTTGG - Intergenic
917226744 1:172791388-172791410 CAAATTAGGAGAAGTATAATAGG - Intergenic
917450866 1:175146332-175146354 CAAATTAAAATACATAAAATTGG + Intronic
918153409 1:181818792-181818814 CAATTTAAGCAACATTTAATGGG + Intergenic
918823395 1:189288834-189288856 CAAATTAAAAAAGCTATAATAGG - Intergenic
918991662 1:191704310-191704332 CAAATTAAGATATATTTAATTGG - Intergenic
919126397 1:193398369-193398391 CAAATTGTGAAACAAATATAAGG + Intergenic
919702050 1:200640920-200640942 CACATTATAAAATATAAAATAGG + Intronic
919778567 1:201209008-201209030 CAATGGATGAAACAGATAATAGG + Exonic
920427951 1:205893434-205893456 CAACATATGATGCATATAATGGG + Intergenic
920523782 1:206650040-206650062 AAAATTAAGAAACATAAAAAGGG - Intronic
921516169 1:216095154-216095176 AAAATGATGAAACAAAAAATAGG - Intronic
921621027 1:217326457-217326479 CGACTTAAGAAACATTTAATGGG - Intergenic
921782407 1:219181125-219181147 CAAAATATTCAACATGTAATCGG + Intronic
921787418 1:219246903-219246925 AAAATAAAGAAACATGTAATGGG + Intergenic
924063111 1:240196925-240196947 GATATTATGAAACATACATTTGG + Intronic
924214092 1:241801859-241801881 ATAATTATGAAACCTTTAATAGG + Exonic
924319476 1:242834086-242834108 CAAATCCAGAAACATATAAATGG + Intergenic
924551809 1:245085076-245085098 CTAAATATTAAACATATAGTAGG - Intronic
1064607054 10:17053289-17053311 CATAGTAAAAAACATATAATTGG - Intronic
1064843317 10:19621261-19621283 TTATTTATAAAACATATAATTGG + Intronic
1065440913 10:25752635-25752657 CAAATTATAAAACATATCCAGGG - Intergenic
1065581609 10:27177344-27177366 CAAATTATAATACAGAAAATGGG - Intronic
1066972442 10:42324397-42324419 CAAATTATAAATAAAATAATAGG - Intergenic
1068180120 10:53506601-53506623 GAAAGAATGAAACATATAACAGG - Intergenic
1068436369 10:56996384-56996406 AGAATAATGAAACATAGAATTGG + Intergenic
1068623756 10:59216070-59216092 CAAATTATGAAATATAAAATTGG + Intronic
1069020327 10:63479984-63480006 CAAATTAAAAAATATATATTTGG - Intergenic
1069267397 10:66478429-66478451 AAAATTTTGAAATACATAATTGG + Intronic
1070017975 10:72553818-72553840 CAAAATATATACCATATAATAGG - Intronic
1071060571 10:81566728-81566750 TAAATCATGATAAATATAATTGG + Intergenic
1071216796 10:83413695-83413717 CAAAATTTGAAACAAATACTTGG + Intergenic
1071387565 10:85137777-85137799 GTAATTATGAAACCTACAATAGG + Intergenic
1071678165 10:87676497-87676519 ATAATTATGAAACATTTAAGTGG - Intronic
1071995132 10:91140442-91140464 GATATTGTGAAACATATATTTGG + Intergenic
1072028715 10:91494529-91494551 TAAATTATGAGACATATATATGG + Intronic
1072327164 10:94310124-94310146 CACATTATTAAACATGTAAAGGG - Intronic
1072601591 10:96935994-96936016 CAAATAAACAAACATTTAATAGG - Intronic
1073800513 10:107036839-107036861 CAAATTCTAAAACATTTAATTGG + Intronic
1074553006 10:114462705-114462727 CAAAATATAATATATATAATTGG - Intronic
1074670598 10:115786169-115786191 AGAATTATGAAGCATATGATAGG - Intronic
1075501965 10:122983177-122983199 CAAATTATGACAATTATAGTAGG - Intronic
1076037398 10:127211632-127211654 GAAATTATGGATCAGATAATTGG + Intronic
1078964471 11:16321955-16321977 TAAATTAATAAACTTATAATAGG + Intronic
1079621618 11:22562562-22562584 AAAATTATAAAAAATAAAATGGG - Intergenic
1079840337 11:25389483-25389505 AAAATTACAAATCATATAATTGG - Intergenic
1079966504 11:26986833-26986855 AAAATGATGAGAAATATAATTGG + Intergenic
1080072371 11:28105409-28105431 GAAATTTTAAAACATTTAATTGG + Intronic
1080758082 11:35221328-35221350 AATATTATTAAACATATAAAAGG - Intronic
1081170371 11:39861836-39861858 GAAAAGATGAACCATATAATAGG - Intergenic
1082293465 11:50410745-50410767 GATATTATGAAATATATATTTGG - Intergenic
1082849043 11:57749165-57749187 CAATATATTAAAAATATAATTGG - Intronic
1084406548 11:68977294-68977316 CTAATTATTAAAAATATTATAGG - Intergenic
1085561617 11:77477027-77477049 CAAATTATCAAACACAAAGTGGG - Intergenic
1086081205 11:82903788-82903810 TAAAATATGAAACAGAAAATTGG + Intronic
1087514142 11:99135766-99135788 ATAAATATGCAACATATAATTGG - Intronic
1087515621 11:99155522-99155544 CAAATTATAATGCAAATAATAGG - Intronic
1087802002 11:102514609-102514631 AAAATTATCAAAGAAATAATTGG - Intergenic
1089799654 11:121015026-121015048 CAAATTAACAGACAAATAATAGG + Intergenic
1089855529 11:121541033-121541055 AAAATTTTGAAACAGATATTTGG - Intronic
1090099331 11:123777616-123777638 CACATTGTATAACATATAATAGG - Intergenic
1090191582 11:124773956-124773978 CAAATTATGAAAATAAAAATTGG + Intronic
1090558820 11:127906638-127906660 AAAATTCTTAAACATATTATTGG + Intergenic
1090577444 11:128121853-128121875 CAAATTCAGAAACATATGAAAGG + Intergenic
1090966336 11:131600616-131600638 GAAATTTTAAAACATATAATGGG + Intronic
1091592238 12:1850498-1850520 CAACTTATAAAACAGATAAAGGG - Intronic
1091690793 12:2596096-2596118 CTAATTATGACACCTAGAATTGG - Intronic
1093577074 12:20744414-20744436 CAATTTATGTAACAGACAATGGG + Intronic
1093696886 12:22170944-22170966 CAAATTCAGAGACATGTAATTGG + Intronic
1094359567 12:29615698-29615720 CATAGAATGAAAAATATAATTGG + Intronic
1094596341 12:31870138-31870160 GATATTATGAAATATATATTTGG - Intergenic
1095605354 12:44061054-44061076 CAAATTATGGAACAGAAAAGTGG + Intronic
1095719908 12:45389120-45389142 CAATTTATAAAACCTATAGTTGG - Intronic
1097435782 12:59550819-59550841 CATATTAGGAAAAATATCATGGG - Intergenic
1097667640 12:62498534-62498556 AAAATTATGAAACTTTTAAAAGG - Intronic
1097721304 12:63024484-63024506 CAAATTAAGAAACCTATCAAGGG - Intergenic
1097729263 12:63109094-63109116 CAGATTATGGAACATTAAATGGG + Intergenic
1097984114 12:65765221-65765243 AAAATTATGAATCATTAAATGGG - Intergenic
1098151090 12:67547327-67547349 CAAGCTATGAAAAATATAAAAGG - Intergenic
1098797979 12:74917242-74917264 AAAAATAGGGAACATATAATTGG - Intergenic
1099038704 12:77622766-77622788 GAATTTATGAAACATAAAGTTGG + Intergenic
1099053592 12:77810150-77810172 CAAACAAACAAACATATAATGGG - Intergenic
1099135655 12:78896535-78896557 CATATTCTGAAACATAGAAGAGG + Intronic
1099218686 12:79885440-79885462 TAAATTATGAAACAGTTAAATGG + Intronic
1099766537 12:86994683-86994705 CCAATTTTAAAACATGTAATGGG - Intergenic
1099833847 12:87881253-87881275 TAAATTAAAAAACATAAAATTGG - Intergenic
1100946609 12:99790742-99790764 CAAATAAAAAAACATACAATGGG + Intronic
1100969113 12:100047765-100047787 GAAATTAGGAAATATATAACAGG - Intronic
1101257280 12:102990806-102990828 GCAATCATGAAACATATAAATGG + Intergenic
1102290899 12:111698784-111698806 CAAATCATGTAACAGATAAACGG - Intronic
1104361170 12:128134441-128134463 AAAATTGTAAAACATAAAATAGG - Intergenic
1105228012 13:18455682-18455704 CAAATTATAAATAAAATAATAGG - Intergenic
1105358075 13:19678410-19678432 CATATTATAAAACATATATAAGG - Intronic
1105940675 13:25145505-25145527 GATATTATGAAATATATACTTGG + Intergenic
1106612632 13:31298245-31298267 GATATTATGAAATATATATTTGG - Intronic
1106647117 13:31648105-31648127 AAAATTCTGAAACAAAAAATTGG + Intergenic
1106986699 13:35361120-35361142 CACAATATGTTACATATAATAGG + Intronic
1107265782 13:38552464-38552486 CAAATTAAAAAACATACAATAGG - Intergenic
1107373737 13:39779913-39779935 AAAATTAAGAAACATTTATTAGG + Intronic
1108979031 13:56486783-56486805 CAAATAATACAACATATAAATGG + Intergenic
1109080921 13:57899965-57899987 CAAATTATATAATATATAATAGG - Intergenic
1109094185 13:58090187-58090209 CTAATCATAAAACATATAAATGG + Intergenic
1109174727 13:59141246-59141268 CAAATTAAGAAACATTTGAATGG + Intergenic
1109239279 13:59863622-59863644 CACATCATGACACATGTAATAGG + Intronic
1109636700 13:65128707-65128729 TAAGTTATGCATCATATAATGGG - Intergenic
1109706522 13:66100259-66100281 CAAAATATAAAAAACATAATAGG - Intergenic
1109737308 13:66503825-66503847 CAAATAATGATGCACATAATGGG - Intronic
1110530030 13:76586282-76586304 CAGATTATGACATATATTATTGG - Intergenic
1110589695 13:77241749-77241771 TAAATTGTAAAACATATACTTGG - Intronic
1110939320 13:81329688-81329710 CAAATTATGAACCAAATGAATGG - Intergenic
1110998577 13:82146447-82146469 GAAATGATCAAACATATAATAGG - Intergenic
1111088462 13:83408954-83408976 CAAATAATTAAAAATATATTAGG + Intergenic
1111973082 13:94937696-94937718 TAAACCATGAAATATATAATTGG + Intergenic
1112196371 13:97230400-97230422 CTAATGATGAAACATCTAAGTGG + Intronic
1112607201 13:100918509-100918531 CAAATTATCAAACATTAAAAAGG + Intergenic
1114784140 14:25574966-25574988 CAAAATATGTAAGATATAATGGG + Intergenic
1115200230 14:30845263-30845285 CAAATTATGAAACTACTAAAAGG - Intergenic
1115924789 14:38419819-38419841 CAAATTAAGAATCTCATAATAGG + Intergenic
1116519946 14:45835017-45835039 GATATTATGAAAAATATAACGGG + Intergenic
1116672151 14:47856829-47856851 TCAATTATGCAACATTTAATAGG + Intergenic
1116990285 14:51268886-51268908 CATAATATGAAATATATATTTGG + Intergenic
1117011509 14:51475182-51475204 GAAATAATGAAAAATATAATTGG - Intergenic
1117099052 14:52326828-52326850 CAATTCATGACACATATATTAGG + Intronic
1117248718 14:53913733-53913755 CAAAATATGAAAGATAAAATGGG + Intergenic
1118511900 14:66484277-66484299 AGAATTTTGAAACATTTAATGGG - Intergenic
1118520445 14:66576866-66576888 CAAATTATGAATTATTTAAATGG - Intronic
1118911505 14:70065672-70065694 CTATTTATGAAACTTTTAATAGG - Intronic
1119142318 14:72278515-72278537 CAAATCATGCAACATATTGTTGG - Intronic
1119280209 14:73400465-73400487 CAAATTATGAAACATATAATTGG + Intronic
1120078798 14:80191074-80191096 AAAATGATGAAAGATATAGTTGG - Intergenic
1120123250 14:80708595-80708617 CAAAATAAAAAACAAATAATGGG - Intronic
1120251725 14:82066981-82067003 CAAATTTTGAAACATGAAATTGG - Intergenic
1120399697 14:84014457-84014479 CAAATTACTTAATATATAATTGG + Intergenic
1120782797 14:88501091-88501113 CAAAGTATGAACCACAAAATGGG + Intronic
1124473103 15:30006098-30006120 CAAATAAGCAAACATATACTAGG - Intergenic
1125029086 15:35058294-35058316 CGTATTATGAAACATAAAAGTGG - Intergenic
1125217852 15:37298139-37298161 CAAATAATCAAAGATAAAATGGG - Intergenic
1127159606 15:56167500-56167522 CTAATTATGAAAAATGTAACTGG + Intronic
1127302459 15:57668673-57668695 CAAAAGATGAAACTTATAAATGG - Intronic
1128003165 15:64213204-64213226 CAATATATGAAACATAAAAAAGG + Intronic
1128465997 15:67912092-67912114 CAAATTTTGAAATATCTCATGGG + Intergenic
1129007620 15:72387364-72387386 CAAAATATGAAACACACAAAAGG - Intergenic
1129662352 15:77560242-77560264 CATATTATGAACCATATCATAGG - Intergenic
1130266762 15:82412422-82412444 AAACTTATGAAACATATGAAGGG - Intergenic
1131652866 15:94421390-94421412 CAAATTATCAAAGACATAAGTGG + Intronic
1131734831 15:95320747-95320769 GATATTATGAAATATATATTTGG - Intergenic
1132308364 15:100835399-100835421 GAAAATATGGTACATATAATCGG - Intergenic
1133007625 16:2893431-2893453 CATATTGTGAAATATATATTTGG - Intronic
1133128065 16:3659187-3659209 CACATGTTGAAACATATTATAGG + Exonic
1133667435 16:7982988-7983010 TACATTCTGAAACATCTAATTGG + Intergenic
1133990957 16:10707314-10707336 GATATTATGAAAAATAAAATGGG + Intergenic
1135776728 16:25263055-25263077 CAAAATATTAAATATAAAATGGG - Intergenic
1136865846 16:33752468-33752490 CATATTATGAAATATGTATTTGG - Intergenic
1140299722 16:73745251-73745273 CATATTATGAAACAACTACTAGG - Intergenic
1141707454 16:85675048-85675070 CAAAGTATGAAACTAATAGTTGG - Exonic
1203106307 16_KI270728v1_random:1363635-1363657 CATATTATGAAATATATATTTGG + Intergenic
1203127207 16_KI270728v1_random:1598733-1598755 CATATTATGAAATATATATTTGG - Intergenic
1143752595 17:9040214-9040236 CAAATTGTAAAACTTAAAATTGG - Intronic
1144246599 17:13372273-13372295 CAAATTATAAAAAGTATAACAGG + Intergenic
1145829536 17:27904446-27904468 ATACTTATGACACATATAATTGG + Intergenic
1146742168 17:35296260-35296282 CAAATTATACAGCATAAAATGGG + Intergenic
1146814005 17:35927844-35927866 AAGATTATGAAACATTTACTTGG - Intronic
1147276879 17:39325361-39325383 TAAATAATCAAACATAAAATTGG + Intronic
1147476451 17:40716053-40716075 AAAATTATGAAATATCTGATAGG - Intergenic
1149185607 17:53993405-53993427 AAAAATAAGAAACATATATTGGG - Intergenic
1149515912 17:57280787-57280809 CAAATCATTAAAAATAAAATAGG + Intronic
1150093745 17:62353822-62353844 CAAATTATGAAAAAAATTACCGG - Intergenic
1150854284 17:68735613-68735635 AAAAATATGAAACATAGAAGAGG + Intergenic
1151256314 17:72879454-72879476 GATATTGTGAAATATATAATTGG - Intronic
1153373384 18:4346556-4346578 CAAATTAGGAAACTGATAATCGG + Intronic
1153883710 18:9443821-9443843 AAAATCATGAAATATTTAATAGG - Intergenic
1154525367 18:15283791-15283813 CAAATTATAAATAAAATAATAGG + Intergenic
1155048385 18:22124740-22124762 CTAATTTTGAAGCATATAAATGG - Intergenic
1155278461 18:24213259-24213281 CAAATTATTAAACTTAAAATAGG - Intronic
1155560404 18:27070343-27070365 CAAATTATACATAATATAATTGG + Intronic
1155752023 18:29436754-29436776 TAAATTATTAAATATATAAGAGG + Intergenic
1155841153 18:30644022-30644044 GATATTATGAAAAATATATTTGG - Intergenic
1156012935 18:32514955-32514977 CAGATTTTGAAAGATTTAATAGG + Intergenic
1156070032 18:33196055-33196077 CAAATAATGGAACTTATAATGGG + Intronic
1156870865 18:41943514-41943536 TCATTTATGAAACAAATAATGGG + Intergenic
1157170153 18:45396544-45396566 CAAATAAAGAAACAAATAAATGG - Intronic
1157639543 18:49199494-49199516 CACATTATGGAAAATAGAATAGG + Intronic
1157892996 18:51436759-51436781 CAAAATATTCAACATATACTTGG - Intergenic
1158319776 18:56249933-56249955 CAAATGTAGAAACAAATAATAGG + Intergenic
1159191356 18:65047378-65047400 CATATGATGAAAGAGATAATTGG - Intergenic
1159253637 18:65915961-65915983 ATAATTAGGAAACATTTAATAGG - Intergenic
1159444957 18:68531089-68531111 CATACTATGAAATATATAAAGGG + Intergenic
1159488243 18:69094450-69094472 CCAAGTATGAATCATATATTTGG + Intergenic
1162222610 19:9190885-9190907 GATATTATGAATCATATAACAGG + Intergenic
1164003293 19:21126534-21126556 CAAATTAAGTAACACATAAATGG - Intergenic
1164023012 19:21325607-21325629 AAAATTATAAAACATAACATTGG + Intronic
1164279589 19:23758138-23758160 TAAATTAAGCATCATATAATTGG - Intronic
1164704683 19:30311571-30311593 GAAAATATTAAACAAATAATAGG - Intronic
1166238388 19:41473051-41473073 CATATTATGAACCATATCACAGG + Intergenic
1166675273 19:44737188-44737210 AAAATTATGAAATATAACATGGG - Intergenic
1167297417 19:48659787-48659809 CAGATTATGTAACATTTTATTGG + Intergenic
1168206594 19:54854621-54854643 CAAATAATCCTACATATAATAGG + Intronic
1202645422 1_KI270706v1_random:135235-135257 TACATTAGGAAAAATATAATTGG - Intergenic
925675141 2:6354464-6354486 CACAGTATTAAACATATAGTTGG - Intergenic
926524098 2:13954775-13954797 CAAATAATGAAAAATATCTTGGG - Intergenic
927027108 2:19079692-19079714 AATATTATTAAACATTTAATTGG - Intergenic
927338321 2:21951289-21951311 GACATTAGGAAATATATAATAGG + Intergenic
927377942 2:22440421-22440443 CAAATTATGAAACATAGTATGGG - Intergenic
927755180 2:25702519-25702541 CAAATGATGAAACTTCTACTGGG - Intergenic
927905891 2:26856171-26856193 CAAATTAAGAAACAGAAAATTGG + Intronic
929078817 2:38101578-38101600 TAAATTCTGAAACATACAATGGG + Intronic
929744850 2:44646021-44646043 GAAATTATTAAACATGCAATGGG - Intronic
932612747 2:73211900-73211922 GATATTATGAAATATATATTTGG - Exonic
932724268 2:74164607-74164629 CAAGTCATAAAAGATATAATAGG + Intronic
932920510 2:75909055-75909077 AAAAATTTGAAACATACAATTGG + Intergenic
933124013 2:78580828-78580850 TGAATTATCAAACATAAAATTGG - Intergenic
933165670 2:79072180-79072202 CAAATTAAAAAGCAAATAATGGG - Intergenic
933532177 2:83524471-83524493 CAAATTAGGAAAGATATAACTGG + Intergenic
934479988 2:94628650-94628672 CACATTCTCAAACATCTAATAGG - Intergenic
934507827 2:94908815-94908837 TACATTAGGAAAAATATAATTGG - Intergenic
934634366 2:95969335-95969357 CATATTATGAAATATATATTTGG - Intronic
934799266 2:97135904-97135926 CATATTATGAAATATATATTTGG + Intronic
934834174 2:97567565-97567587 CATATTATGAAATATATATTTGG - Intronic
934908171 2:98224158-98224180 GAAATTATAAAAGAAATAATTGG + Intronic
934908173 2:98224234-98224256 GAAATTATAAAAGAAATAATTGG + Intronic
937599767 2:123717137-123717159 CAAAATATGTTACATACAATGGG - Intergenic
938177664 2:129150747-129150769 CAAATTGAAAAACATACAATGGG - Intergenic
938524550 2:132115920-132115942 CAAATTATAAATAAAATAATAGG + Intergenic
939390254 2:141559506-141559528 AAAATAATGATACATCTAATTGG - Intronic
939503288 2:143012554-143012576 AAAAATATGAAAAATATTATGGG - Intronic
940104815 2:150087005-150087027 CTAATTATTAGACATATTATAGG + Intergenic
940137142 2:150450503-150450525 AAAATTATGAAACAGAAAACTGG - Intergenic
940697483 2:156997659-156997681 CAAATCATTAAACACATCATAGG - Intergenic
941339916 2:164294259-164294281 GAAATTATGAAACACATAAATGG + Intergenic
941579990 2:167284122-167284144 CAACTTATCAAAAATGTAATAGG - Intergenic
941678823 2:168373464-168373486 CAAATCAAAAAACATAAAATGGG + Intergenic
941731878 2:168926907-168926929 AAAATTATTAAAAATATTATAGG - Intronic
941791360 2:169555716-169555738 AAAATAAAGGAACATATAATAGG + Intronic
942184361 2:173410534-173410556 CAAAACATGAAAGATATAAAGGG + Intergenic
942422108 2:175818967-175818989 AAAATTATGAAACACATAAGAGG - Intergenic
943054337 2:182957187-182957209 AAATTTTTTAAACATATAATTGG + Intronic
943214144 2:185008943-185008965 GAAATTATGAAAATTCTAATGGG + Intergenic
943230463 2:185244242-185244264 GAAATTATGAACCAAATAGTAGG - Intergenic
943423055 2:187694013-187694035 CAAATTATCACAGATACAATGGG - Intergenic
943518509 2:188917425-188917447 CTAATTATGAAGCTTGTAATAGG + Intergenic
943709156 2:191070947-191070969 CTACTTATGAAGCATATATTTGG - Intronic
943968430 2:194369428-194369450 AAAATTATGTAAAATATAAATGG - Intergenic
944778086 2:202989499-202989521 CAAATTATCAAACCTAAAAGGGG - Intronic
945363843 2:208926959-208926981 ACAATTATGAAAGATAAAATCGG - Intergenic
945951303 2:216041517-216041539 GATATTGTGAAACATATATTTGG + Intronic
946082110 2:217130058-217130080 CAAATTATGAAACTAAGAAGAGG - Intergenic
1168993933 20:2118217-2118239 TAAATTATGGTACATATAATGGG - Intronic
1169031731 20:2414849-2414871 CAAATTATGAATTATATTAGTGG + Intronic
1169364998 20:4984836-4984858 CAAAATGTTAAACATAGAATCGG + Intronic
1170121482 20:12917245-12917267 CAAATTCTGTATCCTATAATTGG - Intergenic
1170225392 20:13986476-13986498 TAAAATAAGAACCATATAATAGG + Intronic
1170823168 20:19771374-19771396 TATATTATGAAACATATACCTGG - Intergenic
1170959319 20:21010948-21010970 CATAATAAGAAACATATATTAGG - Intergenic
1171891062 20:30716029-30716051 CAAATTATGACAAATAAAAGTGG + Intergenic
1171895383 20:30754157-30754179 TACATTAGGAAAAATATAATTGG - Intergenic
1172219006 20:33259398-33259420 TAAATTCTGAAAAATATAAAAGG + Intergenic
1172933995 20:38606376-38606398 AAAATTCTGAAACATATTCTGGG + Intronic
1174806885 20:53611933-53611955 AAAATTAGAATACATATAATAGG - Intergenic
1175471845 20:59235724-59235746 CAAATAATAAAATATAAAATAGG - Intronic
1176606464 21:8837507-8837529 TACATTAGGAAAAATATAATTGG + Intergenic
1176772059 21:13084701-13084723 CAAATTATAAATAAAATAATAGG - Intergenic
1176907349 21:14518274-14518296 CAAATGAACAAACATATTATCGG - Intronic
1177006156 21:15674127-15674149 CAAATTATAAATGAAATAATAGG + Intergenic
1177264972 21:18770790-18770812 TAAAATATGAAGTATATAATTGG + Intergenic
1177670993 21:24227111-24227133 TATATTATAAACCATATAATAGG - Intergenic
1178233763 21:30818470-30818492 CAAAATATACAACATAAAATGGG + Intergenic
1178682881 21:34688149-34688171 CAAACTATGACACAAATAGTAGG - Intronic
1178880658 21:36447526-36447548 CAATTTTTAAAACATGTAATAGG - Intergenic
1179314268 21:40227523-40227545 CAAATTCTGAGAAATATCATGGG - Intronic
1179555215 21:42170439-42170461 CAAATTATCTCACATATAAACGG - Intergenic
1180356539 22:11847207-11847229 TACATTAGGAAAAATATAATTGG + Intergenic
1180381724 22:12145124-12145146 TACATTAGGAAAAATATAATTGG - Intergenic
1180519097 22:16178361-16178383 CAAATTATAAATAAAATAATAGG - Intergenic
1182822626 22:33231406-33231428 AAAATTATGACACATTTCATAGG + Intronic
1182858182 22:33536361-33536383 CAAATCATGAAACATACAGAAGG - Intronic
1183005871 22:34901539-34901561 CAAACTATAAAACATAGCATGGG + Intergenic
1183527416 22:38331754-38331776 CACATTATAAAACATACATTAGG - Intronic
1184907032 22:47495195-47495217 CAAAAAATGGAACATAGAATGGG - Intergenic
949487372 3:4552914-4552936 CACATTGTGAAATATATATTTGG - Intronic
950949685 3:16985385-16985407 CAAAATAGAAAACATAAAATAGG + Intronic
951390249 3:22094176-22094198 CAAAAGATGAATAATATAATTGG - Intronic
951402737 3:22254050-22254072 CAAATTATAAAGCACACAATGGG + Intronic
951784985 3:26407860-26407882 TATATTTTAAAACATATAATTGG + Intergenic
952052051 3:29395853-29395875 TAAATAATGAAACATATAATAGG + Intronic
952612195 3:35225498-35225520 CAACTTTTAAAACATATATTTGG - Intergenic
952825766 3:37523504-37523526 CAGTTTCTGAAACAGATAATAGG - Exonic
953541510 3:43822740-43822762 CAAATGTTGAAACATTTCATTGG - Intergenic
953779870 3:45858508-45858530 CAAATGATAAAAAATATATTAGG - Intronic
954052985 3:47997135-47997157 CAATTTAACAAAAATATAATTGG + Intronic
955787488 3:62555712-62555734 TAAATTTTTAAACATAAAATGGG - Intronic
956358468 3:68419537-68419559 TAAATTATGAAACATAAAGATGG - Intronic
956459917 3:69461681-69461703 GAAATTATGAAACAGTTAAGGGG + Intronic
956954938 3:74326792-74326814 TAAAGTATGAAACAAATAAAAGG - Intronic
957303777 3:78429463-78429485 AAAATTATGAATCATATAAATGG + Intergenic
957375571 3:79353242-79353264 CAAATTATTAAGAATTTAATTGG + Intronic
957586324 3:82137124-82137146 CCTATTATTAAACAAATAATAGG + Intergenic
957677503 3:83388379-83388401 CTAATTATTAAAAATATAACAGG - Intergenic
957717933 3:83955884-83955906 CACATTATGAAATATAAAATTGG + Intergenic
958162156 3:89831568-89831590 CAAAATGTCTAACATATAATAGG + Intergenic
958753913 3:98227508-98227530 CAAAATATCTAACATAAAATAGG + Intergenic
958961694 3:100516790-100516812 CACATTATGAAAAAAAAAATGGG - Intronic
960228005 3:115189719-115189741 CCGATTTTGAAACATAAAATAGG + Intergenic
960325705 3:116293063-116293085 AAAATTATGGTACATATGATAGG - Intronic
960800366 3:121532896-121532918 CAAATTCTGAATGATGTAATTGG - Intronic
962680669 3:137796382-137796404 CTAATAATGAAACATATCTTTGG + Intergenic
963539320 3:146565900-146565922 TATATTATAAAACATAAAATGGG - Intergenic
963555649 3:146784015-146784037 TAAATTTTGCAACATTTAATGGG - Intergenic
964215882 3:154281659-154281681 GAGATTATGAAACATAAAGTTGG + Intronic
964219377 3:154326404-154326426 GAACTTATGAAACATACAAATGG + Intergenic
964256324 3:154778479-154778501 AAAATGAGGAAACATTTAATTGG + Intergenic
964919635 3:161880793-161880815 CAAATTATCAAACCTAAAAATGG + Intergenic
965594434 3:170396484-170396506 CAACTGTTGAAACAAATAATTGG + Exonic
965649164 3:170915678-170915700 CAAATTTTAAAATGTATAATTGG + Intergenic
965735394 3:171814276-171814298 AAAATGATGAAACATACAAATGG - Intergenic
966106930 3:176347182-176347204 AAAAATATGAAAAAAATAATAGG + Intergenic
966702460 3:182870420-182870442 ACAATTAGGAAACAAATAATGGG - Intronic
967594556 3:191314496-191314518 GATATTGTGAAACATATATTTGG + Intronic
968058617 3:195711860-195711882 CAAATTGTGAAACATACATTTGG + Intergenic
969863735 4:10058333-10058355 TAAATTGTGAAACCTATCATAGG + Intergenic
970620955 4:17817741-17817763 CAAATAAGCAAACATATACTAGG - Intronic
970701638 4:18747973-18747995 CAAATTTTAAAAAATATAAGAGG + Intergenic
970776564 4:19681469-19681491 CAATTAAAGAAACCTATAATTGG + Intergenic
971909363 4:32775605-32775627 CAAATAATTTAATATATAATAGG + Intergenic
972932720 4:44093189-44093211 CAAATAATAAATAATATAATTGG + Intergenic
973371646 4:49253652-49253674 TACATTAGGAAAAATATAATTGG - Intergenic
973389360 4:49541660-49541682 TACATTAGGAAAAATATAATTGG + Intergenic
973763539 4:54142720-54142742 CAAATTGAAAAACATACAATGGG + Intronic
974220669 4:58966521-58966543 AAAATTATGAAGCATAAAAGAGG - Intergenic
974380921 4:61138723-61138745 CAATGTATGATTCATATAATTGG + Intergenic
974396979 4:61350022-61350044 CAAATAATGAAATATATCACTGG - Intronic
974463632 4:62224310-62224332 AAAATTAATAAACATATAATAGG + Intergenic
975333720 4:73150904-73150926 GAAATTATGTAACATAAATTAGG + Intronic
975630672 4:76399130-76399152 CAAAATAAGATACATATTATAGG + Intronic
976397322 4:84570196-84570218 AAAAATATGAAATATATAAAAGG + Intergenic
976531989 4:86165934-86165956 CAAATTATCAAACATAATTTAGG - Intronic
977071811 4:92399589-92399611 TAAATTGTGAAATATGTAATTGG - Intronic
977075899 4:92448748-92448770 AAAATTATGTAAGATATATTTGG + Intronic
977450684 4:97192662-97192684 TAAACAATGAAACATATAAATGG - Intronic
977528464 4:98172569-98172591 CACATTGTTGAACATATAATAGG - Intergenic
978009785 4:103666172-103666194 GTAATTATGAAGCATAAAATAGG + Intronic
978475284 4:109121267-109121289 CAAACTATGAAAAATATAACTGG + Intronic
979733987 4:124059233-124059255 CAAATTATTTAAGATATCATAGG - Intergenic
979872347 4:125839995-125840017 GAAATTATGAAAACTGTAATAGG - Intergenic
980451343 4:132976642-132976664 CAAATAATAAAACTTATAATTGG + Intergenic
980517681 4:133885927-133885949 CAAGTTATATAAAATATAATGGG + Intergenic
981329434 4:143490704-143490726 CAAACTAGAAAACATACAATGGG + Intergenic
981467652 4:145092520-145092542 CAAATTATTAAAGTTATACTTGG - Intronic
982452707 4:155571912-155571934 CAAGTTATAGAACATATAAGAGG - Intergenic
982853216 4:160345192-160345214 CAGAATATGAAACATAAAGTTGG + Intergenic
982912943 4:161167878-161167900 CAATTTTTGGAACAGATAATGGG + Intergenic
983003382 4:162449064-162449086 CAAATTATGTATCATTTAATAGG + Intergenic
983317151 4:166146988-166147010 CAAATGATGACAAATATAATAGG - Intergenic
983333602 4:166362898-166362920 CAAAATATCAACCTTATAATCGG - Intergenic
983397313 4:167216121-167216143 CAAATATTGTAACATATACTTGG - Intronic
984209490 4:176828324-176828346 CAAATCATGCATCTTATAATGGG + Intergenic
985878085 5:2615860-2615882 CAAATTATTACACAGTTAATAGG + Intergenic
986397024 5:7341287-7341309 CAAAACATGAAATTTATAATAGG - Intergenic
986487567 5:8254201-8254223 CAAATTATGAAACATCAATCTGG + Intergenic
987308141 5:16657771-16657793 TAAATTATGCCACATAGAATGGG + Intergenic
987632169 5:20488157-20488179 CATGTTATAAAATATATAATTGG + Intronic
987991833 5:25222624-25222646 CAAATTCTGGAACACAGAATAGG + Intergenic
988145754 5:27304751-27304773 GAAACAATGAAACATACAATAGG - Intergenic
988213916 5:28246797-28246819 CCAATTAAAAAACAAATAATTGG + Intergenic
988411375 5:30889969-30889991 CAAATTAGGATACTTATAATGGG - Intergenic
988417563 5:30964952-30964974 GAGATTATGAAACAACTAATGGG - Intergenic
988905828 5:35787658-35787680 CATTTTCTGAACCATATAATAGG + Intronic
989485742 5:41989835-41989857 ATAATTATGAAGCATATTATTGG + Intergenic
989813610 5:45708637-45708659 AAATTTATTAAACATATATTGGG - Intergenic
990225978 5:53654279-53654301 CCAATTATAAAACATATAATTGG - Intronic
990507640 5:56460316-56460338 CAAAATATCAAATATATAGTTGG - Intronic
991244690 5:64497862-64497884 CCAATTAGGAAACATAGAACAGG - Intergenic
991378004 5:65986559-65986581 GAAATTCTGAAACACATAAATGG + Intronic
992012301 5:72541135-72541157 AAAATTTTGAAAAATAAAATGGG + Intergenic
992476403 5:77106184-77106206 CAAACTATTAAAAACATAATTGG - Intergenic
992939028 5:81743635-81743657 CAAATTATGCTAGATATAATGGG - Intronic
993182493 5:84572527-84572549 GATATTATGAAATATATATTTGG + Intergenic
993262611 5:85679234-85679256 GAAATTAAGAAACATACCATTGG + Intergenic
993461370 5:88186934-88186956 CAAAGTATTAACCATAAAATTGG - Intergenic
993505616 5:88705363-88705385 CAAATTATGATAGAAATTATTGG + Intergenic
993615075 5:90101279-90101301 CAAATTATAAAGCATATATAGGG - Intergenic
993756621 5:91738572-91738594 CAAATTATGAAATATTTATGTGG + Intergenic
993763395 5:91824910-91824932 TAAATTATGAAAAATATCTTGGG + Intergenic
993765227 5:91848124-91848146 CAAATTATTAAAAACATCATTGG - Intergenic
994364590 5:98898663-98898685 CAAATAGTGGAACGTATAATTGG - Exonic
994391297 5:99196141-99196163 GATATTATGAAACATATTACAGG + Intergenic
994414609 5:99453674-99453696 TAAATTTTTAAACATATTATGGG + Intergenic
994565232 5:101437247-101437269 TAAAATAGGAAACATATATTTGG + Intergenic
994814083 5:104561639-104561661 CAAATTAAGAATAATTTAATGGG - Intergenic
995127999 5:108599184-108599206 CAAATTAAGACAAATATAAATGG - Intergenic
995301281 5:110586286-110586308 CAAATTGTAAAAGATATGATTGG - Intronic
995877304 5:116803699-116803721 TAAATTATGAACCATATGTTGGG + Intergenic
996227023 5:121012158-121012180 CCCATAATGAAAAATATAATAGG + Intergenic
996799234 5:127384569-127384591 CAAATTATGAACCAGAAAAAGGG - Intronic
996931926 5:128899676-128899698 AATATTATTACACATATAATTGG - Intronic
997154802 5:131543510-131543532 CAAATTCTGAAACATGTGAAAGG + Intronic
997682577 5:135766542-135766564 AATATTATGAACCATATAACAGG - Intergenic
997683470 5:135772381-135772403 GAAATTATGAAGAATATCATAGG - Intergenic
997687023 5:135795867-135795889 GATATTATGAACCATATCATCGG - Intergenic
998726591 5:145024271-145024293 CAAGTTATTAAAAATAAAATGGG - Intergenic
998962165 5:147500147-147500169 CAATTCATGAAATAAATAATTGG + Intronic
999537956 5:152539110-152539132 CACTTTATGAAACAAATAACTGG - Intergenic
1000069896 5:157730656-157730678 CAAAGTATGACACAAATATTAGG + Intergenic
1000106074 5:158060125-158060147 AAAATTATGAAGTATAAAATGGG + Intergenic
1000200231 5:159002247-159002269 CAAATTATGGAAAAAGTAATAGG - Intronic
1001152667 5:169245792-169245814 GAGGTTATGAAACATCTAATGGG - Intronic
1001319198 5:170666464-170666486 CCCATTATGAAAATTATAATAGG - Intronic
1004733489 6:18382172-18382194 CATAATATATAACATATAATAGG - Intergenic
1005020200 6:21410837-21410859 CAAAATATGAAATAAATATTGGG - Intergenic
1005595361 6:27374189-27374211 AAAATTATCATACATAAAATTGG - Intergenic
1006213000 6:32413407-32413429 TAAATTATGCTACATATTATGGG + Intergenic
1006369855 6:33637293-33637315 CAAATTATTAAACATAAAGAGGG - Intronic
1006974355 6:38084218-38084240 GAAAAAATGAAACATATATTTGG + Intronic
1008327220 6:50197308-50197330 TAAATTATGAAGCATAAAACTGG - Intergenic
1008458014 6:51734467-51734489 CAATTTATGGAACATAATATAGG - Intronic
1008531992 6:52470551-52470573 TAAGTTTTGAAACATAAAATGGG - Intronic
1009046723 6:58243495-58243517 GGTATTAGGAAACATATAATTGG - Intergenic
1009047607 6:58248833-58248855 CATATTATGAACCATATCACAGG - Intergenic
1009196417 6:60691820-60691842 CAAATTATTAGAGATACAATAGG - Intergenic
1009223409 6:61003129-61003151 CATATTATGAACCATATCACAGG - Intergenic
1009365752 6:62856562-62856584 GAAATTAGGAAAAATATCATGGG - Intergenic
1009644850 6:66386948-66386970 GAAATCATGATACATATAAATGG - Intergenic
1009655532 6:66540414-66540436 TAATTTATGAAACAAATTATCGG - Intergenic
1009725415 6:67531229-67531251 CAAATTATGAAGGATTTTATTGG - Intergenic
1010343440 6:74783879-74783901 CAAATTAAAAAACATGTAACTGG + Intergenic
1011205252 6:84887129-84887151 CAAATTAAAAAATATATAAAAGG + Intergenic
1011285019 6:85714111-85714133 CAAAGTGTTAAAAATATAATGGG + Intergenic
1011847560 6:91585453-91585475 TATATTATGACAGATATAATTGG + Intergenic
1011872922 6:91919846-91919868 AAAATTCTAAAAAATATAATTGG + Intergenic
1011905295 6:92358639-92358661 CAAACTATCAATCATATATTAGG + Intergenic
1012039607 6:94186861-94186883 CAAATTGTGTCACATATACTGGG + Intergenic
1012413805 6:98990475-98990497 CAGATTATGACATATATTATTGG + Intergenic
1012818552 6:104055612-104055634 CAAATTGTGAAAAATCTTATTGG + Intergenic
1012976991 6:105791542-105791564 CAATTTATGAAAAAGAAAATTGG - Intergenic
1013019575 6:106199483-106199505 CAATTTATGTGAAATATAATAGG + Intronic
1013798907 6:113917803-113917825 TAAAGTATGTAGCATATAATAGG + Intergenic
1013941058 6:115663076-115663098 CCAATTATGAAACAAATTAATGG - Intergenic
1014006678 6:116427460-116427482 CAGAATATTAAATATATAATTGG + Intronic
1014077689 6:117255410-117255432 CAAATTATGAAATATTATATAGG - Intergenic
1015505977 6:133988901-133988923 CAAAAAAAGAAACATAGAATAGG + Exonic
1016316536 6:142794974-142794996 CAAATTAGATCACATATAATTGG - Intronic
1018044706 6:159955483-159955505 CAAGTTATGAAATATAATATTGG + Intergenic
1018717884 6:166548174-166548196 AAAATTACGGAACATATTATTGG + Intronic
1018814286 6:167319173-167319195 CAATTTATGAAACTCTTAATAGG + Intergenic
1018938716 6:168293452-168293474 AAAATTATGAAATATAGAAGGGG + Intronic
1019837872 7:3408201-3408223 AAAATTATGAAAAAAAAAATTGG - Intronic
1020398849 7:7751212-7751234 AAAATCATGATACATATAATTGG - Intronic
1020713810 7:11643521-11643543 CAAATTATAGAACAATTAATTGG - Intronic
1020798991 7:12710693-12710715 TATATTATAAAATATATAATTGG - Intergenic
1021541244 7:21760991-21761013 TAAATTATGGGAAATATAATGGG + Intronic
1021829320 7:24587838-24587860 AATATTATGAAACATTTAGTAGG + Intronic
1022841278 7:34166236-34166258 CAAATTATGCACCATATTAAAGG - Intergenic
1023485347 7:40680677-40680699 GAAATTATGAAATTTATAACTGG + Intronic
1024846335 7:53647572-53647594 ACAATTTTGAAACATAAAATTGG - Intergenic
1025913201 7:65844349-65844371 CAAAATATCTAGCATATAATAGG + Intergenic
1026434584 7:70384417-70384439 ATATTTTTGAAACATATAATTGG + Intronic
1026961992 7:74414773-74414795 CACATTATATAAAATATAATTGG + Intergenic
1027508340 7:79046905-79046927 CATTTCATGAAACACATAATTGG - Intronic
1027650299 7:80858578-80858600 GAAATTATTAAATAAATAATAGG + Intronic
1027737688 7:81954997-81955019 CAATTTATAAAGCATATTATTGG - Intronic
1027787766 7:82601944-82601966 AAAATTATAAAACATATGAAAGG - Intergenic
1027815425 7:82963418-82963440 CCAATTATGAAAAAAAGAATTGG - Intronic
1027956340 7:84883395-84883417 AAAATTATGAAAAATATAAAAGG - Intergenic
1027982027 7:85236728-85236750 GAAATAATGAAACAAATATTTGG + Intergenic
1028365458 7:90024402-90024424 CAAATCAAAAAACATAAAATAGG + Intergenic
1029155128 7:98511835-98511857 CAAATTATCAAACATAAAGGTGG + Intergenic
1029343043 7:99959928-99959950 CATATTAGGAACAATATAATAGG - Intergenic
1030914025 7:115290065-115290087 CAAATTATCAATCATATATGAGG - Intergenic
1030932246 7:115538827-115538849 CAAAGTTTGCAACATATGATTGG - Intergenic
1031032917 7:116754204-116754226 CATAATATGAAACATATAGATGG - Intronic
1031192125 7:118566241-118566263 CAAATTATGCATCTTATAAGGGG + Intergenic
1031319349 7:120303317-120303339 CATATTATGAAACAACAAATTGG + Intronic
1031557326 7:123193810-123193832 CAAGGTATAAAACATATTATGGG + Intronic
1031757520 7:125663927-125663949 CATCTTATGAAAGAAATAATAGG - Intergenic
1032278314 7:130479774-130479796 CATATTATGAACCATAAAATAGG - Intergenic
1032281570 7:130507156-130507178 CAAATTGTTACTCATATAATGGG + Intronic
1032714529 7:134494711-134494733 TAAATTATGACAAATAAAATGGG + Intergenic
1033112647 7:138595545-138595567 CAAATAATGATACATATAAATGG - Intronic
1034056295 7:148038648-148038670 CAATTAAAGAAACATTTAATGGG - Intronic
1034731852 7:153393900-153393922 CAGTTTATGAAGCATTTAATAGG - Intergenic
1034918037 7:155057010-155057032 CAAATTATGAGACAGAACATTGG - Intergenic
1035343556 7:158181865-158181887 CAAAAGATGAAACAAAAAATTGG - Intronic
1035621492 8:1038585-1038607 CAAATTATCTAACGCATAATGGG - Intergenic
1036001571 8:4610747-4610769 TAGATTAAGTAACATATAATTGG - Intronic
1036058680 8:5290139-5290161 AAAATTAAAAAATATATAATGGG - Intergenic
1036448829 8:8847106-8847128 CCAATTACGAAAAATATCATTGG - Intronic
1036548740 8:9798497-9798519 GATATTATGAATAATATAATAGG - Intergenic
1038081434 8:24141209-24141231 AAAATAATCAAACATATAATGGG + Intergenic
1038348651 8:26756183-26756205 CTAATTATCTAACATCTAATAGG + Intronic
1038900088 8:31832418-31832440 CAAATTATGAAAAATTTACTGGG - Intronic
1038939491 8:32287799-32287821 CAAATTAAGCAACACATAAAAGG - Intronic
1039806503 8:41004527-41004549 CAAAGTATGAAGCATAAATTGGG - Intergenic
1040042777 8:42933154-42933176 AAAATTATGAAACATGTTGTAGG + Intronic
1040495813 8:47964786-47964808 GAAATTATGAAAGAAGTAATTGG + Intronic
1040652723 8:49466899-49466921 CCAATATTGAAACATCTAATAGG + Intergenic
1041944921 8:63430157-63430179 CAAAAAATAAAAAATATAATTGG + Intergenic
1042616102 8:70651256-70651278 CAATATATGAAATATATACTTGG - Intronic
1042937716 8:74076980-74077002 CAAATTATCAAACTCATCATGGG - Intergenic
1043771780 8:84211502-84211524 CAAATGATAAAAAATATTATGGG - Intronic
1044160482 8:88908235-88908257 CAAATCATGCATCATATAAAAGG + Intergenic
1044279925 8:90342557-90342579 TAAATTATGTAACATATATTAGG - Intergenic
1044974053 8:97645766-97645788 AAAACTATGAAAGATATAATGGG - Intronic
1045259281 8:100558109-100558131 CAAATTCTTAAATCTATAATAGG + Intronic
1045715625 8:105040656-105040678 CAATTGATGCAACATATATTTGG + Intronic
1045729764 8:105223815-105223837 CAAATTAAGAAACAAAGAACTGG + Intronic
1045806741 8:106171147-106171169 CAAATTAAGAAACAGGCAATGGG - Intergenic
1046088300 8:109466520-109466542 CACATTAAGAAACATAAAAAAGG - Intronic
1046242748 8:111518586-111518608 AGAAATATGAAAAATATAATTGG - Intergenic
1046301109 8:112291708-112291730 CAAATTTTGAAACATATGTTTGG + Intronic
1046745071 8:117867825-117867847 CATATGATGAAACACATAAATGG - Intronic
1046965512 8:120161014-120161036 CACATTGTGAAAGATATATTAGG + Intronic
1047058086 8:121190567-121190589 CAATTAATGAAACAGATAATTGG + Intergenic
1047088757 8:121549829-121549851 TAAATTATAAAACATAAATTAGG - Intergenic
1048422348 8:134289556-134289578 CAAATTATTAGACAATTAATGGG + Intergenic
1048565120 8:135588194-135588216 CAAATTATCAAACATAAGAAAGG - Intronic
1049057727 8:140251985-140252007 CAAATTATGAAGCATTCATTTGG - Intronic
1050181851 9:2931751-2931773 TAAATTTTGTAACACATAATTGG + Intergenic
1050264305 9:3873975-3873997 GATATTATGAAATATATATTTGG + Intronic
1050379415 9:5011203-5011225 CAAAGTCTGATACATATAAGTGG - Intronic
1050813772 9:9782544-9782566 TAAATTAAGAAACATAAAACTGG + Intronic
1050955155 9:11647701-11647723 CAATTTATGGAACATTTAGTAGG + Intergenic
1051901536 9:22048123-22048145 CAAAATATGACATAAATAATTGG + Intergenic
1052030549 9:23623147-23623169 CAATTTTTAAAACATCTAATGGG - Intergenic
1052676309 9:31629655-31629677 AAAATTAGGAAACAGGTAATTGG + Intergenic
1053044276 9:34901357-34901379 CAAATTCAGCAACATATAATTGG + Intergenic
1053551800 9:39088202-39088224 AAAATTATCAAACATGTAATGGG + Intronic
1053573894 9:39338376-39338398 TAAATTATGTAACAGAGAATTGG + Intergenic
1053625075 9:39861451-39861473 TAAATTATGAAACAGGGAATTGG + Intergenic
1053677853 9:40455151-40455173 CACATTCTCAAACATCTAATAGG + Intergenic
1053703305 9:40723533-40723555 CAAATTATAAATAAAATAATAGG + Intergenic
1053815931 9:41908337-41908359 TAAATTATCAAACATGTAATGGG + Intronic
1053838515 9:42166932-42166954 TAAATTATGTAACAGAGAATTGG + Intergenic
1053879795 9:42581777-42581799 TAAATTATGAAACAGGGAATTGG - Intergenic
1053892869 9:42712543-42712565 TAAATTATGAAACAGGGAATTGG + Intergenic
1053927768 9:43082983-43083005 CACATTCTCAAACATCTAATAGG + Intergenic
1054095460 9:60897064-60897086 TAAATTATGTAACAGAGAATTGG + Intergenic
1054116921 9:61172984-61173006 TAAATTATGTAACAGAGAATTGG + Intergenic
1054218822 9:62389247-62389269 TAAATTATGAAACAGGGAATTGG - Intergenic
1054231896 9:62519922-62519944 TAAATTATGAAACAGGGAATTGG + Intergenic
1054285875 9:63169804-63169826 CACATTCTCAAACATCTAATAGG - Intergenic
1054353268 9:64038614-64038636 TACATTAGGAAAAATATAATTGG + Intergenic
1054388948 9:64595224-64595246 CACATTCTCAAACATCTAATAGG + Intergenic
1054413362 9:64846998-64847020 CAAATTATAAATAAAATAATAGG + Intergenic
1054506770 9:65921147-65921169 CACATTCTCAAACATCTAATAGG - Intergenic
1054590830 9:67009579-67009601 TAAATTATGTAACAGAGAATTGG - Intergenic
1054614666 9:67279104-67279126 TAAATTATCAAACATGTAATGGG - Intergenic
1055008861 9:71540868-71540890 GAAATTATGAAATATATATTTGG - Intergenic
1055527553 9:77150440-77150462 CAAATAATGAAATATATATGGGG - Intergenic
1055869190 9:80853876-80853898 TACATTAGGAAAAATATAATTGG + Intergenic
1056373275 9:85980506-85980528 GACATTATGAAATATATATTTGG - Intronic
1056743226 9:89277980-89278002 AAAATTAAGAAACAAATATTGGG - Intergenic
1057511351 9:95681946-95681968 CAAGTTTTGAAAAATATGATAGG - Intergenic
1057526594 9:95808440-95808462 AAAAGTATGAAATATATAAGTGG + Intergenic
1057535772 9:95904186-95904208 AAAATTACGGAACATAAAATTGG - Intronic
1057766135 9:97921046-97921068 CAAAATATGAGACCTGTAATCGG + Intronic
1057880166 9:98787163-98787185 CAGATTATGAAATAAATAATAGG - Intronic
1058992523 9:110268401-110268423 AAAATTAGGAAATATTTAATAGG + Intergenic
1060778729 9:126395934-126395956 CAGATTATGCAACTTAAAATTGG + Intronic
1060877103 9:127091442-127091464 CAAATTAAGAAAAAAAAAATGGG - Intronic
1062356511 9:136166982-136167004 CAAATTCTTAAACATACACTGGG - Intergenic
1203696087 Un_GL000214v1:98716-98738 TACATTAGGAAAAATATAATTGG - Intergenic
1203741601 Un_GL000218v1:7728-7750 TACATTAGGAAAAATATAATTGG + Intergenic
1203701785 Un_KI270742v1:2309-2331 TACATTAGGAAAAATATAATTGG + Intergenic
1203640186 Un_KI270751v1:5347-5369 TACATTAGGAAAAATATAATTGG + Intergenic
1186058114 X:5673075-5673097 CTAAGAATGAAACATTTAATAGG + Intergenic
1186712510 X:12214919-12214941 TAAAATATGAAACATGTAATTGG + Intronic
1186746719 X:12577291-12577313 CAAAATATGATACATGCAATGGG + Intronic
1187499650 X:19829188-19829210 CAAAATATTAAACAAATTATGGG + Intronic
1187789285 X:22931721-22931743 AAAACTATGAAAAATATATTTGG - Intergenic
1188344585 X:29047903-29047925 CAAATTATGTAAGAGATTATAGG - Intronic
1188700719 X:33258913-33258935 CAAATTAGCAAACATATATGAGG + Intronic
1188733201 X:33678004-33678026 CAACATATTAAATATATAATTGG - Intergenic
1189190842 X:39103125-39103147 CAAATCTAGAAACATATAAATGG + Intergenic
1189548362 X:42067507-42067529 AAAACTATAAAACATATATTAGG - Intergenic
1189655893 X:43244775-43244797 CAAATTATCAAATATAAAAGGGG - Intergenic
1189884898 X:45532686-45532708 CAAATGAGGAAACATTTATTCGG + Intergenic
1189893597 X:45630840-45630862 CAAAATAAAAAACATATAATGGG + Intergenic
1190125770 X:47704071-47704093 CAAAATATGAAAAAGATAAATGG - Intergenic
1190361359 X:49652409-49652431 AACATTATAAAACATGTAATAGG + Intergenic
1190449827 X:50567794-50567816 CAAATTAAGTAAAATAAAATAGG - Intergenic
1192067219 X:67898317-67898339 CAAATCAAAAAACATACAATGGG + Intergenic
1192231504 X:69268270-69268292 CAAAATATGTCAAATATAATTGG + Intergenic
1193109493 X:77713292-77713314 GAAAATATAAAACATATTATTGG + Intronic
1193478204 X:81993844-81993866 CAAATTATAAATCAAATAAGTGG + Intergenic
1194535419 X:95100913-95100935 AAAATGATGGAACATATAAAGGG + Intergenic
1195178097 X:102330149-102330171 AAAATTATGAAACAATTTATGGG + Intergenic
1195180767 X:102356944-102356966 AAAATTATGAAACAATTTATGGG - Intergenic
1195382945 X:104288321-104288343 GATATTGTGAAACATATATTTGG + Intergenic
1196334881 X:114520805-114520827 CAAATAATGAAAGATCTAAAGGG + Intergenic
1197302058 X:124793194-124793216 TAAATTATGATCAATATAATAGG + Intronic
1197512806 X:127391882-127391904 AAAATTCTGAAAAATAGAATGGG + Intergenic
1197536620 X:127696634-127696656 CAAATTATGAAGCCTTTAACTGG - Intergenic
1198177161 X:134168029-134168051 TAAAATATGAAACATAGAACTGG + Intergenic
1198501406 X:137252141-137252163 AAAATTATCAAATATGTAATGGG + Intergenic
1199403077 X:147423354-147423376 CCAATTATGCATCAGATAATGGG - Intergenic
1200023797 X:153237263-153237285 CAAAGTGAGAAACATGTAATTGG - Intergenic
1200690260 Y:6301676-6301698 TAAATTATGCAACATTTTATGGG + Intergenic
1200714473 Y:6521419-6521441 TAAATTATGCAACATTTTATGGG - Intergenic
1201019351 Y:9639737-9639759 TAAATTATGCAACATTTTATGGG + Intergenic
1201045013 Y:9873040-9873062 TAAATTATGCAACATTTTATGGG - Intergenic
1201060815 Y:10044899-10044921 TAAATTATGCAACATTTTATGGG + Intergenic
1201155131 Y:11125180-11125202 TACATTAGGAAAAATATAATTGG + Intergenic
1201901794 Y:19051054-19051076 AAAATTTTTAAAAATATAATGGG - Intergenic
1202117474 Y:21483811-21483833 TAAATTATGCAACATTTTATGGG - Intergenic
1202586143 Y:26430109-26430131 CATATTATGAAATATATATTTGG + Intergenic