ID: 1119285711

View in Genome Browser
Species Human (GRCh38)
Location 14:73452565-73452587
Sequence CAGGGTTTTCGTGGGTAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119285703_1119285711 27 Left 1119285703 14:73452515-73452537 CCGTCTCAAAAAAAAGGAACGTA 0: 1
1: 2
2: 79
3: 1753
4: 14842
Right 1119285711 14:73452565-73452587 CAGGGTTTTCGTGGGTAGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119285711 Original CRISPR CAGGGTTTTCGTGGGTAGAG AGG Intronic
900472519 1:2861818-2861840 CAGGCTTTTCGCAGGGAGAGTGG - Intergenic
900622434 1:3593530-3593552 CAGGGTTTACTGGGGGAGAGCGG - Intronic
901895437 1:12307878-12307900 CAGGTATTTGGTGGGGAGAGTGG + Intronic
902749631 1:18498740-18498762 CAGAGTTTTACTGGGTTGAGGGG + Intergenic
904498649 1:30901710-30901732 CAGGGTTTTCTTTTGGAGAGAGG - Intronic
905950937 1:41949961-41949983 CAGGGTTTTCCTGTTGAGAGAGG + Intronic
906935502 1:50210957-50210979 CAGGGTTTTATTGGGTGAAGTGG + Intergenic
911335844 1:96579044-96579066 CTGGGTTATCGTGGATGGAGAGG - Intergenic
918704276 1:187641324-187641346 CAGGGTTTTAGTGGGTGAAGAGG - Intergenic
920437426 1:205956508-205956530 CAGGGCTTTGGTTGGAAGAGGGG + Intergenic
921276496 1:213525832-213525854 AAGGGTTTTCTTCAGTAGAGTGG + Intergenic
922194881 1:223351383-223351405 CAGGGTCTTCCTGGACAGAGTGG - Intronic
923616861 1:235545387-235545409 CAGGGTTTTCAGGGGGAGTGAGG + Intergenic
1064007782 10:11712228-11712250 CAGGAATTTCGTGGTGAGAGAGG - Intergenic
1069625081 10:69862793-69862815 CAGGTTTTTCATCTGTAGAGTGG + Intronic
1071012199 10:80952503-80952525 CAGGGTTTTGTTGGGTGGAAAGG + Intergenic
1071364646 10:84885999-84886021 CAGGATTTTCATGGCTAGAGGGG - Intergenic
1073803016 10:107064439-107064461 CAGTGTTTTCTTGGGAATAGCGG - Intronic
1074549296 10:114427944-114427966 GAGGGTTTTCCTGGGTTGGGAGG - Intergenic
1076085462 10:127626169-127626191 CAGGGGCTTAGTGGGTAGGGGGG - Intergenic
1076207164 10:128612497-128612519 CAGAGTTTGCCTGGGGAGAGAGG - Intergenic
1076223229 10:128751612-128751634 CAGGGTTTTCATGGCTGGAAAGG + Intergenic
1076812293 10:132893543-132893565 CAGGATTTTATTGGGTAGAAAGG - Intronic
1080307659 11:30854100-30854122 CAGAGTTGTGGGGGGTAGAGAGG + Intronic
1082659636 11:55894638-55894660 TAGGGTGTACGTGGGTACAGTGG + Intergenic
1086499111 11:87434130-87434152 CAGGCTTTTTGGGGGAAGAGTGG - Intergenic
1090697791 11:129266473-129266495 CAGGATTGTCAGGGGTAGAGTGG - Intronic
1091389015 12:114168-114190 CTGGATTTTCGAGGGCAGAGAGG + Intronic
1091694699 12:2620344-2620366 TAGGGTTGTCGTGGAAAGAGTGG - Intronic
1091797430 12:3305373-3305395 CAGGGTTTGCTTAGGTGGAGGGG - Intergenic
1101512880 12:105408373-105408395 CAGGGGTGGAGTGGGTAGAGAGG - Intergenic
1104220404 12:126777779-126777801 CAGAGTCTTCGTTGGTAAAGTGG - Intergenic
1105833192 13:24183974-24183996 CAGTTTTCTCCTGGGTAGAGGGG - Intronic
1106229400 13:27810100-27810122 CAGGGCTTTCATGGAAAGAGTGG - Intergenic
1106287515 13:28330240-28330262 CAGGGTTATCTTGGGTTGTGAGG + Intronic
1106367042 13:29091378-29091400 CAGGATTTTTGTGGCTACAGAGG + Intronic
1108406082 13:50103664-50103686 CAGTGGTTTCCTGGGGAGAGAGG - Intronic
1110062285 13:71056877-71056899 CAGGGTTTATGTGAGTAGAAGGG + Intergenic
1113433242 13:110268347-110268369 CAGGGATTTCTTGGGTGGGGAGG + Intronic
1118045307 14:61963732-61963754 TAGGATTTTCATGGCTAGAGAGG + Intergenic
1118313517 14:64709494-64709516 TAGGGTTCTCGTGGGCACAGTGG + Intronic
1119285711 14:73452565-73452587 CAGGGTTTTCGTGGGTAGAGAGG + Intronic
1120478075 14:85013911-85013933 CAGGGATTTTGGGGGAAGAGTGG + Intergenic
1126145547 15:45469990-45470012 CAGTTTTTTCGTTGGTAAAGTGG - Intergenic
1126694512 15:51314652-51314674 TAGGATTTTGGTGGGTAGAGAGG - Intronic
1127925419 15:63535722-63535744 CCCAGTTTTCCTGGGTAGAGGGG + Intronic
1130927685 15:88397597-88397619 CACGGTTTTCGGGGGTAGGCAGG + Intergenic
1132148425 15:99442728-99442750 GAGGGTTTTCCTGGCTAGCGCGG - Intergenic
1135077061 16:19402888-19402910 CAGGGTTTTATTGGGTGGAAAGG + Intergenic
1135964708 16:27025952-27025974 GAGGGTTGCCGTGGGTAGAGAGG + Intergenic
1136398716 16:30006462-30006484 CAGGGTCTTGGTGGCCAGAGTGG + Exonic
1137613367 16:49833778-49833800 CAGGGATTTCGTGGGAAGGGAGG + Intronic
1138129094 16:54463812-54463834 CAAGGTTTTCATGGTTGGAGTGG + Intergenic
1139474801 16:67197802-67197824 CTGGGCTTTGGTGGGTGGAGAGG + Intronic
1141195488 16:81857601-81857623 CAGGGTGTGCTTGGATAGAGAGG + Intronic
1149094467 17:52824567-52824589 CAGGGTTTTATTGGGTAAAAAGG + Intergenic
1150633286 17:66895499-66895521 CAGGGGTTTTGAGGGTAGTGTGG - Intergenic
1151336223 17:73441195-73441217 CAGGGTGGTGGTGGGGAGAGGGG - Intronic
1151336995 17:73445892-73445914 CAGGGCTTGGGTGGGTACAGGGG + Intronic
1152713861 17:81888822-81888844 CGGGGTGCTCGTGGGTGGAGAGG + Intronic
1153482609 18:5562739-5562761 CAGGGGCTTCGTGGAGAGAGAGG - Intronic
1156698970 18:39800202-39800224 CAGGGTTTTATTGGGTAAAAAGG + Intergenic
1158725572 18:59968729-59968751 CAGGGTTTTAGAGGGTGGAGAGG + Intergenic
1161131017 19:2588708-2588730 CAGGGTTGTCCTGGTTGGAGTGG + Intronic
1161575061 19:5050508-5050530 CAGGGTCTTCCTGGGTGGGGTGG + Intronic
1162323001 19:9980840-9980862 CAGGGTTCCCGTGGAGAGAGGGG - Exonic
1165850682 19:38848879-38848901 CAGGGTTTTCCAGGGTTTAGGGG - Intronic
1168607246 19:57769906-57769928 CAGGGTCTGGGTGGGTAGGGTGG - Intronic
926121557 2:10243770-10243792 CAGGGTTTGAGTGGGGGGAGAGG - Intergenic
926409671 2:12589987-12590009 CAGGGTTTCTGTGGGAAGAAGGG + Intergenic
928489290 2:31764756-31764778 CAGGGTCTTTGTCAGTAGAGGGG + Intergenic
929948458 2:46388344-46388366 CAGGGTTTGCTTGCCTAGAGGGG - Intergenic
931050802 2:58412237-58412259 AAGGGTTTTCATAGCTAGAGAGG + Intergenic
931425002 2:62162660-62162682 CAGGCCTTGGGTGGGTAGAGGGG + Intergenic
932026919 2:68143147-68143169 CAGGCTTTTGGTGGGTGCAGTGG - Intronic
938987173 2:136588427-136588449 TAGGGCTTTCGTAGCTAGAGAGG - Intergenic
939949703 2:148455356-148455378 CAGCCTTTTCTTGGGAAGAGAGG + Intronic
941249786 2:163147784-163147806 TAGGGTGTCCATGGGTAGAGTGG + Intergenic
941268809 2:163399385-163399407 CAGGACTTTCCTAGGTAGAGTGG - Intergenic
943905795 2:193500065-193500087 TAGGGTTTTCATAGCTAGAGAGG + Intergenic
944411349 2:199446242-199446264 CAGGGTTTTCTTGTATACAGGGG + Intronic
946313932 2:218897457-218897479 CTGGGGTTTCGTGGGTTGGGGGG - Intronic
1171196237 20:23201677-23201699 CAGGGTTTTCTTGAGTAGTTTGG + Intergenic
1171494019 20:25542141-25542163 CAGGGTTTTGGTTGGTCTAGTGG + Intronic
1171957907 20:31474035-31474057 AAGGGTTTTCCTGGGAGGAGAGG + Intronic
1172891619 20:38269995-38270017 CACGGAGTTAGTGGGTAGAGAGG - Intronic
1177664630 21:24138653-24138675 TAGGGTTTTCATAGCTAGAGAGG + Intergenic
1179360266 21:40699964-40699986 CAGGATTTTCATAGCTAGAGAGG + Intronic
1179544538 21:42105438-42105460 CAGGGATGTCGTGGGTAGAATGG + Intronic
1179728935 21:43356520-43356542 CAGGGTGCTCTTGGGAAGAGGGG - Intergenic
1179987442 21:44929512-44929534 CAGGGGCTTCCTGGGTGGAGGGG - Intronic
1179987576 21:44930154-44930176 CAGGGGCTTCCTGGGTGGAGGGG - Intronic
1181499359 22:23307002-23307024 CTGGGTTTTCAAGGGGAGAGGGG + Intronic
1183728709 22:39604988-39605010 CAGGGGTGGCGTGGGTGGAGAGG + Intronic
956877163 3:73475205-73475227 CAGGGTCTTCTTGGTTAAAGGGG - Intronic
956921744 3:73937306-73937328 CAGTGTTTTCATCGGTAAAGTGG - Intergenic
959341418 3:105136209-105136231 CTGTGTTTTCGTGTGTATAGAGG + Intergenic
959592266 3:108093164-108093186 AAGGAGTTTCTTGGGTAGAGAGG + Intergenic
959873570 3:111356134-111356156 TAGGATTTTCATGGCTAGAGAGG + Intronic
960180338 3:114568267-114568289 CAGGTTTTTCGTGGGGGGAGAGG - Intronic
961434200 3:126905378-126905400 CAGGAGTTTCTTGGGTAGATAGG + Intronic
961646229 3:128394158-128394180 CAGGGTGAGCGTGGGTACAGGGG - Intronic
961811951 3:129527199-129527221 CAGTGTTTTTGTGGGGTGAGGGG - Intergenic
966298849 3:178456016-178456038 CAGGGTTTTATTGGGTGAAGAGG + Intronic
967045404 3:185732123-185732145 CAGGGTTCCCGGGGGCAGAGAGG - Intronic
967303811 3:188041759-188041781 CAGGGTTTTCGGGGGTTGGGGGG + Intergenic
969251061 4:5969197-5969219 AAAAGTTTTCGTGGGGAGAGAGG - Intronic
969457541 4:7308689-7308711 CAGGGTGCTGGTGGGAAGAGGGG - Intronic
970438144 4:16055566-16055588 AAGGGTTTTCGTCTGAAGAGAGG + Intronic
974089050 4:57291610-57291632 CTGGGTTTTGGTGGTTTGAGTGG - Intergenic
974123294 4:57665569-57665591 CAGGGTTTTGATGGGTAGGTAGG - Intergenic
976344921 4:83989649-83989671 CAGGGTTTTATTGGGTAAAAAGG - Intergenic
978440897 4:108732172-108732194 CATGTTTTTGGTGGTTAGAGTGG - Intergenic
978551756 4:109935023-109935045 TAGGATTTTCTTGGGTATAGGGG + Intronic
978683914 4:111415875-111415897 GAAGGTTTTCCTGGGGAGAGGGG - Intergenic
984685612 4:182665073-182665095 TAGGGTTTTCATAGCTAGAGAGG + Intronic
985383253 4:189418248-189418270 CAGGGTTTGTGTGGGATGAGTGG + Intergenic
990743791 5:58937682-58937704 CAGGGCTTGTGTGGGTCGAGGGG + Intergenic
992990133 5:82275276-82275298 CAGAGTTTTCATGGATACAGTGG - Exonic
996661538 5:126009244-126009266 CAGGGTTTTATTGGGTATAAAGG - Intergenic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
999008354 5:148006539-148006561 CAGGGTTTTATTGGGTACAAAGG - Intergenic
999714860 5:154352490-154352512 CAGGGTTTTCATGGGCAAAATGG - Intronic
1000030990 5:157401373-157401395 CAGGGTGTGCGTGGGTTGTGAGG - Intronic
1001234405 5:170017403-170017425 CAGGGATTTCCTGGGAAGTGAGG - Intronic
1003556904 6:7148096-7148118 CAGGGTATACGTGGGGGGAGAGG + Intronic
1003860665 6:10319381-10319403 CAGGTTTTCCGTGGGGATAGAGG + Intergenic
1004998161 6:21214438-21214460 CAGTGTTCTCGAGGGGAGAGAGG - Intronic
1007073800 6:39054245-39054267 CTGGGTGGTCGTGGGTGGAGGGG - Intronic
1007314791 6:40978772-40978794 CAGGGTGTTAGTGGGTACTGGGG + Intergenic
1007578206 6:42939402-42939424 CAGGGTTGTCTTGGGGTGAGGGG + Intergenic
1010453748 6:76031036-76031058 CAGGGTTTTATTGGGTGGAAAGG - Intronic
1011355501 6:86469196-86469218 CAGTCTTTCAGTGGGTAGAGAGG - Intergenic
1012320464 6:97838516-97838538 CAGGGTCTTGGGGGGAAGAGTGG + Intergenic
1013410119 6:109876407-109876429 CAGGGTTTTATTGGGTAAAAAGG - Intergenic
1018067320 6:160133271-160133293 CAGGGGAGTCGTGGGTGGAGGGG - Intronic
1021775693 7:24053147-24053169 AAGGGTTTTAGTGAGTATAGCGG + Intergenic
1024043087 7:45570032-45570054 CAGGGTTATGGTCGGAAGAGAGG - Intergenic
1032005860 7:128301594-128301616 CTGGGTAGTCGTGGGTAGAGGGG - Exonic
1032436207 7:131902346-131902368 CAGGGATTACATGGCTAGAGAGG - Intergenic
1033661825 7:143408085-143408107 AAGGGGTTTCCTGGGTAGGGAGG + Intronic
1036759423 8:11496990-11497012 CAGGGTTCACGTGTATAGAGAGG + Intronic
1038405601 8:27320204-27320226 CAGGGTTTTATTGGGTGAAGAGG - Intronic
1038887598 8:31682112-31682134 CCAGGTTTTAGTGGGAAGAGAGG - Intronic
1040652304 8:49462930-49462952 CATGGATTTCGTGGACAGAGAGG - Intergenic
1040949726 8:52925195-52925217 CAGGGTTTTATTGGGTGGAAAGG - Intergenic
1044807789 8:96026160-96026182 AAGACTTTTCGTGGCTAGAGAGG + Intergenic
1045650277 8:104335909-104335931 CAGGGGTCTGGTGGGTAGAGAGG + Intronic
1046819150 8:118617524-118617546 CATGTTTTTCTTGGGGAGAGAGG + Intronic
1047673112 8:127170523-127170545 CAAGGTCTTTGTGGGGAGAGGGG + Intergenic
1048478252 8:134762816-134762838 CAGGTTTTTCAAGGGTAGAGAGG - Intergenic
1049241609 8:141540251-141540273 CAGGGTGTTAGTGGGTAATGAGG - Intergenic
1049696666 8:143987319-143987341 CTGGGTTTTGGTGGGCTGAGGGG - Intronic
1051117999 9:13719433-13719455 CATGTTTTTCATGGGTAGACAGG + Intergenic
1052794688 9:32912450-32912472 CAGGGTTTTACTAGGTGGAGGGG - Intergenic
1054743232 9:68829194-68829216 CAGGATTTTGGAGGGAAGAGGGG + Intronic
1055397668 9:75891730-75891752 GAGGGTGATCGTGGGGAGAGGGG + Intronic
1060212830 9:121720899-121720921 CAGGGTTTTCAAGGTCAGAGTGG - Intronic
1060551798 9:124489127-124489149 CAGGGCTTTGGTGGGAAGAGGGG + Intronic
1189322470 X:40095158-40095180 CAGGGTTTCAGCGCGTAGAGCGG - Intronic
1190246763 X:48696128-48696150 CAGGGCTATGGTGGGTGGAGAGG + Intronic
1190580681 X:51890978-51891000 CAGGATTTTTGTGGGGAGCGTGG - Intronic
1191783429 X:64892705-64892727 CAGGGTTCTGTTGGGCAGAGAGG + Intergenic
1192149377 X:68702516-68702538 CAGGGTTTTTGTAGTAAGAGTGG - Intronic
1193919070 X:87404293-87404315 CAGGGGTTGCGGGGGTAGGGGGG - Intergenic
1194188450 X:90805456-90805478 CAGGGTTTTCTTGGGTGAAAAGG + Intergenic
1198200038 X:134407161-134407183 CAGGGTGGTGGTGGGTGGAGGGG + Intronic
1198636655 X:138709559-138709581 CAGGGTTTTTGTTGGTAGGAAGG + Intronic
1198647335 X:138823470-138823492 CAGGGTTTTATTGGGTAAAAAGG - Intronic
1200535039 Y:4387354-4387376 CAGGGTTTTCTTGGGTGAAAAGG + Intergenic
1202093092 Y:21214548-21214570 CAGGGTTTTATTGGGTAAAAGGG - Intergenic