ID: 1119285712

View in Genome Browser
Species Human (GRCh38)
Location 14:73452566-73452588
Sequence AGGGTTTTCGTGGGTAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119285703_1119285712 28 Left 1119285703 14:73452515-73452537 CCGTCTCAAAAAAAAGGAACGTA 0: 1
1: 2
2: 79
3: 1753
4: 14842
Right 1119285712 14:73452566-73452588 AGGGTTTTCGTGGGTAGAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119285712 Original CRISPR AGGGTTTTCGTGGGTAGAGA GGG Intronic
900042394 1:483231-483253 AGGGTTTTTGGGGGCACAGAGGG - Intergenic
900703219 1:4060774-4060796 AGGGTCTTCGTGGAAACAGACGG - Intergenic
901736118 1:11313227-11313249 AGTTTTTTCTTTGGTAGAGATGG + Intergenic
903031039 1:20464587-20464609 TGGGCTTTGGAGGGTAGAGAAGG - Intergenic
904498648 1:30901709-30901731 AGGGTTTTCTTTTGGAGAGAGGG - Intronic
905881772 1:41468615-41468637 AGGGGTGGGGTGGGTAGAGATGG + Intergenic
905940148 1:41856733-41856755 AGGGAGTTTCTGGGTAGAGATGG - Intronic
905950938 1:41949962-41949984 AGGGTTTTCCTGTTGAGAGAGGG + Intronic
907520706 1:55021708-55021730 AGGGGCTTCCTGGGAAGAGAGGG + Intergenic
910607916 1:89107477-89107499 AGGGTTTACATGGACAGAGAAGG + Intronic
916792657 1:168137114-168137136 AGGCTGTTCGTGGGAAGAAATGG - Intronic
917254942 1:173104006-173104028 AGGGAAGTGGTGGGTAGAGAAGG - Intergenic
918524210 1:185447295-185447317 AGGGCTGTCCTGGGGAGAGATGG + Intergenic
920496574 1:206459127-206459149 AGGTTCTTCCTGGGGAGAGAGGG - Intronic
920939020 1:210463323-210463345 AGTGGTTTCTTGGGGAGAGAGGG - Intronic
921916487 1:220617328-220617350 AAGGTTGTGGTGGGTAGGGAGGG + Intronic
924480038 1:244421806-244421828 AGGTTTTTTTTTGGTAGAGATGG - Intronic
1064007781 10:11712227-11712249 AGGAATTTCGTGGTGAGAGAGGG - Intergenic
1064031375 10:11885397-11885419 AGGGGATGGGTGGGTAGAGATGG + Intergenic
1064031396 10:11885475-11885497 AGGGGATGGGTGGGTAGAGATGG + Intergenic
1064111852 10:12546488-12546510 AGGGCCTTTGTGGGTAGAGAAGG + Intronic
1065059211 10:21880874-21880896 AGGACTTTCATGGCTAGAGAGGG - Intronic
1066275092 10:33861000-33861022 AGAGAATTCGTGGGCAGAGACGG - Intergenic
1071893867 10:90042350-90042372 AGGGAAGTCCTGGGTAGAGAAGG - Intergenic
1074536259 10:114330343-114330365 AGGGTTTATGTGGGTAGCCAGGG - Intronic
1074592150 10:114822595-114822617 TTGGTTTTCGGGGGTAGAGGTGG + Intronic
1075295750 10:121273492-121273514 AGGGTTTTCTTAGGTTAAGAGGG - Intergenic
1075638538 10:124047923-124047945 AGGGGTGGCGTGGGTAGAGTTGG - Intronic
1076207163 10:128612496-128612518 AGAGTTTGCCTGGGGAGAGAGGG - Intergenic
1076980268 11:200390-200412 AGGGTCTGTGTGGGGAGAGATGG + Intronic
1078193598 11:9115227-9115249 AGGACTTTCATGGCTAGAGAGGG - Intronic
1078652028 11:13204935-13204957 AAGGTTTTCCTGAGCAGAGAGGG - Intergenic
1078858546 11:15226388-15226410 AAGGTTTTCTTTGGTAGAAAGGG + Intronic
1081719001 11:45273047-45273069 AGGGTTTTTGCAGGAAGAGATGG + Intronic
1085282713 11:75341464-75341486 GGGGTTTCTGTGGGCAGAGAGGG - Intronic
1085435199 11:76493554-76493576 GGGGTTTTCATGGGTTCAGAAGG - Intronic
1090788703 11:130070768-130070790 AGGGTTTCAGTGAGTAGGGAAGG + Intronic
1091389016 12:114169-114191 TGGATTTTCGAGGGCAGAGAGGG + Intronic
1091842796 12:3632736-3632758 AGGGTTGTCGTGGACATAGATGG + Intronic
1091911182 12:4231852-4231874 AGGATTTTCATAGGGAGAGATGG - Intergenic
1092213866 12:6666998-6667020 AGGGTCTTTGTAGGCAGAGAAGG + Exonic
1092749520 12:11705785-11705807 AGGGTTTGAGTGGGCAGACAGGG - Intronic
1097826504 12:64179690-64179712 AGGGTTTTGGCAGGTAAAGATGG + Intergenic
1099244892 12:80182572-80182594 TGGCTTTTCCAGGGTAGAGAAGG + Intergenic
1100493033 12:95099368-95099390 AGTGTGTTGGTGGGAAGAGATGG + Intronic
1101841103 12:108328083-108328105 AGGCTTTTCATGGGGTGAGAGGG + Intronic
1102798610 12:115711546-115711568 ATGGTGGTGGTGGGTAGAGATGG - Intergenic
1107337024 13:39365999-39366021 AGGGTTTTCAAGGGAAGAAAGGG - Intronic
1113011431 13:105771942-105771964 AAGGTTTTCATGGGTAGTTATGG - Intergenic
1113433243 13:110268348-110268370 AGGGATTTCTTGGGTGGGGAGGG + Intronic
1114543753 14:23483270-23483292 ATGGCTTTCCTGGGAAGAGAGGG - Intronic
1116180369 14:41524528-41524550 ATGGTGTTGGTGGGCAGAGAGGG - Intergenic
1116961673 14:50973587-50973609 AGGGTTTTCATGGGCTCAGAAGG - Intergenic
1117214992 14:53541881-53541903 AGGCTTTTTGTGTGTTGAGAGGG - Intergenic
1117844222 14:59894192-59894214 ATGGTGTTAATGGGTAGAGAAGG - Intergenic
1119285712 14:73452566-73452588 AGGGTTTTCGTGGGTAGAGAGGG + Intronic
1120471685 14:84933616-84933638 AGGTTATTCGGGGGTACAGATGG + Intergenic
1122134361 14:99624381-99624403 AGGGTTATGGTGGGGACAGAAGG + Intergenic
1128208803 15:65876869-65876891 AGGCTGTTAGTGGGTAGGGAAGG - Intronic
1128749006 15:70135117-70135139 AGGGTGTCCATGGGTGGAGAAGG - Intergenic
1130927686 15:88397598-88397620 ACGGTTTTCGGGGGTAGGCAGGG + Intergenic
1131019999 15:89089283-89089305 AGTGCATTTGTGGGTAGAGAAGG - Intronic
1132148424 15:99442727-99442749 AGGGTTTTCCTGGCTAGCGCGGG - Intergenic
1135077062 16:19402889-19402911 AGGGTTTTATTGGGTGGAAAGGG + Intergenic
1135964709 16:27025953-27025975 AGGGTTGCCGTGGGTAGAGAGGG + Intergenic
1137373599 16:47931985-47932007 AGGTTTCTCGTGGTTGGAGAAGG - Intergenic
1137407449 16:48200724-48200746 AGGATTTTTGGGGGTAGGGAAGG + Intronic
1141195489 16:81857602-81857624 AGGGTGTGCTTGGATAGAGAGGG + Intronic
1141875301 16:86819951-86819973 GGGGTTCTCGTGGGTGGAGGAGG + Intergenic
1141876302 16:86827017-86827039 AGGGTTATTGTGGGTTGAGTAGG + Intergenic
1144763114 17:17718466-17718488 AGGGTTTTGATGGGGAGAAAAGG + Intronic
1145289690 17:21533557-21533579 AGGGTTGTCGTGGGTAGTAAAGG - Exonic
1145416369 17:22716820-22716842 AGGGGTTTCCTTGGAAGAGAGGG + Intergenic
1148076287 17:44937234-44937256 AGGGTTTTTGAGGGAGGAGAGGG - Intronic
1153279517 18:3401192-3401214 AGACTTTACATGGGTAGAGATGG - Intergenic
1153455307 18:5274641-5274663 AGGGTGGTCGTGGGTAGAGGTGG + Intergenic
1153482608 18:5562738-5562760 AGGGGCTTCGTGGAGAGAGAGGG - Intronic
1156560341 18:38118171-38118193 AGGCTTTTCGTGGGTAATGAAGG + Intergenic
1156698971 18:39800203-39800225 AGGGTTTTATTGGGTAAAAAGGG + Intergenic
1159840350 18:73392082-73392104 AGTGTTTTCATGGGCAGAAAAGG + Intergenic
1161169132 19:2804316-2804338 AGGGGTTTTGTGGGTGGAGAAGG + Intronic
1162420127 19:10561405-10561427 AGGGCTTTGGTGGGCAGAGGAGG - Intronic
926091022 2:10049630-10049652 AGGGTTTCAGTAAGTAGAGATGG - Intronic
926924444 2:17972966-17972988 AGGTTGATCGTGGGTACAGAAGG + Intronic
927606762 2:24492176-24492198 AGGGGTTTCGGAGGTAGACATGG + Exonic
930343080 2:50142303-50142325 AGGGTGTTCATGTGTAGAAAGGG + Intronic
930576085 2:53150514-53150536 AGGGTGTGGGTGGGGAGAGAGGG + Intergenic
931551256 2:63449632-63449654 GGGGTTTGTGTGGGTAGAGGAGG - Intronic
931735340 2:65188600-65188622 TGGGTTTTTTTGGCTAGAGATGG + Intergenic
933774950 2:85766270-85766292 AGGGATTTTGGGGGTCGAGATGG + Intronic
936851597 2:116905530-116905552 AGGCTTTACTTGGATAGAGAAGG + Intergenic
938285276 2:130108851-130108873 AGAGTTTGAGTCGGTAGAGAAGG - Intronic
942179870 2:173370291-173370313 AGAGTTTTCTGAGGTAGAGATGG + Intergenic
943160397 2:184242706-184242728 AGGAGTTTTTTGGGTAGAGAAGG - Intergenic
943192931 2:184704214-184704236 GGGGTTGCCGTGAGTAGAGATGG - Intronic
945502508 2:210593397-210593419 AGGGTGTTGGAGGGGAGAGAGGG + Intronic
1169126763 20:3133925-3133947 GGGGGTTTTTTGGGTAGAGATGG + Intronic
1172891618 20:38269994-38270016 ACGGAGTTAGTGGGTAGAGAGGG - Intronic
1173316483 20:41949215-41949237 TGGGTTTTCGGTGGTAGACAGGG + Intergenic
1176653820 21:9572497-9572519 AGGGGCTTCCTGGGAAGAGAGGG + Intergenic
1181901114 22:26156513-26156535 AGGGCTTTCCTGGGAAGAGCCGG + Intergenic
949852037 3:8429409-8429431 GGGGTTTTCGTGGGAAGGGATGG - Intergenic
950624181 3:14232290-14232312 AGGGTTTGAGAGGGAAGAGAAGG - Intergenic
950969570 3:17172873-17172895 AGGGTGTTAGTGAGTAGAAAGGG + Intronic
951383713 3:22018954-22018976 TAGGTGTTTGTGGGTAGAGACGG - Intronic
951432215 3:22621579-22621601 AGGGCTTTGGTGGTTAGAGATGG - Intergenic
953061777 3:39433910-39433932 AGGGTTTTGGTGTGGACAGAGGG - Intergenic
953199455 3:40765902-40765924 AGGATTTTAGTGGGTTGATAGGG + Intergenic
953289855 3:41649933-41649955 GGGGTTTTCATGGGCTGAGAAGG - Intronic
954425524 3:50440944-50440966 GGGGTTTTTGTGGGTGGACAGGG + Intronic
955111879 3:55958328-55958350 AGGGTTTTCATGGGCTCAGAAGG + Intronic
955235422 3:57134932-57134954 TGTGTTTTTGTTGGTAGAGATGG - Intronic
955371210 3:58353820-58353842 AGGGTTTGCATGGGAAGAAAGGG + Intronic
956623591 3:71245549-71245571 AGGGGGTGGGTGGGTAGAGAAGG - Intronic
957251810 3:77781271-77781293 ATAGCTTTGGTGGGTAGAGAAGG - Intergenic
959592267 3:108093165-108093187 AGGAGTTTCTTGGGTAGAGAGGG + Intergenic
960127582 3:114017253-114017275 AGGATGTTCCTAGGTAGAGATGG - Intronic
960180337 3:114568266-114568288 AGGTTTTTCGTGGGGGGAGAGGG - Intronic
961434201 3:126905379-126905401 AGGAGTTTCTTGGGTAGATAGGG + Intronic
961495407 3:127287825-127287847 AGAGTTTGCGTGGGTACAGGTGG - Intergenic
963385585 3:144588793-144588815 AGGGTTTTGGTGTTTGGAGATGG - Intergenic
963735084 3:149009966-149009988 AGGGTTATTGTGGGTAGTAAGGG + Intronic
966800819 3:183762278-183762300 AGGTTTGTGTTGGGTAGAGATGG + Exonic
967303812 3:188041760-188041782 AGGGTTTTCGGGGGTTGGGGGGG + Intergenic
976344920 4:83989648-83989670 AGGGTTTTATTGGGTAAAAAGGG - Intergenic
979354878 4:119691527-119691549 AGGGTGTGTGGGGGTAGAGATGG + Intergenic
979665872 4:123310516-123310538 AGGGCTTTAGTGTGGAGAGAAGG - Intronic
980438232 4:132809198-132809220 AGGGATGTGCTGGGTAGAGAAGG + Intergenic
981769801 4:148295545-148295567 GGAGTTTTGGTGGGCAGAGATGG - Intronic
985532324 5:441346-441368 GGGGTTTTTTTTGGTAGAGATGG + Intergenic
985566065 5:618149-618171 GGGGTGTTCCTGGGGAGAGACGG + Intronic
994059568 5:95459362-95459384 AGGTTTTTCGTGTGGAAAGAAGG - Intergenic
994674393 5:102802945-102802967 ATGTTTTTTGTGTGTAGAGATGG - Intronic
996259812 5:121452736-121452758 AGGGTAGTTGTGGGTGGAGATGG + Intergenic
997149267 5:131474568-131474590 AGTGCTTTCCTGGGGAGAGAAGG + Intronic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
998508565 5:142692158-142692180 GGGGTTTTTTTTGGTAGAGAAGG - Intronic
998791991 5:145775661-145775683 AGGCTTTTAGTGGGAAGTGAAGG - Intronic
999008353 5:148006538-148006560 AGGGTTTTATTGGGTACAAAGGG - Intergenic
999081159 5:148844773-148844795 AGGTTTTGCGTGGGGAGTGATGG - Intergenic
1001234404 5:170017402-170017424 AGGGATTTCCTGGGAAGTGAGGG - Intronic
1002731449 5:181335698-181335720 AGGGTTTTTGGGGGCACAGAGGG + Intergenic
1003780388 6:9417841-9417863 TGTTTTTTCTTGGGTAGAGATGG + Intergenic
1003860666 6:10319382-10319404 AGGTTTTCCGTGGGGATAGAGGG + Intergenic
1003896591 6:10613981-10614003 AGGCTTTTAGGGAGTAGAGAAGG + Intronic
1003972175 6:11310313-11310335 GGGGTTTCAGTGGGCAGAGAGGG - Intronic
1005705056 6:28443287-28443309 AGGGTCTTCTTGGCCAGAGATGG - Intronic
1006300423 6:33191064-33191086 AGGGGCTGAGTGGGTAGAGATGG - Intronic
1008847292 6:55983425-55983447 AGGATGGGCGTGGGTAGAGAGGG - Intergenic
1010131583 6:72500385-72500407 AGGTTTTTCATGGTCAGAGAAGG + Intergenic
1015246756 6:131083379-131083401 AGTGTTTACCTGGGTAAAGAAGG + Intergenic
1015789089 6:136948448-136948470 AGCTTTTTTTTGGGTAGAGATGG + Intergenic
1015919790 6:138255422-138255444 AGGTTTTTCCTGGGAAGAGATGG - Exonic
1017507584 6:155082644-155082666 GGGGTTTTTTTGGGTTGAGATGG - Intronic
1018297941 6:162369327-162369349 AGAGTTTTCTTAGCTAGAGACGG - Intronic
1019425343 7:973497-973519 AAGGTTTTTTTTGGTAGAGATGG - Intronic
1019727292 7:2610130-2610152 AAGTTCTTCGTGGGCAGAGACGG - Exonic
1020035304 7:4960014-4960036 AGGGGGTTAGTGGGAAGAGAGGG + Intergenic
1024931748 7:54671725-54671747 AGGGTTTTTGTGGGAAAAAATGG - Intergenic
1025059604 7:55794141-55794163 AGGGTTTTTGAGGGCACAGAAGG - Exonic
1025280164 7:57621163-57621185 AGGGGCTTCCTGGGAAGAGAGGG + Intergenic
1025304569 7:57844338-57844360 AGGGGCTTCCTGGGAAGAGAGGG - Intergenic
1026496224 7:70906065-70906087 AAGGTGCTGGTGGGTAGAGAAGG + Intergenic
1026590182 7:71687614-71687636 TGGGTTTTCGTGGATGGAAAGGG - Intronic
1028837449 7:95390632-95390654 AGGCTTTACGTTGGAAGAGAAGG - Intronic
1029450611 7:100640251-100640273 TGTGTTTTCTTTGGTAGAGACGG + Intronic
1030852359 7:114505736-114505758 AGGGTTTTTGTGTGTTCAGAAGG + Intronic
1034252164 7:149701397-149701419 AGGGTTTTCATGGGCTCAGAAGG + Intergenic
1035114659 7:156514593-156514615 GGGGTTTGAATGGGTAGAGACGG - Intergenic
1036782552 8:11659516-11659538 AGGGTTTTGGTGGAGGGAGAAGG - Intergenic
1036784733 8:11678534-11678556 AGGGTTTTAGTGGGAAAAGCAGG + Intronic
1038350436 8:26771469-26771491 AGGGTTTGGGTAGGTAGAGAAGG - Intronic
1038405600 8:27320203-27320225 AGGGTTTTATTGGGTGAAGAGGG - Intronic
1038471658 8:27828588-27828610 AATTTTTTCGTGTGTAGAGATGG - Intronic
1038887597 8:31682111-31682133 CAGGTTTTAGTGGGAAGAGAGGG - Intronic
1039417171 8:37405660-37405682 ATGGGTTTGGTGGGTAGCGAAGG - Intergenic
1040652303 8:49462929-49462951 ATGGATTTCGTGGACAGAGAGGG - Intergenic
1040949725 8:52925194-52925216 AGGGTTTTATTGGGTGGAAAGGG - Intergenic
1041516516 8:58705400-58705422 AGGGTTCTCATGAGTAGGGAAGG + Intergenic
1042572551 8:70182329-70182351 AGGGTTTTGCTGGGTGGAGATGG - Intronic
1042796052 8:72664508-72664530 AGGGTTTTATTTGGTAGAGGTGG - Intronic
1053482163 9:38423929-38423951 GGGGATTGGGTGGGTAGAGAAGG - Intronic
1055397669 9:75891731-75891753 AGGGTGATCGTGGGGAGAGGGGG + Intronic
1055706748 9:79013679-79013701 AGGGTCTTCCTGAGCAGAGAAGG - Intergenic
1056476188 9:86953493-86953515 TGGGTGTTCTTTGGTAGAGATGG - Intergenic
1057963155 9:99476720-99476742 AGGGTTTTCATGGTTAGTGCAGG - Intergenic
1060948043 9:127581893-127581915 AGGGATTACATGGGGAGAGAGGG - Intergenic
1060948084 9:127582024-127582046 AGGGATTACATGGGGAGAGAGGG - Intergenic
1060948093 9:127582051-127582073 AGGGATTACATGGGGAGAGAGGG - Intergenic
1061206476 9:129166861-129166883 GGGGTGGTCCTGGGTAGAGATGG + Intergenic
1062462507 9:136667816-136667838 GGGGTGTTCGTGGGCAGAGCTGG - Intronic
1203631541 Un_KI270750v1:75949-75971 AGGGGCTTCCTGGGAAGAGAGGG + Intergenic
1187665594 X:21605743-21605765 TGGGAATTCGTGGGTGGAGAGGG + Intronic
1188816445 X:34720459-34720481 ATGGTTTTCATAGGTAGAAATGG + Intergenic
1189675324 X:43455564-43455586 AGGGTGTAAGTGGGTGGAGAAGG - Intergenic
1190600757 X:52089621-52089643 AGGGATGTGCTGGGTAGAGAAGG + Intergenic
1191974966 X:66861672-66861694 AGGGATGTGCTGGGTAGAGAAGG - Intergenic
1195615869 X:106911475-106911497 AGGGGTTTGGGGGGTGGAGATGG - Intronic
1196008595 X:110862286-110862308 AAGGTTTTTTGGGGTAGAGATGG + Intergenic
1196685034 X:118503684-118503706 AGGGTTCTCGAGGGCAGAGGTGG + Intronic
1197653633 X:129092079-129092101 AGGATTTTGATAGGTAGAGATGG - Intergenic