ID: 1119286950

View in Genome Browser
Species Human (GRCh38)
Location 14:73462859-73462881
Sequence TATTATGTAAAGCAGGCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119286950_1119286954 1 Left 1119286950 14:73462859-73462881 CCTTCCGCCTGCTTTACATAATA 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1119286954 14:73462883-73462905 GGCTTGAGCGCTTGTAAAAATGG 0: 1
1: 0
2: 0
3: 4
4: 58
1119286950_1119286955 5 Left 1119286950 14:73462859-73462881 CCTTCCGCCTGCTTTACATAATA 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1119286955 14:73462887-73462909 TGAGCGCTTGTAAAAATGGATGG 0: 1
1: 0
2: 0
3: 1
4: 110
1119286950_1119286956 6 Left 1119286950 14:73462859-73462881 CCTTCCGCCTGCTTTACATAATA 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1119286956 14:73462888-73462910 GAGCGCTTGTAAAAATGGATGGG 0: 1
1: 0
2: 0
3: 2
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119286950 Original CRISPR TATTATGTAAAGCAGGCGGA AGG (reversed) Intronic
900056228 1:632995-633017 TGTTATGTAAAGGATGCGTAGGG - Intergenic
905840525 1:41173534-41173556 TATTATGGAAAACAGGATGAAGG + Intronic
909279032 1:73725285-73725307 TATTATGAAAAGCAGCCATAAGG - Intergenic
911160911 1:94682502-94682524 TATTTTGAAAAACAGGCTGACGG + Intergenic
913391009 1:118312396-118312418 TATCCTGTAAAGCTGGCTGAAGG + Intergenic
921640796 1:217550755-217550777 AATTATGTAAAGCAGACTAATGG - Intronic
924384879 1:243491147-243491169 TGTGCTGTAAAGCAGGCAGATGG - Intronic
924693168 1:246371880-246371902 AAATATTTAAAGCAGGCAGAAGG - Intronic
1066294244 10:34040420-34040442 TATTAAGTAAAGCAGGCAGCTGG + Intergenic
1069017002 10:63441549-63441571 TATGATCTAATGCAGGAGGAAGG - Intronic
1081489565 11:43556902-43556924 ATCTATGTAAAGCATGCGGAGGG + Intronic
1081921495 11:46781785-46781807 GTTTATGTAAAGCAGGATGAAGG - Intronic
1084440255 11:69168674-69168696 TATTAAGTAAAAGAGGAGGAGGG - Intergenic
1085362147 11:75899105-75899127 TATTTTGTAAGGCAGGGGAAAGG - Intronic
1091680452 12:2523089-2523111 TAATATGCAAAGCAGGTGGACGG + Intronic
1098729352 12:74013114-74013136 TGTTATGTAAACAAGGCTGATGG + Intergenic
1098932414 12:76434925-76434947 TATTATGGAAAGCAGTATGAAGG + Intronic
1107462971 13:40622610-40622632 AATTATGTCAAGCAGGCAGGAGG - Intronic
1108906754 13:55485347-55485369 CATTATGTAAAGCAGTAGGGAGG - Intergenic
1114132907 14:19813723-19813745 TATTATGTAAAGCTGGCATCTGG - Intronic
1119286950 14:73462859-73462881 TATTATGTAAAGCAGGCGGAAGG - Intronic
1123575997 15:21669547-21669569 TATTATGTAAAGCTGGCATCTGG - Intergenic
1123612618 15:22112021-22112043 TATTATGTAAAGCTGGCATCTGG - Intergenic
1126429871 15:48571164-48571186 TGTTATTTAAATCAGGCTGATGG - Intronic
1130329537 15:82910620-82910642 TATTATCTAAAGCAGGCATCTGG - Intronic
1202984865 15_KI270727v1_random:403792-403814 TATTATGTAAAGCTGGCATCTGG - Intergenic
1135527043 16:23221539-23221561 TTTTATTAAAAGGAGGCGGAAGG - Intergenic
1145339715 17:21943688-21943710 TAGTATGTAAAGCAATCGAATGG + Intergenic
1146494111 17:33305278-33305300 TATCATGTAATGCAGGAGGCCGG - Intronic
1147617198 17:41836403-41836425 TATTATGAAGAGCAGGGTGAAGG + Intronic
1149349846 17:55775374-55775396 TCTTGTGCAAAGCAGGCTGATGG - Intronic
1151980767 17:77507127-77507149 TAGTTTGTAAATCAGGCAGATGG - Intergenic
1154458930 18:14559622-14559644 TATTATGTAAAGCTGGCATCTGG - Intergenic
1161316480 19:3619812-3619834 TTGTCTGTAAACCAGGCGGATGG + Intronic
1161678694 19:5667911-5667933 CAATATGCAAAGCAGGGGGAAGG - Intronic
1164282366 19:23780180-23780202 TATTGTATAAAGCACTCGGATGG + Intronic
1164312963 19:24062175-24062197 TATTGTGTAAAGCACTTGGATGG + Intronic
1164879308 19:31717658-31717680 TTTTATATAAAGCAGGAGAAGGG + Intergenic
925461910 2:4070457-4070479 TATTTTGTGAAGCAGGAGGCAGG - Intergenic
929593471 2:43161556-43161578 TGTTATATAATGCAGGCAGAGGG + Intergenic
930613419 2:53568178-53568200 CATTATGTCAAGTAGGAGGATGG - Intronic
933432053 2:82194727-82194749 TATTATGAAAAACAGTAGGAAGG + Intergenic
934511459 2:94947558-94947580 CAGTATATAAAGCATGCGGAGGG + Intergenic
937648144 2:124288588-124288610 TATTATCCAAAGCATGCTGAAGG - Intronic
941277683 2:163511087-163511109 TATGATGTAGAGAAGGCAGAGGG + Intergenic
945445981 2:209939250-209939272 CCTTCTGTAAAGCAGGCAGAAGG + Intronic
1173546379 20:43901405-43901427 GTTTATGTGAAGCAGGGGGATGG + Intergenic
1175012304 20:55750890-55750912 TATTAAGTAAAGCAGGTAGTTGG + Intergenic
1176815212 21:13593703-13593725 TATTATGTAAAGCTGGCATCTGG + Intergenic
1177439932 21:21109876-21109898 TATAATGTAAAGGAGGCACAGGG + Intronic
1178771549 21:35509395-35509417 GATTTTGTAAAGCAGGCTTAAGG - Intronic
1181625069 22:24117714-24117736 TTTTATGGAAAGCAGGCAGAGGG - Intronic
1183138701 22:35915615-35915637 AATTATGTAAACCAGGGTGAGGG + Intronic
1183997482 22:41645977-41645999 TATTCTTCAAAGCAGGAGGAAGG + Intronic
1185403564 22:50631817-50631839 TATTATCTAAAGCAGGCATCTGG - Intergenic
955324212 3:57997287-57997309 TTTATTGTAAAGCAGGAGGAGGG - Intergenic
955963652 3:64365987-64366009 GCTTATGGAAAGCAGGCGGAAGG - Intronic
958619842 3:96543817-96543839 TATGAAGTAAAGCTGGTGGATGG + Intergenic
959051960 3:101532999-101533021 TATTATCTAAAGCAGGCATCTGG - Intergenic
962514443 3:136137162-136137184 AATTATGTAAAGAAGGCTAAAGG + Intronic
963456096 3:145549853-145549875 TATTATCTAAAGCAGGCATCTGG - Intergenic
963587640 3:147213284-147213306 TATTATGGAAAGCAGTACGAAGG + Intergenic
965748781 3:171955246-171955268 TATTGTGTAAGGCAGGAAGATGG - Intergenic
972336508 4:38111672-38111694 TAGTAGGAAAAGCAGGGGGAGGG + Intronic
976349376 4:84043499-84043521 TATTTTGTAAAACAGCAGGAGGG + Intergenic
977369382 4:96115768-96115790 TTTTAATTAAAGCAGGCTGAAGG + Intergenic
980065535 4:128184119-128184141 TATTATATAAAGCAGTGGCAGGG + Intronic
980128763 4:128799053-128799075 TATTATCTAAAGCAGGCATCTGG - Intergenic
986891010 5:12305622-12305644 TATTATGAAAACCATGTGGAGGG + Intergenic
987835794 5:23159774-23159796 TATTATCTAAAGCAGGCTTCAGG - Intergenic
998181867 5:139951651-139951673 TAGGATGAAAGGCAGGCGGATGG - Intronic
999233233 5:150074954-150074976 TATAATGAAAAGGAGGAGGATGG - Intronic
999401743 5:151269631-151269653 TATTATCTAAAGCAGGCATCTGG + Exonic
1003694366 6:8388512-8388534 TATTATCTAAAGCTGGCGTCTGG + Intergenic
1007853682 6:44831616-44831638 TATTATTTAAAGCACAGGGATGG + Intronic
1010000428 6:70943461-70943483 AATTATGTGAAGCAGGCTCAGGG - Intronic
1011453713 6:87524264-87524286 GATTTGGTAAAGCAGGCTGAGGG - Intronic
1013694118 6:112681227-112681249 CATTATGTAAAGGAGGAGGATGG - Intergenic
1017210692 6:151852374-151852396 TATTATGAAAATCAAGAGGAAGG - Intronic
1020777949 7:12479484-12479506 TGTTATGAAAACCAGGCTGAGGG - Intergenic
1037030722 8:14101518-14101540 TATTATTTAAAGCAGACAGCAGG + Intronic
1037197902 8:16214615-16214637 TTTTATGTAAAGCAGGCTGCTGG + Intronic
1039354600 8:36801193-36801215 TATTATCTAAAGCAGGCATCTGG - Intronic
1043719361 8:83527721-83527743 TATTCTGTAAATCAGGCAAAAGG - Intergenic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1044832890 8:96267566-96267588 TATCAAGTAAAGCAGGAGAAAGG - Intronic
1045421981 8:102025527-102025549 TATTATGTACAGAAGGAGTAAGG - Intronic
1048407771 8:134140528-134140550 TATTATTTCAAGCAGGGTGATGG - Intergenic
1050784109 9:9377605-9377627 TTTTATGTAAAGCTGGGGGTTGG - Intronic
1050931990 9:11340658-11340680 TATTATATAAAGCAGATGCAGGG - Intergenic
1051726900 9:20097324-20097346 TATAATATAAAGCAGGTTGAAGG - Intergenic
1055760772 9:79605056-79605078 TAAAATGTAAAGCAGGCAGCTGG + Intronic
1058408142 9:104700419-104700441 TATTATCTAAAGCAGGCATCTGG + Intergenic
1059595249 9:115713251-115713273 TATTATCTAAAGCAGGCATCTGG - Intergenic
1062303249 9:135887682-135887704 TACTATGTTAAGCAGGAGGCAGG + Intronic
1202629882 M:7824-7846 TGTTATGTAAAGGATGCGTAGGG - Intergenic
1203532146 Un_GL000213v1:155719-155741 TATTATGTAAAGCTGGCATCTGG - Intergenic
1203655307 Un_KI270752v1:18290-18312 TATTATGTAAAGGAGTCTGTGGG + Intergenic
1189692897 X:43635514-43635536 TATTATCTAAAGCAGGCATCTGG - Intergenic
1197362608 X:125524947-125524969 GATCATGTAAAGCAGGGAGAGGG - Intergenic
1198867619 X:141141438-141141460 CATTTTGTCAAGCAGGCTGACGG + Intergenic