ID: 1119288651

View in Genome Browser
Species Human (GRCh38)
Location 14:73476608-73476630
Sequence AGCCAGCAAGACCATACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119288651_1119288653 -10 Left 1119288651 14:73476608-73476630 CCCTCTGTATGGTCTTGCTGGCT No data
Right 1119288653 14:73476621-73476643 CTTGCTGGCTGACTGACTGAAGG No data
1119288651_1119288654 -9 Left 1119288651 14:73476608-73476630 CCCTCTGTATGGTCTTGCTGGCT No data
Right 1119288654 14:73476622-73476644 TTGCTGGCTGACTGACTGAAGGG No data
1119288651_1119288655 1 Left 1119288651 14:73476608-73476630 CCCTCTGTATGGTCTTGCTGGCT No data
Right 1119288655 14:73476632-73476654 ACTGACTGAAGGGTTCAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119288651 Original CRISPR AGCCAGCAAGACCATACAGA GGG (reversed) Intergenic
No off target data available for this crispr