ID: 1119288745

View in Genome Browser
Species Human (GRCh38)
Location 14:73477441-73477463
Sequence GGGAAGAAAGGATGTGATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119288735_1119288745 26 Left 1119288735 14:73477392-73477414 CCTCCATGCCCGGCCTTGCTTTT 0: 3
1: 43
2: 475
3: 3252
4: 14520
Right 1119288745 14:73477441-73477463 GGGAAGAAAGGATGTGATTAGGG No data
1119288739_1119288745 13 Left 1119288739 14:73477405-73477427 CCTTGCTTTTTATATTTTTGACA No data
Right 1119288745 14:73477441-73477463 GGGAAGAAAGGATGTGATTAGGG No data
1119288737_1119288745 18 Left 1119288737 14:73477400-73477422 CCCGGCCTTGCTTTTTATATTTT No data
Right 1119288745 14:73477441-73477463 GGGAAGAAAGGATGTGATTAGGG No data
1119288736_1119288745 23 Left 1119288736 14:73477395-73477417 CCATGCCCGGCCTTGCTTTTTAT No data
Right 1119288745 14:73477441-73477463 GGGAAGAAAGGATGTGATTAGGG No data
1119288738_1119288745 17 Left 1119288738 14:73477401-73477423 CCGGCCTTGCTTTTTATATTTTT No data
Right 1119288745 14:73477441-73477463 GGGAAGAAAGGATGTGATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119288745 Original CRISPR GGGAAGAAAGGATGTGATTA GGG Intergenic
No off target data available for this crispr